Cover for No Agenda Show 1214: Stanktuary
February 6th, 2020 • 2h 53m

1214: Stanktuary

Shownotes

Every new episode of No Agenda is accompanied by a comprehensive list of shownotes curated by Adam while preparing for the show. Clips played by the hosts during the show can also be found here.

SOTU
SOTU Trump’s hair was a helmet
SOTU 2 trillion MIC generals looking shifty
DHS suspends Global Entry, Trusted Traveler Programs for New York residents in response to sanctuary law | Fox News
Thu, 06 Feb 2020 06:06
Published February 05, 2020
Last Update 5 hrs ago
Acting Homeland Security Secretary Chad Wolf exclusively told Fox News' "Tucker Carlson Tonight" Wednesday that DHS was immediately suspending enrollment in Global Entry and several other Trusted Traveler Programs (TTP) for all New York state residents -- a dramatic move in response to the liberal state's recently enacted sanctuary "Green Light Law."
The sweeping order came a day after President Trump, in his State of the Union address, condemned left-wing states and local governments that "release dangerous criminal aliens to prey upon the public," and called on Congress to pass a law establishing civil liability for sanctuary cities.
In a letter to top New York state officials obtained exclusively by Fox News, Wolf noted that the New York law prohibited state DMVs from sharing criminal records with Customs and Border Protection (CBP) and Immigration and Customs Enforcement (ICE).
READ THE DHS LETTER SUSPENDING GLOBAL ENTRY, OTHER TTPs FOR NEW YORK
"In New York alone, last year ICE arrested 149 child predators, identified or rescued 105 victims of exploitation and human trafficking, arrested 230 gang members, and seized 6,487 pounds of illegal narcotics, including fentanyl and opioids," Wolf wrote. "In the vast majority of these cases, ICE relied on New York DMV records to fulfill its mission."
Illegal immigrants rushed to New York DMVs in large numbers after the law, which allowed them to obtain driver's licenses or learner's permits regardless of their immigration status, took effect last December. The law also permitted applicants to use foreign documents, including passports, to be submitted in order to obtain licenses.
The law, Wolf went on, "compromises CBP's ability to confirm whether an individual applying for TTP membership meets program eligibility requirements."
TRUMP, IN STATE OF THE UNION, TOUTS ICE AND SLAMS SANCTUARY CITIES
Because TTPs rely on states to verify individuals' identities, New York residents "will no longer be eligible to enroll or re-enroll" in select TTPs -- including Global Entry, NEXUS, SENTRI, and FAST.
Wolf noted that TTP "permits expedited processing into the U.S. from international destinations (under Global Entry); Canada only (under NEXUS); and Canada and Mexico only (under SENTRI)." Additionally, TTP allows quicker processing for commercial truck drivers entering or leaving the U.S. (under FAST).
TSA PreCheck was not among the TTPs affected by the order, a DHS official confirmed to Fox News.
Wolf further warned that because the New York law "hinders DHS from validating documents used to establish vehicle ownership, the exporting of used vehicles titled and registered in New York will be significantly delayed and could also be costlier."
He said DHS' assessment was ongoing and future enforcement action remained possible.
Responding to the news late Wednesday, Rich Azzopardi, a senior aide to New York Gov. Andrew Cuomo, told CNN: "This is obviously political retaliation by the federal government and we're going to review our legal options."
During his State of the Union address, Trump explicitly called out New York's sanctuary policies.
CLICK HERE TO GET THE FOX NEWS APP
"Just 29 days ago, a criminal alien freed by the Sanctuary City of New York was charged with the brutal rape and murder of a 92-year-old woman," Trump said. "The killer had been previously arrested for assault, but under New York's sanctuary policies, he was set free. If the city had honored ICE's detainer request, his victim would be alive today."
Fox News' "Tucker Carlson Tonight" investigative producer Alex Pfeiffer contributed to this report.
Cool NA Lights
ITM Adam,
I have been working with Mark Gonyea, one of your artists,
to print his art using my C02 Laser to engrave 4mm cast Acrylic which includes
a solid beach wood light base. We think it’s a great format for your
audience to display their support of the show on their desktop or to use as a
night light for their human resources.
Our plan is to use the value for value model and we will
share the proceeds with the No Agenda Show, the Artist, and my Shop. I
would appreciate if I can get a plug. The name of the shop on Etsy is “LaserKraftersllc”
no spaces and the K is not a misspelling. They can find it by going to
the Etsy webpage and searching under the shop name. These can be
customized with the producers name or title if they so choose.
Please let me know if you have any questions or comments.
Thanks,
Don Arsenych
Super owl
Super Bowl draws lowest TV audience in more than a decade: Nielsen
Mon, 03 Feb 2020 10:10
The 2019 Super Bowl was watched by the fewest people in 11 years, according to preliminary ratings figures from research firm Nielsen.
The CBS broadcast of Sunday's game between the Los Angeles Rams and the New England Patriots was watched by about 98.2 million people, Nielsen said late Monday. Those figures are the lowest since 2008, when 97.5 million tuned in.
The Patriots won 13-3 in the lowest-scoring Super Bowl in its 53-year history.
Ratings have fallen for the fourth year in a row: Last year, 103.5 million watched the NFL championship game, down from 111.3 million in 2017 and 111.9 million in 2016. Viewing figures peaked in 2015, when 114.4 million saw the New England Patriots beat the Seattle Seahawks 28-24.
Nielsen also said that 67 percent of U.S. homes with televisions in use were tuned into the broadcast on Sunday, compared with 68 percent in 2018.
Even though viewing figures went down, the cost of a 30-second ad spot during the big game broadcast increased. Super Bowl ad spots are the most expensive on commercial TV in the U.S. by far, with a 30-second slot on CBS costing $5.25 million this year. That's up slightly on the $5.2 million charged by NBC for ad spots in last year's game.
'-- Disclosure: NBC and CNBC are owned by Comcast's NBCUniversal unit.
WATCH: How Nike turns controversy into dollars
The Super Bowl Showed That the NFL Is Back on Top
Mon, 03 Feb 2020 10:08
The spirit of the evening. Photo: Rob Carr/Getty Images
The Super Bowl began with a compulsively likable kid running onto the field, trailed by 29 other adorable children, and celebrating at midfield like any of us would do if we had 70,000 people screaming for us and more than 100 million watching at home. The kid was the star of the NFL's ad campaign honoring its 100th season, in a commercial that featured the elusive scamp carrying a football past various NFL legends before finishing, live in front of the world, right there at midfield. It was charming and, for the NFL, the perfect capper on a season-long celebration of its anniversary, ending with the almost taunting benediction ''Here's to the next 100.'' For a sport that has spent the last decade frantically dodging existential threats like CTE, the Colin Kaepernick kerfuffle and the president, the slogan '-- we'll outlive you all '-- couldn't help but feel like a flex.
And why wouldn't it? On a gorgeous night in Miami Gardens, with the Rock on the pregame mic, dozens of NFL legends in attendance, resale ticket prices that were the most expensive in years (more than $7,000 get-in price), and, of course, J.Lo and Shakira, the NFL reached the absolute height of its powers, culminating in a terrific 31''20 Kansas City win over San Francisco in a matchup of two young, exciting teams with ravenous fan bases. It was a night in which all the NFL's troubles seemed far in the past, long forgotten, remembered only by the cynical and purposefully cranky. Everything fell perfectly in the league's direction. It was peak NFL.
All that was wrong with last year's widely panned Super Bowl was better this year. Last year's game featured zero passing touchdowns and barely any offense at all, with notorious bad guys New England winning in uninspired fashion; this one had last year's MVP, Patrick Mahomes, multiple lead changes, some juicy referee controversies, a wild comeback, and a crackerjack ending. Last year's halftime show featured Maroon 5, in Atlanta no less; this one had Jennifer Lopez and Shakira lighting the place on fire (while somehow also subtweeting the Oscars). Last year's game featured widespread backlash in the wake of the league's continued blackballing of Kaepernick; this one featured the CEO of Roc Nation, Jay-Z's agency that produced the halftime show, saying this about NFL commissioner Roger Goodell in the paper of record: ''Roger is amazing, and we couldn't be doing this without him.'' Even President Trump, who has been tormenting the NFL for several years now, left them alone in his pregame Fox interview. (It helps when you ban kneeling for him.) The league didn't even have to deal with Tom Brady and Bill Belichick, the dark princes of the league; instead, it had two teams nobody dislikes all that much, one of which just won its first Super Bowl in 50 years. Shoot, even the commercials weren't half bad.
It has been a remarkable turnaround for Goodell, a man who appeared for all the world to be mincemeat at regular intervals over the last five years. (It turned out that the worst thing that happened to him was a temporary pay cut, all the way down to $34 million. He's now back up to $40 million.) The league made a record $16 billion in revenue in 2018, the most recent recorded year, and is well on its way to reaching Goodell's target of $25 billion by 2027. And while the NBA has suffered dramatic television-ratings drops and baseball only crosses over to popular culture when it has a cheating scandal, the NFL earned its best ratings in four years this season. Last year, the entertainment industry was widely boycotting it over the Kaepernick mess; this year, the Super Bowl featured Jay-Z and Beyonc(C) waving from the luxury suites. Why wouldn't the league be strutting? And more to the point: Why wouldn't it feel cocky about another 100 years? Every time the NFL is counted out, it comes back stronger.
Then you go back to that kid. Remember that kid, running on the field, with all those dancing children around him? The kid representing the innocence of play, expressing all the joy and youthful exuberance that sports represents, that exuberance everyone watching is always trying to recapture? Well, he's not a professional actor. His name is Maxwell ''Bunchie'' Young. He was Sports Illustrated's 2017 ''Kid of the Year,'' and he has been on the sports national radar his entire life, winning a sprint competition at the age of 6. But his favorite sport is football, and he has been playing it just as long as he has been running, scoring 30 touchdowns in a youth league at the age of 9. Young isn't some plucky youngster getting his first shot to shine on a national stage. He's a lusted-after commodity; University of Illinois coach Lovie Smith has already offered him a scholarship to play football. He did so when Young was 10 years old.
Ten years old, by the way, is two years younger than the age of 12, which is the age that researchers at Boston University found anyone who played football that young had ''a twofold 'risk of problems with behavioral regulation, apathy, and executive function' and a threefold risk of 'clinically elevated depression scores.''' One researcher said, ''The brain is going through this incredible time of growth between the years of 10 and 12, and if you subject that developing brain to repetitive head impacts, it may cause problems later in life.''
A child who has been playing tackle football his entire life '-- who was offered a football scholarship at the age of 10 '-- was the centerpiece of the league's marketing at its most massive event, celebrating its 100th birthday, pointing toward 100 more years of football ahead. That kid represented everything glorious and shining about the NFL on its signature night; it built the whole thing around him, and those kids, and what the future holds for them. This past Super Bowl Sunday, everything was perfect and beautiful for the NFL. But there are many, many more Sundays to come.
Super Bowl LIV: JLo and Shakira's halftime show 'cages' were a jab at Trump administration, claim fans | MEAWW
Mon, 03 Feb 2020 08:48
They won the audience with their performance but fans could not help but notice the reference that the two made against the Trump administration
Getty ImagesJennifer Lopez and Shakira set the stage on fire with their power-packed performance during the half-time show. The singers let their heritage shine through as their performance consisted of some of their most famous songs. However, one thing that people could not unsee was the gab that the two singers took during their performance.
Fans were quick to notice the small references that were made throughout the song. However, one thing in particular that caught their eye was the children who were locked inside a cage while the song, "Born in the US", was sung in the background. Many thought that it was a direct attack at President Donald Trump's decision of putting migrant children into detention camps.
"Props to Jlo, Shakira and/or the choreographer for the necessary statement with Latino children in cages singing" Born in the USA," one user wrote. Another added, "JLo understands what Trump is doing to the Hispanics people and what he did to Puerto Rico."
Others thought that their performance screamed a call for help and how everyone should wake up after watching the performance. "A global massage for all those Latino kids in a cage, those kids belongs in heart, not behind iron bars, wake up Congress Thanks #JLo & #Shakira," read the comment.
Another jab that Jennifer took at the Trump administration was waving the Puerto Rican flag while singing the same song. Puerto Rican natives became emotional upon seeing this and were happy to see Jennifer standing up for the community. Many were pleased to see that someone took the initiative to remind Trump that the Caribbean island is part of the US and the people should be treated like every other US citizen.
"JLo out here reminding Trump that Puerto Rico is very much a part of America," one tweet read. Another tweeted, "Love that #JLo 's US flag opened to become the #PuertoRico flag! It's about time some people were exposed to, well ... a super sexy 50 yo mother, Spanish, ululating, belly dancing, pole dancing, salsa and Latina women who kick a$$. It was amazing!"
If you have a news scoop or an interesting story for us, please reach out at (323) 421-7514
25 for 45
Bette Midler on Twitter: "HE PINNED THIS. YOU THINK THIS IS A JOKE, DON'T YOU? IT'S NOT. HE MEANS IT. HE WILL CHANGE THE RULES AND HIS ENABLERS WILL LET HIM. IF HE WINS AGAIN, HE WILL RULE YOU UNTIL HE DIES, YOU DIE, OR BOTH. THEN...YOU'LL GET
Thu, 06 Feb 2020 00:23
@ BetteMidler HE PINNED THIS. YOU THINK THIS IS A JOKE, DON'T YOU? IT'S NOT. HE MEANS IT. HE WILL CHANGE THE RULES AND HIS ENABLERS WILL LET HIM. IF HE WINS AGAIN, HE WILL RULE YOU UNTIL HE DIES, YOU DIE, OR BOTH. THEN...YOU'LL GET IVANKA.
twitter.com/realdonaldtrum'...
Trump Rotation
Tracking all of President Trump's false or misleading claims - Washington Post
Wed, 05 Feb 2020 13:05
Fact Checker Analysis Analysis Interpretation of the news based on evidence, including data, as well as anticipating how events might unfold based on past events.
The Fact Checker's ongoing database of the false or misleading claims made by President Trump since assuming office.
Updated Jan. 19, 2020
Fact Checker Search claimsLoading . . .
President Trump made 16,241 false or misleading claims in his first three years - The Washington Post
Wed, 05 Feb 2020 12:37
Three years after taking the oath of office, President Trump has made more than 16,200 false or misleading claims '-- a milestone that would have been unthinkable when we first created the Fact Checker's database that analyzes, categorizes and tracks every suspect statement he has uttered.
We started this project as part of our coverage of the president's first 100 days, largely because we could not possibly keep up with the pace and volume of the president's misstatements. We recorded 492 claims '-- an average of just under five a day '-- and readers demanded that we keep it going for the rest of Trump's presidency.
Little did we know what that would mean.
In 2017, Trump made 1,999 false or misleading claims. In 2018, he added 5,689 more, for a total of 7,688. And in 2019, he made 8,155 suspect claims.
In other words, in a single year, the president said more than the total number of false or misleading claims he had made in the previous two years. Put another way: He averaged six such claims a day in 2017, nearly 16 a day in 2018 and more than 22 a day in 2019.
As of Jan. 19, his 1,095th day in office, Trump had made 16,241 false or misleading claims. Only 366 days to go '-- at least in this term.
The president added to his total on Sunday evening with more than 20 Trumpian claims '-- many old favorites '-- during a triumphant speech at the annual conference of the American Farm Bureau Federation. He incorrectly described trade agreements '-- suggesting Canadian dairy tariffs were eliminated and an agreement with Japan to reduce tariffs on $7 billion of farm products was ''a $40 billion deal'' '-- and also falsely asserted that ''tough'' farmers and ranchers were crying as he signed a repeal of Obama-era regulations. A video of the event shows no one crying.
In 2018 and 2019, October and November ranked as the months in which Trump made the most false or misleading claims: October 2018: 1,205; October 2019: 1,159; November 2019: 903; and November 2018: 867.
In 2018, Trump barnstormed the country in an effort to thwart a Democratic takeover of the House. The two biggest false-claim days were before the election: Nov. 5: 139, and Nov. 3: 128.
The key reasons for last year's surge in October and November was the uproar over a phone call on July 25 in which Trump urged Ukraine's president to announce an investigation of former vice president Joe Biden, a potential 2020 election rival '-- and the ensuing House impeachment inquiry. Almost 1,000 of the false and misleading claims made by the president deal with the Ukraine investigation, even though it only became a category four months ago.
The president apparently believes he can weather an impeachment trial through sheer repetition of easily disproved falsehoods.
For instance, nearly 70 times he has claimed that a whistleblower complaint about the call was inaccurate. The report accurately captured the content of Trump's call and many other details have been confirmed. Nearly 100 times, Trump has claimed his phone call with the Ukrainian president was ''perfect,'' even though it so alarmed other White House officials that several immediately raised private objections.
Three claims about the Ukraine investigation have now made it onto our list of Bottomless Pinocchios. (It takes 20 repeats of a Three- or Four-Pinocchio claim to merit a Bottomless Pinocchio, and there are now 32 entries.) Besides the claim about the whistleblower, the two other claims on the Bottomless Pinocchio list are that Biden forced the resignation of a Ukrainian prosecutor because he was investigating his son Hunter Biden and that Hunter Biden scored $1.5 billion in China after hitching a ride on Air Force Two with his father.
Trump crossed the 10,000 mark on April 26. From the start of his presidency, he has averaged nearly 15 such claims a day.
About one in five of these claims are about the economy or jobs.
As Trump approaches a tough reelection campaign, his most repeated claim '-- 257 times '-- is that the U.S. economy today is the best in history. He began making this claim in June 2018, and it quickly became one of his favorites. The president can certainly brag about the state of the economy, but he runs into trouble when he repeatedly makes a play for the history books. By just about any important measure, the economy today is not doing as well as it did under Presidents Dwight D. Eisenhower, Lyndon B. Johnson or Bill Clinton '-- or Ulysses S. Grant. Moreover, the economy is beginning to hit the head winds caused by Trump's trade wars, with the manufacturing sector in an apparent recession.
About one in six of Trump's claims are about immigration, his signature issue '-- a percentage that increased in early 2019 when the government was partly shut down over funding for his promised wall along the U.S.-Mexico border. In fact, his second-most-repeated claim '-- 242 times '-- is that his border wall is being built. Congress balked at funding the concrete barrier he envisioned, so he has tried to pitch bollard fencing and mostly repairs of existing barriers as ''a wall.'' (Almost all of the 100 miles that have been completed replaced previous barriers.) The Washington Post has reported that the bollard fencing is easily breached, with smugglers sawing through it, despite Trump's claims that it is impossible to get past.
Trump has falsely said 184 times that he passed the biggest tax cut in history. Even before his tax cut was crafted, he promised that it would be the biggest in U.S. history '-- bigger than Ronald Reagan's in 1981. Reagan's tax cut amounted to 2.9 percent of the gross domestic product, and none of the proposals under consideration came close to that level. Yet Trump persisted in this fiction even when the tax cut was eventually crafted to be the equivalent of 0.9 percent of gross domestic product, making it the eighth-largest tax cut in 100 years. This continues to be an all-purpose applause line at the president's rallies.
On 176 occasions, Trump has claimed the United States has ''lost'' money on trade deficits. This reflects a basic misunderstanding of economics. Countries do not ''lose'' money on trade deficits. A trade deficit simply means people in one country are buying more goods from another country than people in the second country are buying from the first country. Trade deficits are also affected by macroeconomic factors, such as currencies, economic growth, and savings and investment rates.
The president's constant Twitter barrage also adds to his totals. Nearly 20 percent of the false and misleading statements stemmed from his itchy Twitter finger.
Trump's penchant for repeating false claims is demonstrated by the fact that the Fact Checker database has recorded more than 400 instances in which he has repeated a variation of the same claim at least three times.
The award-winning database website, created by graphics reporter Leslie Shapiro, has an extremely fast search engine that will quickly locate suspect statements the president has made. We encourage readers to explore it in detail. We recently added a new feature that provides a URL for every claim that is fact-checked, allowing readers to post the link on social media.
Note: The Fact Checker welcomes academic research of the Trump claims database. Recent examples include work done by Erasmus University, University College London and the University of California at Santa Barbara. You can request our data files with an explanation of your research plans by contacting us at factchecker@washpost.com.
(About our rating scale)
Send us facts to check by filling out this form
Sign up for The Fact Checker weekly newsletter
The Fact Checker is a verified signatory to the International Fact-Checking Network code of principles
Iowa
News anchors were pissed they had to fill up hours of airtime
Wuhan Fung Flu
Wuhan Flu Postal Workers Packages
Anonymous please..
Hi agin Adam love your work.
The a postal service in Australia is telling its workers
that the virus can't live outside human body for more than 2 hours so no need
to worrie about the hundreds of Chinese parcels that are handled every day.
The hospitals and medical professionals I have spoken to say
the virus will stay on a contaminated thing dormant for two weeks and then
activate . Once activated the contamination is permanent and dangerous.
I feel the misinformation postal workers are being exposed
to will increase the spread and severity of the pandemic.
Please help raise awareness.
It's herpies for the lungs.
As I have no money I would like to consider information I
give you as payment in like.
PS I'm am a dooshbag and proud to be called that.
Thanks take care.
Wuhan supply chain issues from producer Steve
Adam,
In case you're interested (sorry if it's too long)
Regarding economic impact of Corona virus - here's some
anecdotal stuff:
I'm a small manufacturer (I used my gear to replace the
synth used on the jingle for my dedouching) I'm in the process of prototyping a
new piece and missed the "spring festival" (aka Chinese New Year)
deadline in January.
That means the circuit board designs I submitted after
Jan 19 wouldn't begin until the factory reopened on Feb 1.
When I checked my order status Saturday (Feb 1) I was
notified that the factory would now remain closed until Feb 10 due to an
internal "public travel ban.
This basically means I won't be able to do any revenue
generating activity for the new gear this month.
I'm already prepared for boom/bust on the sell through
side, but combining that with a supply problem makes the butthole pucker a bit
: )
An additional week shouldn't hurt too much however,
experience has taught me not to believe anything the Chinese promise.
Until I see my order move to the next step (fabrication),
I consider that factory closed permanently (for real).
Wuhan Arrivals
My co-worker Jerry and his wife few home Last
Thursday. Nobody said anything to them when they arrived in the US.
They thought someone from the CDC or the airline would want information, but no
nothing. GE told him to stay home for 14 days before coming back to
work.
China Phase 1 agreements left and out or China in the very last line when they knew that they already had the Coronavirus
Xi says China fighting 'demon' virus as infections soar over 4,500 | Free Malaysia Today
Thu, 06 Feb 2020 07:19
Chinese Premier Li Keqiang (centre) speaks with medical workers at a Wuhan hospital. (AP pic)WUHAN: President Xi Jinping said Tuesday China was in a struggle against a ''demon'' epidemic, as the death toll from the new SARS-like virus soared to 106 and the first cases of human-to-human contagion were detected abroad.
Xi made his remarks during talks with head of the World Health Organisation in Beijing as a host of nations prepared to airlift their citizens from Wuhan, the epicentre of the outbreak.
''Chinese people are currently engaged in a serious struggle against an epidemic of a new type of coronavirus infection,'' Xi told WHO chief Tedros Adhanom Ghebreyesus.
''The epidemic is a demon, and we cannot let this demon hide,'' the Chinese leader said, pledging that the government would be transparent and release information on the virus in a ''timely'' manner.
His comments came after anger simmered on Chinese social media over the handling of the health emergency by local officials in central Hubei province, where the disease first emerged in December.
Some experts have praised Beijing for being more reactive and open about this virus compared to its handling of the Severe Acute Respiratory Syndrome (SARS) epidemic of 2002-2003.
But others say local cadres had earlier been more focused on projecting stability than responding to the outbreak when it began to spread earlier this month.
Since then, the number of cases has soared '' doubling to more than 4,500 in the past 24 hours.
WHO chief Tedros praised China's response to the crisis during a meeting with Foreign Minister Wang Yi, according to state news agency Xinhua.
Contagion abroad
The WHO last week stopped short of declaring the outbreak a global emergency, which could have prompted a more aggressive international response such as travel restrictions.
But global concern has been growing, with Japan and Germany on Tuesday reporting the first human-to-human infections outside China.
Until now, all cases in more than a dozen countries involved people who had been in or around Wuhan.
In Japan, a man in his sixties contracted the virus apparently after driving two groups of tourists from the city earlier in January, the health ministry said. He was hospitalised with flu-like symptoms on Saturday.
On the other side of the world, a 33-year-old German man caught the disease off a Chinese colleague from Shanghai who visited Germany last week, according to health officials.
The development came after countries including Sri Lanka, Malaysia and the Philippines announced tighter visa restrictions for people coming from China.
Experts believe the virus came from a wild animal market in Wuhan and then jumped to humans, with Chinese health officials saying Tuesday that people infect each other through sneezing or coughing, and possibly through contact.
Authorities initially sealed off Wuhan and other cities in Hubei province late last week, trapping more than 50 million people.
China then halted international and domestic group tours. It also imposed a wide range of travel restrictions inside China, suspending long-distance bus routes and more than 2,000 train services.
But with the death toll climbing and more fatalities reported in Chinese cities far away from Wuhan, authorities on Tuesday urged people to delay any foreign travel ''to protect the health and safety of Chinese and foreign people'', the National Immigration Administration said.
Escape plans
Wuhan, meanwhile, has been turned into a near ghost-town under a lockdown that has largely confined the industrial hub's 11 million people to their homes.
With a ban on car traffic, the streets were nearly deserted apart from the occasional ambulance '' although the city's hospitals are overwhelmed.
''Everyone goes out wearing masks and they are worried about the infection,'' said David, a Chinese man who works in Shanghai but ended up trapped in Wuhan after it was put under quarantine.
Many thousands of foreigners are also among those stuck in the city.
''It's deeply stressful,'' Joseph Pacey, a 31-year-old Briton who teaches English in Wuhan, told AFP.
''The biggest fear for me is that this thing will go on for months, and it will get harder and harder to get supplies, and to live.''
Japan said it would send a chartered flight on Tuesday evening to get about a third of its 650 nationals there.
''We will also bring aid supplies such as masks and protective suits for Chinese people as well as for Japanese nationals,'' Foreign Minister Toshimitsu Motegi said in Tokyo.
If the mission succeeds, Japan would be the first country to airlift its citizens out of Wuhan.
A US-chartered flight bound for California is scheduled to leave Wuhan on Wednesday with consular staff and some American citizens, a day later than previously planned.
France and South Korea are also planning to fly out their citizens later this week, and several other countries, including Germany, were considering doing the same.
The United States, Turkey and Germany have urged their citizens to ''reconsider'' all travel to China.
Landlocked Mongolia '' which is heavily dependent on trade with China '' took the drastic step of closing the border with its huge neighbour to cars, as well as shutting down schools and banning large gatherings.
Wuhan multiplies at exactly 2.1 percent
Thu, 06 Feb 2020 07:42
Welcome home! This timeline is where you'll spend most of your time, getting instant updates about what matters to you.
Tweets not working for you? Hover over the profile pic and click the Following button to unfollow any account.
Say a lot with a little When you see a Tweet you love, tap the heart '-- it lets the person who wrote it know you shared the love.
Spread the word The fastest way to share someone else's Tweet with your followers is with a Retweet. Tap the icon to send it instantly.
Join the conversation Add your thoughts about any Tweet with a Reply. Find a topic you're passionate about, and jump right in.
Learn the latest Get instant insight into what people are talking about now.
Get more of what you love Follow more accounts to get instant updates about topics you care about.
Find what's happening See the latest conversations about any topic instantly.
Never miss a Moment Catch up instantly on the best stories happening as they unfold.
Gov't unveils new electronic tags for people under Wuhan coronavirus home quarantine | Coconuts Hong Kong
Thu, 06 Feb 2020 06:58
The Hong Kong government has announced it has 500 electronic monitoring tags ready to distribute to Hong Kong people placed under home quarantine upon returning to the SAR after having spent time in Hubei province, the epicenter of the ongoing coronavirus outbreak.
The government's chief information officer, Victor Lam, unveiled the e-tag at a press briefing this afternoon, saying that any Hong Kong residents who have been to Hubei in the past 14 days must undergo home quarantine of 14 days, a measure the new electronic bracelets are meant to ensure.
Subscribe to our Coronavirus Daily Briefing for non-hysterical updates from around the region.
The tag is paired to a person's smartphone '-- using Bluetooth Low Energy, or BLE, technology '-- and is plugged into the mains at the wearer's home.
If the person wearing the tag unplugs the phone and leaves the quarantine zone with it, or if the distance between the tag and the phone exceeds 20 meters, an alert will be sent to the Department of Health and the police.
The authorities will also get an alert if the tag is broken or removed. Anyone who violates the home quarantine order faces up to six months in jail and a fine of HK$5,000 (US$644).
Lam added that because of concerns about personal privacy, the e-tag will not collect any personal data, and the tags aren't equipped with GPS. When asked by reporters how will they be able to find anyone who absconds, Lam said they will first try calling the person on their phone.
At the moment, 500 tags are ready to be handed out, and an additional 1,000 can be made available within two weeks if necessary.
The additional quarantine measures come after the authorities disclosed the city now has 15 confirmed cases of the little-understood and potentially fatal Wuhan coronavirus.
Also at today's briefing was Undersecretary for Health Chui Tak-yi, who confirmed that the majority of the 97 places at the three current quarantine camps are already occupied, and officials are looking for additional sites. Other proposed sites have met with fierce resistance from nearby residents.
Chui said the government is working on turning the Sai Kung Outdoor Recreation Centre into a quarantine camp, and added that despite a weekend of protests in the area, they're also moving ahead with plans to turn the Heritage Lodge near Mei Foo Sun Chuen Estate into the city's fourth quarantine center.
Chui said the location of the lodge as a quarantine center was appropriate given that it's not close to any apartments '-- being about a 10-minute walk away from the Mei Foo Sun Chuen Estate and the MTR station '-- and that the camps were just for people who are under quarantine but asymptomatic.
DOD Statement on use of Camp Ashland, Nebraska in Support of HHS > U.S. DEPARTMENT OF DEFENSE > Release
Thu, 06 Feb 2020 07:07
On Feb. 3, Secretary of Defense Dr. Mark T. Esper, in response to a request for assistance from the Department of Health and Human Services (HHS), approved housing support at Camp Ashland, Nebraska for up to 75 people who may need to be quarantined upon arrival from overseas travel due to the novel coronavirus. This is a DoD-owned facility that is leased to the State of Nebraska. The approval was done in consultation with the Governor of Nebraska.
Secretary Esper also approved providing a facility for briefing passengers and office space for HHS personnel and equipment through Feb. 29, 2020.
As with prior coronavirus RFAs, HHS will be responsible for all care, transportation, and security of the evacuees. This includes limiting the movement of the evacuees on Camp Ashland.
DOD personnel will not be in direct contact with the evacuees and will minimize contact with personnel supporting the evacuees. Should routine monitoring of the evacuees identify ill individuals, HHS has procedures in place to transport them to a local civilian medical facility. HHS will also ensure that no evacuated personnel are transferred to any DOD installation if they are infected or ill.
The department's primary responsibility is the safety of our force, our families and our base communities. DOD personnel will follow guidance in the memorandum, "Force Health Protection Guidance for the Novel Coronavirus Outbreak," to reduce risk.
Tencent may have accidentally leaked real dat... | Taiwan News
Wed, 05 Feb 2020 11:02
Tencent briefly lists 154,023 infections and 24,589 deaths from Wuhan coronavirus Chart listing deaths as 24,589. (Internet photo) Chart listing deaths as 24,589. (Internet photo)
TAIPEI (Taiwan News) '-- As many experts question the veracity of China's statistics for the Wuhan coronavirus outbreak, Tencent over the weekend seems to have inadvertently released what is potentially the actual number of infections and deaths, which were astronomically higher than official figures.
On late Saturday evening (Feb. 1), Tencent, on its webpage titled "Epidemic Situation Tracker", showed confirmed cases of novel coronavirus (2019nCoV) in China as standing at 154,023, 10 times the official figure at the time. It listed the number of suspected cases as 79,808, four times the official figure.
The number of cured cases was only 269, well below the official number that day of 300. Most ominously, the death toll listed was 24,589, vastly higher than the 300 officially listed that day.
Moments later, Tencent updated the numbers to reflect the government's "official" numbers that day. Netizens noticed that Tencent has on at least three occasions posted extremely high numbers, only to quickly lower them to government-approved statistics.
Feb. 1 chart showing higher numbers (left), chart showing "official" numbers (right). (Internet image)
Netizens also noticed that each time the screen with the large numbers appears, it shows a comparison with the previous day's data which demonstrates a "reasonable" incremental increase, much like comparisons of official numbers. This has led some netizens to speculate that Tencent has two sets of data, the real data and "processed" data.
Some are speculating that a coding problem could be causing the real "internal" data to accidentally appear. Others believe that someone behind the scenes is trying to leak the real numbers.
However, the "internal" data held by Beijing may not reflect the true extent of the epidemic. According to multiple sources in Wuhan, many coronavirus patients are unable to receive treatment and die outside of hospitals.
A severe shortage of test kits also leads to a lower number of diagnosed cases of infection and death. In addition, there have been many reports of doctors being ordered to list other forms of death instead of coronavirus to keep the death toll artificially low.
Cats & Dogs Are Thrown Out Of Apartment Because People Thought They Can Spread Wuhan Virus - WORLD OF BUZZ
Sun, 02 Feb 2020 23:45
Like us on Facebook for great stories daily! Tap to listen to this article instead:
Why it seems like, no matter what problems we humans face, our animal friends will always suffer too? Yes, we do understand that during this grim moment, the majority tends to panic even because everyone is on their toes but it does not justify killing our pets without any concrete evidence.
As reported by The Sun, pet owners are killing their pets by throwing their furry ones out of their apartment windows after receiving unconfirmed news that pets can spread the Coronavirus too. Pictures of bloodied pet carcasses can be seen on major platforms after these innocent creatures are hurled to death, thanks to their panicky owners.
The panic was caused by a statement by Dr Li Lanjuan who originally said that if a pet has come in contact with a person with the virus, the pet should be quarantined, just to be safe.
QUARANTINED! Not throw them out a window!
This statement has caused panic among a handful of people in China which led to the killing of their pets in a very cruel manner.
Of course this sparked outrage throughout social media. We hope no other pets are spared because of intense panic! ðŸ
Also read: Top Virus Expert Claims Wuhan Virus May Transmit To Household Pets Too, Not Just Humans
Like us on Facebook for great stories daily!
OTG
YouTube details ban on 'manipulated' election content
Tue, 04 Feb 2020 08:00
1 / 2
Alphabet and Google chief executive Sundar Pichai touted YouTube, whose logo is seen at the right, as a revenue star at the company (AFP Photo/Robyn Beck)
Washington (AFP) - YouTube said Monday it would remove election-related videos that are "manipulated or doctored" to mislead voters, as part of its efforts to stem online misinformation.
The Google-owned service said it was taking the measures as it strives to become a "more reliable source" for news and to promote a "healthy political discourse" amid heightened fears over video fakes around the world.
Leslie Miller, YouTube's vice president of government affairs and public policy, said in a blog post that the service's community standards prohibit "content that has been technically manipulated or doctored in a way that misleads users... and may pose a serious risk of egregious harm."
The latest YouTube statement, which seeks to clarify its global policy on election misinformation, was announced as the US presidential primary season kicks off, with caucuses being held in Iowa on Monday and the first primary next week in New Hampshire.
The move comes amid growing concern about so-called "deepfake" videos altered by using artificial intelligence, which can create credible-looking events, but also "shallow" fakes that use more rudimentary techniques to deceive viewers.
Deepfakes and manipulated content have raised fears over the election process worldwide, amid notable incidents in Britain and India where videos were used for disinformation.
YouTube noted the policy also bans content which aims to mislead people about voting rules or the US census process that is underway.
Online platforms have come under pressure to root out misinformation in the wake of foreign manipulation efforts in the US in 2016 and elsewhere in recent years.
In the US, critics of online platforms have claimed not enough is being done to curb false claims by candidates themselves.
- Concerns over US campaign -
Google last year said it was stepping up efforts on election misinformation and would remove false claims in ads, including on YouTube, but the new statement appeared to offer specifics on certain kinds of content that will be blocked.
"The underlying standards YouTube explains and illustrates today do not appear to be brand new, but the company deserves praise for setting them out in clear terms and warning that it intends to enforce them vigorously," said Paul Barrett of the New York University Center for Business and Human Rights and author of a 2019 study on political disinformation.
"YouTube's statement today appears to reiterate its determination not to allow its users to be conned during the 2020 election campaign."
The announcement underscores differing policies by major social networks on disinformation. Twitter has said it would ban all political ads for candidates, while Facebook has maintained a hands-off policy for political speech and ads, with some exceptions for content that misleads users about voting times and places.
"Each platform is weighing free expression against voter manipulation, but the information operations work across platforms and exploit these loopholes," said Karen Kornbluh, a German Marshall Fund researcher who follows political disinformation.
"That's why the platforms should come together and develop shared, clear, consistent, enforceable rules to protect voters from becoming easy marks for disinformation campaigns."
Monday's statement offered specific examples of content that would be removed from YouTube.
Among the content banned include any video "manipulated to make it appear that a government official is dead" or that "aims to mislead people about voting or the census processes, like telling viewers an incorrect voting date."
YouTube will also take down any false claims about eligibility requirements for political candidates, "such as claims that a candidate is not eligible to hold office based on false information about citizenship status requirements."
A separate statement by Google's head of online trust and safety, Kristie Canegallo, said the internet giant has stepped up its efforts to stem abuse and false information on elections globally.
"Our trust and safety teams span the globe to monitor and disrupt account hijackings, inauthentic activity, disinformation campaigns, coordinated attacks, and other forms of abuse on our platforms on a 24/7 basis," Canegallo said.
"We take seriously our responsibility to protect our users from harm and abuse, especially during elections."
She added that Google was working with other technology companies and government agencies including the FBI "to identify bad actors, disable their accounts, warn our users about them, and share relevant information with industry officials and law enforcement."
2020
Bloomberg Puerto Rico
Hi
Adam,
As
you know, in Puerto Rico we are American citizens who cannot vote for the
President of the USA. But here we can vote in the primaries to select the
candidates. This year we will have the Democratic primaries on March 29, and
Puerto Rico will sent 51 delegates to the Democratic convention, a delegation
larger than the delegations of 20 states. At this moment Bloomberg is the only
candidate which ads in local TV and radio, and it seem that he is investing a
lot of money since you can watch and hear the ads frequently on the shows with
the best ratings. Below please find a link to an article that reflects
what is happening in Puerto Rico in regards the primaries. Also I’m
sending an MP3 with the last part of one of the ads, which is in Spanish, and I
will not translate since it is obvious. Sorry that I could not find a better
quality of the audio clip, but if I find the original ad, I will send you the link
later.
Girlfriend's Dogs Are Not Bloomberg's Best Friends - The New York Times
Thu, 06 Feb 2020 06:57
They curl up on the fringes of New York City royalty, positioned to eavesdrop on conversations no one else can hear, but unlikely to pass along the details. They come from a well-worn class of political companion, intended to generate sympathy for even the surliest of leaders, but have failed to persuade the city's first man to accept them as his best friends. They stand, and sit, as symbols of compromise in the private life of an uncompromising mayor.
They are Bonnie and Clyde, the yellow Labradors who reside in the Upper East Side town house that Mayor Michael R. Bloomberg shares with his girlfriend, Diana L. Taylor. Just don't call them the mayor's dogs.
Four years ago, Ms. Taylor, a former superintendent of the state's Banking Department, presented the animals to Mr. Bloomberg as a Christmas gift. The dogs could stay, he told her. But she would be looking after them.
Both seem to have honored the spirit of the agreement. Ms. Taylor, 56, has provided the dogs with an idyllic urban life that many owners would hardly recognize: Central Park strolls, a professional walker, extensive puppy-training sessions.
And the mayor has tolerated them '-- in his kitchen, at his campaign functions, even at the wedding of two aides in July, at which Mr. Bloomberg officiated. He has been known to correct those who ask about his dogs. ''Diana's dogs,'' he says.
Still, dogs have occasionally found their way onto the periphery of Mr. Bloomberg's public life. His daughter Georgina has spoken against mass breeding. Bloomberg-themed T-shirts for dogs are widely available online. (Options include ''Mike Is My Homeboy,'' ''Bloomberg for President'' and ''Free Plaxico.'') And Mr. Bloomberg has made fleeting reference to Bonnie and Clyde in political contexts, remarking that the city's parks had become so safe under his leadership that ''my girlfriend goes and walks the dogs at 1 in the morning.''
Image Diana L. Taylor, the mayor's girlfriend, leaving Central Park this month with Bonnie and Clyde. They were a Christmas gift to the mayor four years ago. Credit... Michael Appleton for The New York Times But in a country whose 16 most recent presidents have had dogs, according to the Presidential Pet Museum in Williamsburg, Va., Mr. Bloomberg stands apart as one of the few public figures who have declined the opportunity, quite literally given to him, to use the animals to burnish his Everyman credentials.
Stu Loeser, a spokesman for the mayor, was asked if Mr. Bloomberg liked the dogs. If he ever walked them. If he considered them his own.
''Ms. Taylor's dogs have nothing to do with the mayor's public life,'' Mr. Loeser replied in an e-mail.
They have, however, wrought occasional havoc on his town house, chewing hand towels, a bench in the breakfast nook and the hood of Ms. Taylor's jacket. On one occasion, while gated inside ''their half of the kitchen,'' said Robert Haussmann, their former trainer, the dogs nudged a crate toward the edge of their pen, climbed atop it, and leapt over to taste the freedom of, well, the other half of the kitchen.
''They had a whole grand theft thing worked out,'' said Mr. Haussmann, who features a testimonial, attributed to Ms. Taylor and Mr. Bloomberg, on his Web site. ''I want to come back as Mayor Bloomberg's dogs.''
He could do worse. Most mornings, Ms. Taylor walks her pets in Central Park, often for more than an hour, unfastening their matching red leashes once they reach the main walkway, as is permitted in much of the park before 9 a.m. Fellow owners often shout instructions at their dogs, lest the animals decide that life in the urban wilderness might be more attractive than a return home. Ms. Taylor, parkgoers said, never has to yell.
On a recent weekday morning, as their owner strode in front of them in black athletic pants and a jacket vest, sipping from a coffee cup, Bonnie and Clyde greeted the day in typical fashion. Bonnie darted across the pavement, hazel eyes wide, stopping to exchange pleasantries with a Portuguese hound. Clyde busied himself with a small stick he had found beside a tree, pinning it beneath his paws as he chewed.
Soon, a parade of dogs converged on the edges of the Great Lawn, but Bonnie and Clyde played mostly with each other, as they often do, according to park regulars. At one point, an Australian shepherd-poodle mix, Sydney, bounded over, tongue dangling, then sped off in an attempt to inspire a chase. The Labradors declined. They remained in their places, nestled against each other, and soon Ms. Taylor leashed them and returned to the town house, where the entrance is guarded by police officers at all hours.
Green New Deal
California Bill Seeks Takeover of Nation's Largest Utility
Thu, 06 Feb 2020 07:04
SAN FRANCISCO'--A California lawmaker on Feb. 3 introduced legislation that would force taxpayers to buy the struggling utility and turn it into a public entity with a safety-first mission ahead of shareholder profits.
The proposal follows the bankruptcy filing last year by Pacific Gas & Electric after sections of its sprawling network of power lines were knocked down in windstorms and started wildfires that killed dozens of people and caused billions of dollars in damage.
Since then, the company has intentionally shut off power to millions of people during windstorms to prevent wildfires and avoid liability.
Under the proposed legislation, taxpayers would borrow money to purchase all shares of Pacific Gas & Electric, which has a market value of about $9 billion, and turn it into a public entity subject to open-records laws. Local governments would have a chance to buy pieces of the network to start their own municipal power districts.
''PG&E is a failed company,'' said state Sen. Scott Wiener, a Democrat from San Francisco who wrote the bill. ''PG&E focuses so extensively on pleasing Wall Street and creating returns and dividends for shareholders, it has allowed its infrastructure to deteriorate.''
As part of the bankruptcy case, PG&E is trying to settle claims with wildfire victims, insurers and government agencies for a total of $25.5 billion. Its plan needs approval by Gov. Gavin Newsom and state regulators so the utility can access a key state-mandated insurance fund to help soften future losses from wildfires.
So far, Newsom has rejected PG&E's plan, saying it doesn't do enough to lessen the company's debt so it can afford up to $50 billion of improvements to its electrical grid.
The governor has threatened to take over PG&E if it doesn't make acceptable changes. Wiener's bill is the first glimpse of what a takeover might look like. Wiener's office said it has discussed the bill with the Newsom administration and he has not ruled it out.
PG&E said it is ''firmly convinced'' a government takeover won't work.
''PG&E's facilities are not for sale,'' company spokesman James Noonan said. ''We remain focused on fairly resolving wildfire claims and existing the (bankruptcy) process as quickly as possible.''
He said other recent takeover attempts of utilities have largely failed due to a range of factors.
Wiener's proposal is modeled after the Long Island Power Authority, which in 1998 borrowed nearly $7 billion to purchase the infrastructure of the former Long Island Lighting Company. However, in 2013, amid escalating debt, the authority was forced to hire an investor-owned utility to manage the electric system, according to a report by Concentric Energy Advisors.
Last week, PG&E pledged to overhaul its board of directors to avoid a state takeover. Newsom's administration has not yet responded to that plan.
Wiener's news conference announcing his bill was disrupted by a raucous group of roughly three dozen people from the local chapter of the International Brotherhood of Electrical Workers. The union represents about 12,000 PG&E employees.
The workers held signs demanding pensions and jobs be protected, and they shouted at Wiener and other speakers, protesting statements that public ownership would make the state safer or lower electric rates.
''People are going to lose their jobs, that's an absolute guarantee that our workers will lose their jobs and that's not acceptable,'' said utility worker Kristen Rasmussen, 53, of Stockton.
Wiener dismissed the idea of a bureaucratic bungling of a takeover, saying the legislation will protect workers, including their collective bargaining agreements, wages, and benefits.
''You could defend PG&E if you want, but how is that going? They're burning down entire towns, they are blacking out the power to millions of people,'' Wiener said. ''PG&E is a failure and we need to try something new.''
By Janie Har & Adam Beam
Millennials
Millennials and lines
Autism
About millennials and staying in their place in line.
I would like to add that you may be seeing
characteristics of someone on the autistic spectrum - which would lend credence
to both theories of Johns.
My niece is on the spectrum and notice strange behaviour
similar to this from her. Most notably her inability to handle external change.
Autistic traits may be exactly what the corporate,
authoritarian Orwellian types were always looking for in well behaved slaves.
*cough* MMR vaccine *cough*
Sexism
John and Adam, longtime listener who is in urgent need of a
de-douching. More on that to come with a donation.
Writing about John's recent interaction at the grocery where
he described the female with melting ice cream who wouldn't let him skip in
line. I would submit that she wasn't prey to either of the two possibilities
John submitted, but rather probably looked on John's offer as "benevolent
sexism." The term was new to me until recently. But it embodies the notion
that men in particular should not do stereotypical male things to help women -
it belittles them.
See that woman with a flat tire? She can change it herself!
A woman in line is waiting behind you? She's no damsel I. Distress - she's an
island of resolve.
I'll soon need to stop holding doors for women in my
workplace, and even my own daughters. Chivalry has been rebranded as this
"benevolent sexism" and we suddenly can do less work as a
result.
Cheers, and thanks for all the work you two do. It's truly a
god-send.
Josiah Hersey
Epstein
Corey Feldman's Truth Documentary Will Only Be Shown One Time and That's It
Thu, 06 Feb 2020 06:13
Kevin Burwick'-- February 5, 2020in Movie NewsYesterday, we got the first details about Corey Feldman's Truth documentary. Now, the actor, musician and one-time teen idol is calling the making of his new movie the most "emotionally trying" period of his entire life. Fans and interested parties who want to hear what he has to say in this provocative new expose will only have one chance to watch the finished product this March.
Corey Feldman and his wife Courtney Anne Feldman shared a new video announcement shortly after the poster, release date and first E-ticket details were released to the public. Together, this dynamic duo go onto explain how (My) Truth: The Rape of 2 Coreys has been in the works for at least three years now. Feldman has finally been able to announce a release date for March 9, 2020, with E-tickets going on sale February 22, 2020. However, there is a catch.
The movie will only be shown once and the whole world will have to all watch together at the same time. The movie will stream live at 8pm on the West Coast, which means it won't air until 11pm on the East Coast, and those in the UK and other parts of the world will have to get up early to watch this once-in-a-lifetime premiere. Corey Feldman and his family, friends and colleagues will also be watching the same stream at that time in a private screening.
Feldman promises an innovative new technology and platform to launch the long-awaited movie, which could catch on in the entertainment industry for more than just live concert events. As far as Feldman knows, this is the first time ever a movie has been shown in this type of platform. And don't worry, he's not asking an exuberant price to be part of this epic event. While pricing hasn't officially been announced, Feldman promises that it will be the same price as your average movie ticket, somewhere between $15 and $20 dollars, profits of which go to trying to pull this all off.
Feldman promises he's not trying to profit from this endeavor and that he almost didn't go through with it. Even Netflix turned down the Truth documentary, because they felt its contents were just too dangerous to be associated with, which really has Corey putting his neck out. But Feldman is keeping a promise to his best friend Corey Haim to get the word out to the world about what really happened to the two young actors in Hollywood, and Corey Feldman has long promised to expose a high profile pedophile who is still working and quite prominent in the entertainment industry.
(My) Truth: The Rape of 2 Coreys will premiere on March 9th, 2020 at 8 PM Pacific. The date is significant since it is on the eve of the tenth anniversary of Corey Haim's death. Corey Feldman could not get traditional distribution for his documentary for the same reasons that his book and the Lifetime movie were censored. Putting out Feldman's claims could see some legal repercussions and there aren't many studios looking to put their necks out, even if it's for a strong message. As Feldman has said numerous times, he made a promise to Corey Haim to tell his story.
The event is broadcasting (My) Truth: The Rape of 2 Coreys live at the same time all over the world because Corey Feldman insists that everybody get this information at the same time and be able to form their own opinions without the media or pundits jumping into dissect it and offer their opinions about it before everyone else has a chance to make up their own minds.
Advanced screenings or early reviews will not happen because Feldman does not want anyone out there twisting his narrative and message. At this point, it's not even clear if there will be a trailer or any footage released from the documentary before hand, which is also in innovative move. We may have reached an apex in Hollywood where withholding a trailer becomes the new norm for highly anticipated movies everyone is already quite aware of.
But basically, Feldman wants the evidence to speak for itself and this might be his best way of doing so. With that being said, this is all on him as he is the one liable. There are no publishers or studios to blame for censorship, so expect some raw and honest truth from Feldman, in a way only he can tell it. Or, expect some backlash if (My) Truth: The Rape of 2 Coreys is not what has been advertised.
Corey Feldman also hopes to be able to set up a multimedia "extras" section, or as he calls it, a companion piece, for (My) Truth: The Rape of 2 Coreys online, where he will provide some source material from the doc. There's a lot of ground to cover and Feldman often gets emotional talking about finally getting Corey Haim's story out and into the world for the first time in an uncensored manner. Haim's mother, Judy, is very skeptical of Feldman and his motivations, which is more than likely why Haim is not seen in the promotional poster, which contains old movie posters that featured both actors with only Feldman's face showing.
Buying an E-Ticket for the live event will give viewers a registration code to stream the movie on Truthdoc.com. Only one ticket purchase is necessary for homes or group parties planning to show the movie. So basically, any one near the TV can watch for the price of just one movie ticket. Corey Feldman doesn't have a big promotional budget to get word about the movie out to the public, so he is asking his fans to form street teams. The poster is easy to download. He wants everyone to go to Kinkos, print up a couple hundred, and plaster their town with the info. And if fans can't afford to print up a couple of flyers, he asks that they share Memes on social media to get the word out. He asks that this all be a group effort.
As for when tickets go on sale, that is another important date for fans of Corey Haim and Corey Feldman. Tickets will go on sale February 22nd, 2020, which refers to their lucky numbers: 22 and 2/2/2. You can watch the announcement below, thanks to Corey Feldman's Twitter account.
Corey Feldman Needs Security 24/7 as His Truth Documentary Ramps Up for ReleaseKevin BurwickCorey Feldman's Truth Documentary Release Date, Poster and Ticket Details ArriveB. Alan OrangeFeldman Says Netflix Is Too Scared to Show His Finished Documentary, Needs DistributorKevin BurwickFeldman Close to Finishing The Rape of 2 Coreys Documentary, May Arrive in Late 2019Kevin BurwickFeldman's Child Abuse Doc Gets Titled Truth: The Rape of 2 CoreysKevin Burwick
Clips
VIDEO - Australian media 'dishonestly portrayed' bushfire crisis | Sky News Australia
Thu, 06 Feb 2020 07:29
Sky News host Alan Jones says Australia is a ''long way from its worst fire season'' and is ''not seeking to diminish the horror but merely trying to alleviate the hysteria''. Mr Jones praised Sky News host Chris Kenny for a recent piece he had written in The Australian, in which Mr Kenny said, "with little research and even less fact checking, the narrative about the fires being unprecedented took off and was amplified."''Climate change was mentioned across the media almost 900,000 times," said Mr Jones and led to a ''dishonest portrayal of what is happening". ''There is one reason, above all others, for this fire catastrophe. You cannot start a fire without fuel''.Image: Getty
VIDEO - In California, Protecting Workers Means Outlawing Their Jobs '' Reason.com
Thu, 06 Feb 2020 07:26
"A s a freelancer, I have the flexibility to do work while I'm at school, or do work late at night, or, you know, not work that week because I'm busy," Kassy Dillon, a journalist and graduate student at Pepperdine University, told Reason in late 2019.
On January 1, 2020, earning that extra cash got a lot more difficult. California Assembly Bill 5 was designed to constrain the growth of the so-called gig economy, based on the theory that companies like Uber, Lyft, and Postmates are taking advantage of contract labor.
Dozens of professions, including many jobs in health care, commercial fishing, grant writing, hair styling, and the fine arts, are exempt from the law. Journalists were allotted a partial exemption of 35 submissions per year per client, which was negotiated by the bill's author , California Assemblywoman Lorena Gonzalez (D''80th District).
"Was it a little arbitrary," Gonzalez told the The Hollywood Reporter regarding how she came up with that number, " Yeah. Writing bills with numbers like that are a little bit arbitrary." (Gonzalez declined Reason's interview request.)
Vox, which had hailed the new law as a " victory for workers everywhere , " announced in December that it will be ending contracts with more than 200 freelancers who lived in or covered California. Those 200 freelance contracts will be replaced with 20 part-time or full-time staff positions.
"This is a really unusual position for people in creative fields like freelance journalism to be in," says Randy Dotinga, a San Diego-based freelance journalist and the former president of the American Society of Journalists and Authors. "B y nature, most of us are liberal, progressive Democrats. We're also pro-union for the most part. And here we are saying this goes too far."
Journalists "might write on a blog post in 20 minutes and they might write dozens of blog posts every month or every year," says Dotinga. " A lot of publications don't have the resources to put someone like that on staff. So they're either going to be limited in what they can write or they're just going to be let go." The American Society of Journalists and Authors has filed a lawsuit arguing that the bill is unconstitutional.
If regulating freelancers is a good idea, why were there so many vaguely defined exemptions written directly into the text of the law? In the lead-up to its passage, most lip service was paid to the plight of Uber and Lyft drivers.
Veena Dubal, a law professor at the University of California Hastings, thinks that drivers are mis-classified as independent contractors. "I f you have such little bargaining power with the folks that you're consulting with or you're freelancing for," says Dubal, "then it's exploitative."
Uber and Lyft maintain that drivers have flexible schedules and are therefore correctly classified as independent contractors. And 95 percent of California's Uber and Lyft drivers say that the job's flexibility is "extremely" or "very" important to them.
Coral Itzcalli, a spokesperson for Mobile Workers Alliance, which is trying to unionize the industry, says that Uber and Lyft "are paying workers very little wages. You're looking at workers driving 14, 16 hours a day. There's no flexibility in that."
But California Lyft drivers spend an average of 3 hours per week on the app. And according to a 2019 study commissioned by Lyft, the company will likely have to end its arrangements with around 250,000 drivers, and the part-timers, who make up the majority, would be the first to go.
" For us," says Itzcalli, "this is about focusing on ensuring that jobs are good jobs. If we have one or 100 jobs that are paying less than minimum wage, there is absolutely no benefit. I [would] rather have 50 good jobs than a 100 bad paying jobs."
But who gets to make that choice? The labor movement or the freelancers taking those jobs?
" I hope that there's some way that the labor movement can look at freelancers of all types, and say this is a valid, honorable profession," says Randy Dotinga. "We are workers too. And many of us choose this field. We are not exploited. We don't exploit others. We're not scabs. We're small businesses and we deserve to be treated that way."
Produced by John Osterhoudt. Camera by Osterhoudt, Zach Weissmueller, and James Marsh.
Photo credit: Vito Di Stefano/ZUMA Press/Newscom; Hayne Palmour Iv/ZUMA Press/Newscom; Earnie Grafton/ZUMApress/Newscom; Charlie Neuman/ZUMAPRESS/Newscom; Charlie Neuman/ZUMA Press/Newscom; KM2/Ken McCoy / WENN/Newscom; Andre Jenny Stock Connection Worldwide/Newscom; Chuck Myers/ZUMA Press/Newscom; ID 42987615 (C) trekandshoot | Dreamstime.com; ID 169721027 (C) Andrei Gabriel Stanescu | Dreamstime.com
VIDEO - Wuhan virus compared to MERS and SARS - YouTube
Thu, 06 Feb 2020 07:08
VIDEO - RIPPING HISTORY: Nancy Pelosi Broke The Law During State of the Union - YouTube
Thu, 06 Feb 2020 07:06
VIDEO - (4) Karli '­¸'­¸'­¸ - Text TRUMP to 88022 on Twitter: "I don't think what she was reading was the speach! Remember the funeral notes! I think the lush got the next 9 months agenda and she can rip it up but ''No Deals'' There is no ste
Thu, 06 Feb 2020 07:00
Welcome home! This timeline is where you'll spend most of your time, getting instant updates about what matters to you.
Tweets not working for you? Hover over the profile pic and click the Following button to unfollow any account.
Say a lot with a little When you see a Tweet you love, tap the heart '-- it lets the person who wrote it know you shared the love.
Spread the word The fastest way to share someone else's Tweet with your followers is with a Retweet. Tap the icon to send it instantly.
Join the conversation Add your thoughts about any Tweet with a Reply. Find a topic you're passionate about, and jump right in.
Learn the latest Get instant insight into what people are talking about now.
Get more of what you love Follow more accounts to get instant updates about topics you care about.
Find what's happening See the latest conversations about any topic instantly.
Never miss a Moment Catch up instantly on the best stories happening as they unfold.
VIDEO - TYT's Emma Vigeland slams media for dismissing Bernie's popular vote lead - YouTube
Thu, 06 Feb 2020 06:52
VIDEO - #BREAKING: Iowa Dems PULL #IowaCaucus Results After Giving BERNIE SANDERS Votes to Steyer & Patrick - YouTube
Thu, 06 Feb 2020 06:51
VIDEO - Insights@Meridian: White House National Security Advisor Robert O'Brien - YouTube
Thu, 06 Feb 2020 06:47
VIDEO - A new class of drug that could prevent depression and PTSD | Rebecca Brachman - YouTube
Thu, 06 Feb 2020 06:37
VIDEO - Coronavirus updates: China confirms 19 foreigners have been infected
Thu, 06 Feb 2020 06:30
This is a live blog. Please check back for updates.
All times below are in Beijing time.
7:30 pm: Tesla temporarily closes China stores amid coronavirus fearsTesla has temporarily closed its stores in mainland China as of Sunday, Feb. 2, according to an online post from a company sales employee on that date.
The move comes as more than half of China has shut down in an effort to limit the spread of a new coronavirus that has killed more than 500 people in the country.
The electric automaker's China communications office did not respond to a CNBC request for comment during business hours on Thursday Beijing time.
7:20 pm: Organizers of Tokyo 2020 Olympic and Paralympic Games set up task force to tackle coronavirus outbreakThe organizers of the Tokyo 2020 Olympic and Paralympic Games have set up a task force in an attempt to counter intensifying fears about the coronavirus outbreak.
Tokyo 2020 CEO Toshiro Muto told reporters gathered at a press briefing on Thursday that he had chaired the newly-created Novel Coronavirus Countermeasures Task Force, Reuters reported. The group held its first meeting on Tuesday, Muto said, and a second briefing could take place as soon as Friday.
The Olympic Games are set to take place from July 24 to August 9, with the Paralympic Games scheduled to run from August 25 through to September 6.
6:50 pm: Air France and KLM airlines extend a ban on flights to ChinaAir France announced on Thursday it has extended a suspension of flights to and from mainland China for much of March, citing worries about the coronavirus outbreak.
Dutch carrier KLM also confirmed it would extend a ban on flights to China as a result of the virus outbreak. In an online statement, KLM said it would prolong the suspension of its flights to Beijing and Shanghai "up to and including 15 March."
Earlier in the day, (see 12:55 p.m. update) Japan Airlines and ANA both announced reduced international flights to China.
6:10 pm: US urges WHO to 'engage directly' with Taiwan, prompting China to hit backThe U.S. pushed for the World Health Organization (WHO) to "engage directly" with Taiwan in the fight against the coronavirus on Thursday, prompting a swift rebuke from Beijing's ambassador to the United Nations health agency.
Andrew Bremberg, U.S. ambassador to the United Nations in Geneva, said it is a "technical imperative that WHO present visible public health data on Taiwan as an affected area and engage directly with Taiwan public health authorities on actions," Reuters reported.
In response, China's delegation expressed "strong dissatisfaction" that some countries had raised the issue of Taiwan's participation at WHO.
A woman wearing a protective mask prays at the Lungshan temple during the fourth day of the Lunar New year of the Rat in Taipei in January 28, 2020.
Sam Yeh | AFP | Getty Images
Taiwan is not a member of the WHO due to China's objections. Beijing considers self-governing Taiwan a wayward province to be brought under its control.
Separately, Taiwan's Foreign Ministry spokeswoman, Joanne Ou, slammed China and the WHO for providing inaccurate information about the number of coronavirus cases in Taiwan. The WHO reported Tuesday that the island had 13 cases, when there were only 10 at that time.
Taiwan has temporarily suspended entry for all Chinese citizens who live in mainland China.
5:20 pm: Philippine central bank cuts rates, warns coronavirus could have an 'adverse impact' on economic activityThe Philippine central bank said Thursday that it had lowered the rate on its overnight reverse repurchase facility by 25 basis points to 3.75%, adding it was prepared to trim rates further if necessary to protect economic growth.
The interest rates on the overnight lending and deposit facilities were reduced to 4.25% and 3.25%, respectively, the central bank said.
In a statement published Thursday, the central bank said the spread of the coronavirus "could have an adverse impact on economic activity and market sentiment in the coming months."
4:08 pm: China confirms 19 foreign nationals have been infectedChina's Ministry of Foreign Affairs said that data from a "competent authority" confirmed, as of noon Thursday, 19 foreign nationals have contracted the new coronavirus. Two of them had been cured and discharged from the hospital while 17 are undergoing treatment in isolation, the ministry said.
"China attaches high importance to addressing the concerns and demands of foreign nationals in China, especially those in Wuhan, Hubei Province," spokeswoman Hua Chunying said, according to an official translation.
She added that along with local governments, the ministry holds outbreak-related briefings for foreign embassies and consulates. Hua did not specify the nationalities of the infected foreign nationals. '-- Cheng
3:03 pm: Nintendo apologizes, says coronavirus outbreak may affect some game consolesJapanese gamemaker Nintendo apologized on Thursday and said it expects an inevitable delay in production and shipment of some of its products. Those include the Nintendo Switch hybrid gaming console and the Joy-Con controllers that are manufactured in China for the Japanese market.
Nintendo said in its earnings report last month that by the end of 2019, it sold more than 52 million units of the Switch console since it was first released three years ago.
Character of Nintendo's franchise Mario is seen at a promotional booth for the video game "Mario & Sonic at the Olympic Games Tokyo 2020" during the Tokyo Game Show in Makuhari, Chiba Prefecture on September 12, 2019.
Charly Triballeau | AFP | Getty Images
2:09 pm: Taiwan bans international cruise ships from calling at its portsTaiwan's health ministry said Thursday it will prohibit all international cruise ships from its ports. Earlier in the day, Japan said a Taiwanese person onboard the quarantined Diamond Princess cruise in Yokohama was one of ten new people diagnosed with the virus.
Taiwan said Thursday there are currently 13 confirmed cases on the island.
1:40 pm: China may delay its annual meeting of parliament due to the coronavirusChina is considering delaying the annual meeting of the National People's Congress, made up of around 3,000 delegates, in March, Reuters reported, citing sources familiar with the matter. The meeting that is scheduled for Mar. 5 is used to pass laws and unveil China's economic targets for the year.
12:55 pm: Japan Airlines, ANA to reduce international flights to ChinaJapan Airlines said it would suspend some flights to Beijing and Shanghai routes starting Thursday until Feb. 16, 2020. From Feb. 17, more flights will be suspended until Mar. 28 (Mar. 29 for certain flights). Meanwhile, flight frequency on routes from Tokyo to Guangzhou and Dalian would be reduced.
The carrier said it had seen a decrease in travel demand as more countries are implementing travel restrictions on people who have visited China during specific periods.
Competitor ANA also said it will temporarily decrease or suspend operations to and from selected cities starting Feb. 10, including Beijing and Shanghai. Flights to and from Tokyo's Narita International Airport to Wuhan, the Chinese city where the virus was first detected, were suspended on Jan. 23. ANA's reductions and suspensions are slated to continue until Mar. 28.
11:54 am: Oil prices jump more than 1% during Asian hoursU.S. crude prices were up around 2.01% to $51.77 a barrel while global benchmark Brent rose 1.54% to $56.13. Overnight, energy was the top-performing sector on the S&P 500.
Oil prices have struggled in recent weeks, with U.S. crude down more than 16% for the year and Brent also lower by almost 16%. The worry from market participants is that the coronavirus outbreak could significantly curb demand for oil, especially from China. Some experts said that could lead to OPEC and its allies cutting production to bolster prices.
A technical committee comprising OPEC members and its partners extended a two-day meeting this week into Thursday to find a consensus on whether the oil producers need to make emergency production cuts. OPEC and its allies, which include Russia, are currently holding back 1.8 million barrels a day, with Saudi Arabia reducing its output the most.
10:35 am: Japan reveals more information about infected people on cruise shipJapan's health ministry disclosed in a press briefing more details about the ten additional people it said tested positive for the virus on board a cruise ship. According to NBC News, Japan said the newly infected people came from:
Japan: 4 (one woman in her 60s, two women in their 70s, one man in his 70s)U.S.: 2 (one woman in her 60s, another woman in her 70s)Canada: 2 (one woman in her 60s, a man in his 70s)New Zealand: 1 (a man in his 50s)Taiwan: 1 (a woman in her 70s)The ministry declined to comment on their conditions and said that they would like to wait for the diagnosis from the medical facilities.
10:21 am: Australia PM: Economic impact is going to be 'very significant'Australia's Prime Minister Scott Morrison told Sydney's 2GB radio on Thursday that he expects the economic impact from the new coronavirus to be "very significant," owing to the country's increased exposure to China, in terms of the number of Chinese visitors and students it receives.
China is Australia's largest trading partner.
"We can't pretend there's no impact to a global virus like this, and we can't pretend that we can make it like the day it was before the virus struck," Morrison said, pointing out in previous instances of viral outbreaks, tourism in Australia dented in one quarter before bouncing back in the next.
As of Thursday morning, Australia's health ministry said there have been 14 confirmed cases in the country.
9:45 am: Beijing city bans group mealsThe city of Beijing said on Wednesday that caterers and individuals are not allowed to organize group gatherings, and that previous arrangement should be canceled or postponed. Rural collectives are also prohibited from organizing banquets, whether for festivals, birthdays or school promotions.
As of Sunday night, Beijing had more than 200 confirmed cases of the new coronavirus, with more than half due to group gatherings, according to state media. Hotels and catering services contributed 11.11 billion yuan ($1.6 billion) to Beijing's GDP in the first quarter of 2019, or 20% of the total for the year, according to official data accessed through Wind Information. '-- Cheng
Chinese men wear protective masks as they walk in a nearly empty shopping street on February 2, 2020 in Beijing, China.
Kevin Frayer | Getty Images
9:32 am: Qualcomm sees 'significant uncertainty' around the impact of coronavirus on supply chainChipmaker Qualcomm said the virus outbreak, which put most of China under an extended shutdown, could potentially affect the mobile phone industry.
"There is significant uncertainty around the impact from the coronavirus on handset demand and supply chain," CFO Akash Palkhiwala told investors on the company's latest earnings call. Qualcomm stock dropped about 4% in extended trading after it beat analysts' estimates on the top and bottom lines, reporting first-quarter earnings of 99 cents a share on revenue of $5.06 billion.
8:51 am: Millions of chickens in China could be wiped outHundreds of millions of chickens in China are at risk of being wiped out as the shutdowns have hit supply chains. Transport restrictions are preventing much-needed animal feed such as soybean meal from getting delivered to poultry farms, according to analysts and Chinese state media.
There are over 300 million chickens in the virus epicenter of Hubei alone putting farmers in a dire situation, a local poultry association said. '-- Tan
8:12 am: 10 more coronavirus cases aboard quarantined cruise ship in Japan7:33 am: China reports 563 total deaths, and 28,018 confirmed casesChina's National Health Commission said that as of Wednesday night, a total of 28,018 cases have been confirmed and 563 people have died in the country. There were 3,694 new confirmed cases.
There were 73 additional deaths, with most of them in Hubei province.
7:04 am: Hubei reports an additional 70 deathsChina's Hubei province reported an additional 70 deaths and 2,987 new confirmed cases related to the fast-spreading coronavirus as of the end of Wednesday.
The Hubei Provincial Health Committee said that 549 people have died in the region and a total of 19,665 cases have been confirmed thus far. The province, where the pneumonia-like virus was first detected, has accounted for most of the deaths related to the new coronavirus.
The view of the Wuhan Keting in Wuhan, central China's Hubei Province. Wuhan in central China's Hubei Province started converting three existing venues, including a gymnasium and an exhibition center, into hospitals to receive patients infected with the novel coronavirus (2019-nCoV), the headquarters for the epidemic control said late Monday.
Getty Images
All times below are in Eastern time.
5:10 pm: Yum China temporarily closes 30% of China stores, could see lossesYum China Holdings, which operates Pizza Hut and KFC in China, has temporarily closed more than 30% of its stores there. Same-store sales for the locations that stayed open plunged by up to 50% since the Chinese New Year holiday, the company said, adding that it can't say when its locations may reopen or whether it will need to close more. "Looking into 2020, the coronavirus outbreak is a major public health situation in China," CEO Joey Wat said in a statement, adding that the safety of employees and customers was a priority. The outbreak will have a "material impact" on its 2020 sales and profit '-- possibly even see a quarterly or annual loss, depending on the course of the outbreak, the company said. '-- Rogers
4:07 pm: New York City tests 5 people for potential coronavirusThe New York City Department of Health said it now has five "patients under investigation" for the virus and is awaiting test results on four of them from the CDC. "This means they had recently been in China and presented with fever and cough or shortness of breath without another common cause, like influenza and other respiratory viruses, identified through testing," the agency said in a statement. The two new potential patients are both under 40. One has been hospitalized and the other is under isolation with daily monitoring by the health department. The specimen from the first suspected case sent to the CDC was negative, the department previously said.
Read CNBC's coverage from the U.S. overnight: US can't keep virus 'out of our border,' NYC has 2 new 'patients under investigation'
'-- CNBC's Christine Wang, Evelyn Cheng, Weizhen Tan, Kate Rogers, Berkeley Lovelace Jr. and William Feuer contributed to this report.
VIDEO - PETA Implores You To Stop Calling Your Animals "Pets" | 98.7 KLUV
Thu, 06 Feb 2020 06:29
The People for the Ethical Treatment of Animals, otherwise known as PETA, wants you to stop calling your animals "pets."
They feel it's a derogatory term, claiming that is patronizes the animal.
Words have power. Are YOU using language that could be harmful to your companion animals? https://t.co/6CZYxqaOMV pic.twitter.com/kcnTwI3Mpu
'-- PETA (@peta) February 4, 2020Jennifer White, a Senior Media Officer at PETA, explained on Good Morning Britain that "A lot of people at home who have dogs or cats will call them pets and refer to themselves as owners and this implies that the animals are a possession, like a car for example. When you refer to animals not as the living beings as they are but as an inanimate object, it can reflect our treatment on these animals."
She instead suggests using more inclusive'' terms like "companion" and "human carer," when referring to your animals.
PETA founder and president Ingrid Newkirk further explained the organization's stance in a statement that read:
Referring to an animal as a 'pet' or as 'it' reduces a sentient being with a personality and emotions to an inanimate object'--a possession to be used in any way the 'owner' wishes. Contrary to some reports, we are not seeking to ban these words; we're simply suggesting that it would be more respectful to refer to the animals in our homes as 'animal companions' and ourselves as their 'guardians' in the same way that all social movements concerned with cultivating respect have made appeals to stop using terms that are racist or sexist or that otherwise imply that the subject is less important than the speaker.
Via Fox News
VIDEO-Stephanie Kennedy on Twitter: "Matt Gaetz has his vindictive sights set on House Speaker Nancy Pelosi for ripping apart a copy of Trump's speech, rife w/ lies. One wonders how many official White House documents pertaining to Trump's Ukraine sha
Thu, 06 Feb 2020 01:00
Log in Sign up Stephanie Kennedy @ WordswithSteph Matt Gaetz has his vindictive sights set on House Speaker Nancy Pelosi for ripping apart a copy of Trump's speech, rife w/ lies. One wonders how many official White House documents pertaining to Trump's Ukraine shakedown were destroyed to cover up crimes.
pic.twitter.com/6aZSZDkMYU 10:38 PM - 5 Feb 2020 Twitter by: Acyn Torabi @Acyn brent h. @ bouges
11m Replying to
@WordswithSteph @Unfreakin Weird.
google.com/amp/s/www.poli'... View conversation · Valerie J. Wood #ImpeachTrump 🗽🌊 @ ValerieJWood
15m Replying to
@WordswithSteph It was only a photocopy.
View conversation · LauraJane #FBPE @ LJR1626
14m Replying to
@WordswithSteph If you come for the Queen you had better but miss.
View conversation · mingomonk @ mingomonk
10m Replying to
@WordswithSteph pic.twitter.com/GNPlBaPCEi View conversation · rmcv42'¯¸ 🇺🇸ðŸ—"🌊 @ robertmcvey42
9m Replying to
@WordswithSteph @electroboyusa ðŸ¤--Yup
View conversation · CynthiaMarie @ cynthiacrytzer
6m Replying to
@WordswithSteph It's ok to shake down a foreign leader for dirt on an opponent you republicans got to go
View conversation · ScoutLadyNY @ ScoutLadyNY
2m Replying to
@WordswithSteph @mattgaetz He pissed because he couldn't get his whole DWI thing just ripped up.
@mattgaetz #americansvstrump View conversation · LibertyBansTrump @ YesWeCan4Us
37s Replying to
@WordswithSteph Says a representative of Kremlins grand old party that breaks their oath ''to do impartial justice according to the Constitution and laws'' each time it comes to covering up their cult vehicle's unprecedented art of treason and mass destruction.
View conversation · Lotsofur 2.0 @ RealTwitish
18s Replying to
@WordswithSteph The Republicans don't care at all what Dear Leader is doing to this document..
pic.twitter.com/35RcHpoYUi View conversation · Enter a topic, @name, or fullname
Settings Help Back to top ·
Turn images off
VIDEO-BACKFIRE: 'I Will Never Vote Democrat Again,' Say Angry Dems on C-SPAN After Pelosi's Tantrum | News and Politics
Thu, 06 Feb 2020 00:52
This is the most satisfying video series you'll see all day. After Pelosi and her White Witches threw their little fits of rage last night at the SOTU, they felt very smug about themselves. Their voters, on the other hand, felt differently. It turns out that most Americans think you should stand up and clap for the good things that happen in America instead of sulk and pout on your butt like a spoiled child.
C-SPAN asked people to call in and give their opinions on the SOTU. What happened after that was brilliant. "I'm a Democrat, but I no longer will vote Democrat," said one caller. "I think it's outrageous that they sat there when all these good things are happening to our country and how much we love our country. And they looked like they hated our country...It's outrageous and I will never vote Democrat again." She went on to say that all her family voted for Hillary last time but this time they will never vote for a Democrat again.
But she wasn't the only one. A man called in and said, "Let me put it this way, I've been a Democrat for 70-some years and what I saw tonight was appalling to me...it was very disrespectful to this president and I didn't vote for him...but that man is the president and we should respect him." He continued, "What I've seen tonight of the Democrat party, I am changing my mind...I'll probably stay home. I'm embarrassed being a God-danged Democrat for what they did in the House today." Then he had me rolling on the floor with this. "They looked like a bunch of dadgum idiots sitting there." Hear, hear!
A woman from Mississippi called in to give the Democrats a piece of her mind. "I watched my president give a speech on everything great that's happening in our country but yet, Nancy Pelosi and the others who were dressed in white, I might add, just sitting over there, never standing, never clapping for anything that might be good for the country'--I don't understand it. I used to be a Democrat, and I am no longer a Democrat." And there's more than that. It's a slaughter. Listen.
According to people who watched it live, there were many more calls saying the same thing. All the Democrats had to do was look normal, and they couldn't even do that. It's almost as if they have a death wish. I'm not complaining, but dang! That was some seriously bad optics, folks! Considering that the Trump rally in New Jersey drew a crowd of 25% Democrats (who were all cheering and screaming for the president) I think they are in big, YUGE trouble. What do you think?
https://pjmedia.com/trending/backfire-i-will-never-vote-democrat-again-say-angry-dems-on-c-span-after-pelosis-tantrum/
VIDEO-Animated No Agenda - Wuhan Flu *AHEM* Coronavirus Explainer - YouTube
Thu, 06 Feb 2020 00:50
VIDEO-QuickTake by Bloomberg on Twitter: "Venezuela's government denounces Trump after he called Juan Guaido the "true and legitimate president" https://t.co/tW73JGhrws" / Twitter
Thu, 06 Feb 2020 00:22
Enter a topic, @name, or fullname
VIDEO-TYT's Emma Vigeland slams media for dismissing Bernie's popular vote lead - YouTube
Wed, 05 Feb 2020 23:51
VIDEO - DC Basement >> 🍊🍠>> 🐠on Twitter: "@adamcurry clip, Symone Sanders/Joe Biden campaign damage control message https://t.co/djMhLQAzeM" / Twitter
Wed, 05 Feb 2020 13:07
Welcome home! This timeline is where you'll spend most of your time, getting instant updates about what matters to you.
Tweets not working for you? Hover over the profile pic and click the Following button to unfollow any account.
Say a lot with a little When you see a Tweet you love, tap the heart '-- it lets the person who wrote it know you shared the love.
Spread the word The fastest way to share someone else's Tweet with your followers is with a Retweet. Tap the icon to send it instantly.
Join the conversation Add your thoughts about any Tweet with a Reply. Find a topic you're passionate about, and jump right in.
Learn the latest Get instant insight into what people are talking about now.
Get more of what you love Follow more accounts to get instant updates about topics you care about.
Find what's happening See the latest conversations about any topic instantly.
Never miss a Moment Catch up instantly on the best stories happening as they unfold.
VIDEO - How Many Lies Has Trump Told? Jimmy Kimmel Explains In A Way Even POTUS Can Understand | HuffPost
Wed, 05 Feb 2020 12:38
Part of HuffPost Entertainment. (C)2020 Verizon Media. All rights reserved.
How Many Lies Has Trump Told? Jimmy Kimmel Explains In A Way Even POTUS Can Understand
President Donald Trump has made more than 16,000 false or misleading claims since taking office, according to the latest tally by The Washington Post.
How big a number is that?
Jimmy Kimmel tried to put it into perspective on ''Jimmy Kimmel Live!'' on Monday by showing what it would mean in terms of space, cruise ship passengers, pancakes. He also shared one comparison that the president should find very relatable.
Check it out above.
Calling all HuffPost superfans!
Sign up for membership to become a founding member and help shape HuffPost's next chapter
VIDEO-Watchman Home by Rekor - License Plate Recognition for Home Security - YouTube
Wed, 05 Feb 2020 11:37
VIDEO-Van Jones Warns Democrats: Trump Is Helping African-Americans 'In Real Life'
Wed, 05 Feb 2020 11:05
CNN contributor Van Jones warned fellow panelists, and Democrats in general, on Tuesday evening that President Donald Trump was helping African-Americans ''in real life'' and reaching out to them for their vote in 2020.
Jones was reacting to the president's State of the Union address, in which the president mentioned several efforts to help African-Americans specifically:
What he was saying to African-Americans can be effective. You may not like it, but he mentioned HBCUs [historically black colleges and universities] '-- our black colleges have been struggling for a long time, a bunch of them have gone under '-- he threw a lifeline to them, in real life, in his budget. He talked about that. He talked about the criminal justice reform. He talked about opportunity zones. He talked about school choice.
The party failed to report results after Monday's crucial, first-in-the-nation contest, and has still not fully reported results as of Wednesday morning.
Jones added that the State of the Union address came against the backdrop of Democrats' mishap in the Iowa caucuses the day before.
Jones tweeted video of his comments to the CNN panel, adding: ''WAKE UP, folks. The #IowaCaucus was a debacle, followed by a strong #SOTU speech laying out Trump's strategy to win '' which includes going for Black voters. This was a warning shot from the Trump campaign to liberals, and we need to take this VERY seriously in order to win.''
WAKE UP, folks. The #IowaCaucus was a debacle, followed by a strong #SOTU speech laying out Trump's strategy to win '' which includes going for Black voters. This was a warning shot from the Trump campaign to liberals, and we need to take this VERY seriously in order to win. @CNN pic.twitter.com/bgBFms9jtN
'-- Van Jones (@VanJones68) February 5, 2020
Jones has clashed with Trump before, though he has supported the administration's efforts at passing criminal justice reform through the First Step Act.
President Trump honored African-American heroes several times during his speech, notably Tuskegee Airman Charles McGee and Army Veteran Tony Rankins. He also awarded an Opportunity Scholarship to fourth grader Janiyah Davis.
While Jones theorized that Trump was attempting to divide African-Americans and Latinos by focusing on border enforcement and stopping illegal immigration, there is no evidence that the president is doing so.
Joel B. Pollak is Senior Editor-at-Large at Breitbart News. He earned an A.B. in Social Studies and Environmental Science and Public Policy from Harvard College, and a J.D. from Harvard Law School. He is a winner of the 2018 Robert Novak Journalism Alumni Fellowship. He is also the co-author of How Trump Won: The Inside Story of a Revolution, which is available from Regnery. Follow him on Twitter at @joelpollak.
VIDEO-Democracy Now! on Twitter: "Trump will be a "tough president to beat," @DavidFrum says. While Bernie Sanders "speaks to the disaffected, the people who are content with the status quo are stronger than they have been" since the '90s and Sanders has
Wed, 05 Feb 2020 10:38
Trump will be a "tough president to beat,"
@DavidFrum says. While Bernie Sanders "speaks to the disaffected, the people who are content with the status quo are stronger than they have been" since the '90s and Sanders has "never fought a hard race," Frum says.
pic.twitter.com/ebfJWpUzfZ
VIDEO-Eleven Films on Twitter: "BREAKING: Remember America? We do. #ImpeachmentDay https://t.co/tzGPwX7zBG" / Twitter
Wed, 05 Feb 2020 10:30
Log in Sign up Eleven Films @ Eleven_Films BREAKING: Remember America? We do.
#ImpeachmentDay pic.twitter.com/tzGPwX7zBG 8:04 PM - 4 Feb 2020 Twitter by: Eleven Films @Eleven_Films AGF*¸ÉÉ‡v¸É : ρÑ>>>>‰t>>‰§§ @ poemproducer
9h Replying to
@Eleven_Films the sound design is for stupids
View conversation · Eleven Films @ Eleven_Films
9h Replying to
@poemproducer Ouch. Between putting the kids to bed and other things we may have rushed it.
View conversation · tybinðŸ...ðŸ'(C)ðŸ•"¸ðŸ... @ 4tybin
12h Replying to
@Eleven_Films @MikeBloomberg @ProjectLincoln @MikeBloomberg @ProjectLincoln get with these guys and find a way to put it on da ðŸ'º
View conversation · SuSk @ xluluo
12h Replying to
@4tybin @Eleven_Films and
2 others yes
@MikeBloomberg get this on tv in every state every day until election day
View conversation · NightShade 🖲 @ NightShade31415
12h Replying to
@Eleven_Films Holy Moley '­¸'­¸'­¸'­¸'­¸ what an ad.
twitter.com/eleven_films/s'... twitter.com/eleven_films/s'... View conversation · WeAreThe99% @ letsliveinpeace
11h Replying to
@NightShade31415 @Eleven_Films Truth Matters Here. Awesome!
View conversation · Vigil For Democracy ðŸ†ðŸ± @ vigil4democracy
12h Replying to
@Eleven_Films See how much can be packed into a minute and a half of clever filmmaking?
#ImpartialJustice will come too late for some, like
#Khashoggi, but thank you,
@Eleven_Films, for remembering him.
pic.twitter.com/4G6hMwhF42 View conversation · Belle Lynne @ 7bluebelle
9h Replying to
@vigil4democracy @Eleven_Films OMG'¼¸What they did to Khashoggi will haunt me forever'¼¸Some people do things and think there's no price to pay. ðŸ--¥Too bad they're very wrong.ðŸ--¥
View conversation · Jennifer Rubin @ JRubinBlogger
12h Replying to
@Eleven_Films my only criticism is that it should include the fidgeting during natl anthem. In fact an entire real of him disrespecting natl symbols would be handy
View conversation · #RIPGOP ' ðŸ"¸'ðŸŒ @ _ReaalAmerican_
11h Replying to
@JRubinBlogger @Eleven_Films It's in there near the beginning.
View conversation · Enter a topic, @name, or fullname
Settings Help Back to top ·
Turn images off
VIDEO-David Cedarbridge on Twitter: "@cheddar @BakerMachado @NoraKAli @TheSill @RocketMortgage @adamcurry @THErealDVORAK We've gone beyond furbabies now." / Twitter
Wed, 05 Feb 2020 10:26
Enter a topic, @name, or fullname
VIDEO - NYC subway hit by huge protest for free rides - YouTube
Wed, 05 Feb 2020 10:10
VIDEO - No licensing system coming for news organizations, Trudeau says
Wed, 05 Feb 2020 09:49
The Canadian Press Duration: 01:37 1 day ago
Conservative Leader Andrew Scheer accused the government of creeping authoritarianism after Heritage Minister Steven Guilbeault appeared to say over the weekend that an overhaul of Canadian media rules would include licences for news media. The Liberal government values free and independent news, Prime Minister Justin Trudeau replied.
More from The Canadian Press
VIDEO - The Brain Science Behind Social Conflict And Depression - YouTube
Wed, 05 Feb 2020 09:22
VIDEO - Iowa Republican Voters React To Trump's State Of The Union Address : NPR
Wed, 05 Feb 2020 09:19
Iowa Republican Voters React To Trump's State Of The Union Address NPR's David Greene watched the State of the Union speech far from the halls of Congress. He was in Madison County, Iowa, where President Trump won big in 2016. GOP voters there react to the speech.
February 5, 2020 5:09 AM ET
Iowa Republican Voters React To Trump's State Of The Union Address Download Embed <iframe src="https://www.npr.org/player/embed/802904125/802904126" width="100%" height="290" frameborder="0" scrolling="no" title="NPR embedded audio player">
NPR's David Greene watched the State of the Union speech far from the halls of Congress. He was in Madison County, Iowa, where President Trump won big in 2016. GOP voters there react to the speech.
VIDEO - Officials consider next steps after large homeless camp fire in NE Austin | FOX 5 New York
Wed, 05 Feb 2020 08:35
AUSTIN, Texas - A fire broke out at a large homeless camp below the eastbound frontage road of Anderson Lane, between IH-35 and Cameron Road Monday morning.
''We come down here for medical calls a lot. We always feared there being a fire -- well there was a fire. Upon arrival there were no residents of the camp that we had to deal with and rescue.'' explained Battalion Chief Matthew Cox, of the Austin Fire Department.
Cox, said firefighters were worried about spaces, small fires -- and possibly, people they could not reach in the catacomb like camp.
RELATED: AFD puts out fire at large homeless camp with living quarters, hazardous debris
''It is definitely a very unsafe situation for our firefighters as they're gonna have to dig through this stuff for hours.'' he said.
The camp spans roughly three football fields. Cox described, ''couches, tv's, propane tanks, padlocked areas, mattresses, trash and literally hundreds of needles.''
It is an entire system of underground homes. Many, containing stove tops, refrigerators, bunk beds -- all built into the overpass.
''I like landscaping and so I dug a big a** cave into the wall under the bridge about ten feet underground. I mean, I built a furnace and chimney in there and it's nice and warm and cozy.'' explained Ridge Johnson, who lives in the camp.
Johnson believes he is one of about 100 people living under the overpass.
''They've become very resourceful in dealing with lack of no power. So, there's a generator that we have to account for that leaking into the watershed.'' said Cox.
The camp sits in a watershed, on property the City of Austin's watershed department says belongs to TXDOT.
FOX 7 Austin spoke with TXDOT spokesperson Diann Hodges. Hodges explained that TXDOT did clean areas under overpasses for a time period. They turned that responsibility over the the City of Austin last summer. Then, in November Governor Greg Abbott instructed TXDOT to take back cleanups at 17 locations. She says those locations, are under overpasses primarily impacting pedestrians -- the Anderson Lane site, is not one of the 17 sites. "Bottom line" Hodges said, "the city is responsible for encroachments on state roadways, and encampments are encroachments" She explained that TXDOT has "never performed cleanups in the watershed. That has always been the city's responsibility."
TXDOT did however need to call Hazmat to the Anderson Lane site Monday -- as their bridge inspectors were unable to reach the fires starting point otherwise.
''Just to make sure it's safe for our guys to go down there.'' Hodges explained.
Inspectors said the bridge was fine. It re-opened for traffic at rush hour.
The City of Austin's Watershed Protection Department says a member of their ''pollution prevention team'' visited the site back in July -- following a citizen complaint.
Last week, the city began cleaning up homeless camps in watersheds as part of a $250,000 year long contract that could be extended. The city is flexible on how many sites they'll clean up this year, but right now, they're slated to clean approximately twenty. This site -- was not on the city's initial list of spots to clean.
But this Friday crews cleaned out a nearby site -- directing their attention to the site that caught fire Monday. As a result, they made plans to evaluate it, and hope to add it to their list of clean up sites.
''This is an area of illicit activity, so we're gonna have to coordinate with our police department to have a presence.'' explained Jose Guerrero.
Ridge Johnson, says the room he carved out was not impacted -- and he plans to return as soon as possible.
VIDEO-Breaking Down Fox's Super Bowl LIV Ratings and Coverage
Tue, 04 Feb 2020 23:16
Super Bowl ratings were up. | Jamie Squire/Getty ImagesViewership for this year's Super Bowl was slightly up, reversing a four-year trend of declining ratings. An attractive matchup, savvy time management, and a difference-making pregame show featuring the uber-valuable Terry Bradshaw helps explain the rise.
Fox's broadcast was relatively smooth thanks, in big part, to the unflappable Joe Buck and Troy Aikman, though there were some chaotic sideline interviews and the new touchdown graphic could be seen from space.
The Big Lead's Ryan Glasspiegel and Kyle Koster discussed all things Big Game media-related, including the great personal impact television ratings have on all our lives.
Also touched upon:
-The possibility of an even later Super Bowl kickoff time
-The relative calmness of this year's NFL season
-If the Monday Night Football song is misleading
-Foam fingers
VIDEO-USA TODAY on Twitter: "The Democratic response to the State of the Union is delivered by Michigan Governor Gretchen Whitmer. https://t.co/icMiupEGL8" / Twitter
Tue, 04 Feb 2020 22:59
Log in Sign up USA TODAY @ USATODAY The Democratic response to the State of the Union is delivered by Michigan Governor Gretchen Whitmer.
pscp.tv/w/cQovMDU3NXwx'... 7:34 PM - 4 Feb 2020 USA TODAY @ USATODAY
21m Replying to
@USATODAY Her focus on policy issues came after an acrimonious State of the Union speech that began with a refusal by Trump to shake House Speaker Nancy Pelosi's hand and ended with the speaker ripping up the text of the president's speech.
View conversation · USA TODAY @ USATODAY
21m Replying to
@USATODAY Whitmer ended her remarks by referencing the vote the GOP Senate is expected to take Wednesday to acquit Trump of the two articles of impeachment approved by the Democrat-controlled House.
View conversation · USA TODAY @ USATODAY
21m Replying to
@USATODAY "The truth matters. Facts matter. And no one should be above the law," she said. "It's time for action. Generations of Americans are counting on us. Let's not let them down."
usatoday.com/story/news/pol'... View conversation · connie mir @ tequilamir
1h Replying to
@USATODAY Will not listen to it after seeing Pelosi rip up the speech. I will vote Republican!
View conversation · Dave Hockett @ shabbytrick
19m Replying to
@tequilamir @USATODAY You always were anyway...
View conversation · #NeverTrumper @ horrorgothfan
1h Replying to
@USATODAY pic.twitter.com/KIBIrCCBz9 View conversation · Mike in the 419 @ buckeyes883
1h Replying to
@USATODAY ask why a kid had to fill a pothole and her government didnt??!!!
View conversation · Kelly @ nottobebelieved
1h Replying to
@USATODAY Well done Governor.
View conversation · james tolson @ jamestolson17
1h Replying to
@USATODAY She ran on street but didn't do nothing water still messhup
View conversation · Enter a topic, @name, or fullname
Settings Help Back to top ·
Turn images off
VIDEO-CBS News on Twitter: "Michigan Gov. Gretchen Whitmer targets President Trump's attempts to dismantle Obamacare: "It's pretty simple '-- Democrats are trying to make your health care better, Republicans in Washington are trying to take it away." #SOT
Tue, 04 Feb 2020 22:58
Dan Mckee @ 808ransom
1h Obamacare, was the largest act of EXTORTION, ever committed on the American people. Implemented by the Democratic Party. There are people spending life in jail, for much smaller scale, extortion schemes.
View conversation ·
VIDEO-Jason Donner on Twitter: "Speaker Nancy Pelosi on why she ripped up President Trump's speech: ''Because it was the courteous thing to do considering the alternatives.'' https://t.co/nYTjAZAwGo" / Twitter
Tue, 04 Feb 2020 22:55
Log in Sign up Jason Donner @ jason_donner Speaker Nancy Pelosi on why she ripped up President Trump's speech: ''Because it was the courteous thing to do considering the alternatives.''
pic.twitter.com/nYTjAZAwGo 7:44 PM - 4 Feb 2020 Twitter by: Jason Donner @jason_donner Cathy Filipcic @ CathyFilipcic
1h Replying to
@jason_donner @bdomenech She is completely unhinged
View conversation · DevinNunesTHEDragQueen @ NunesDrag
42m Replying to
@CathyFilipcic @jason_donner @bdomenech No, you're thinking of Rudy's jaw
View conversation · B Dazzles 🌸 @ just_barbra
1h Replying to
@jason_donner @maggieNYT pic.twitter.com/SgNxMcDZzd View conversation · itaexit @ kssdhr
49m Replying to
@just_barbra @jason_donner @maggieNYT These two are not so much better than the witch.
View conversation · Winston Salem @ winstonsalem33
1h Replying to
@jason_donner @drawandstrike It is time for her resignation.
View conversation · thetriggeredlibtardsnowflake @ squidgopro
50m Replying to
@winstonsalem33 @jason_donner @drawandstrike It's past time for his resignation.FIFY
View conversation · RON COULTER @ RONCOULTER
1h Replying to
@jason_donner @maggieNYT That doesn't even make sense. She should look into an assisted living arrangement with Joe Biden.
View conversation · Yolanda @ JesyQ
59m Replying to
@jason_donner @44Neha She's sharp. She also distracted his speech at ending by tearing papers. More pple will talk abt this. Love her.
View conversation · Neha @ 44Neha
34m Replying to
@JesyQ @jason_donner Trump's last
#SOTU2020 sentence was 'the best yet to come'... Who knew he'd be right in 2 seconds!! Love
#NancytheRipper View conversation · Enter a topic, @name, or fullname
Settings Help Back to top ·
Turn images off
VIDEO-DC Basement >> 🍊🍠>> 🐠on Twitter: "@adamcurry clip, Juan Guaid" joins us 🥃 https://t.co/o5Wsuh6gRU" / Twitter
Tue, 04 Feb 2020 22:54
Enter a topic, @name, or fullname
VIDEO-Praying Medic on Twitter: "Why is former Secretary of State John Kerry defending Quid-Pro-Joe? He has no choice. They're all complicit. They'll all go down together. '° H/T @TheSharpEdge1 https://t.co/2Mr9BPx4wK" / Twitter
Tue, 04 Feb 2020 09:57
Log in Sign up Praying Medic @ prayingmedic Why is former Secretary of State John Kerry defending Quid-Pro-Joe?He has no choice.They're all complicit.They'll all go down together.'°H/T
@TheSharpEdge1 pic.twitter.com/2Mr9BPx4wK 7:54 AM - 4 Feb 2020 Twitter by: TheSharpEdge @TheSharpEdge1 In Pursuit of Truth @ IPOT1776
1m Replying to
@prayingmedic @TheSharpEdge1 According to this new app I got, it looks like Kerry is running.And currently in 3rd.
View conversation · spyderlynn @ spyderlynn
2m Replying to
@prayingmedic @TheSharpEdge1 Friends of a feather....
View conversation · Wenny @ WenkiK
2m Replying to
@prayingmedic @TheSharpEdge1 He is fighting for his life. They are turning on each other now. It will get worse.
View conversation · Qanon Poland @ Kamil61289009
1m Replying to
@prayingmedic @TheSharpEdge1 I can not believe he really said that.
View conversation · Brian Griffin #WTO #Q 🇬🇧 🇺🇸 👋ðŸŽðŸ'£ @ ticticktock
1m Replying to
@prayingmedic @TheSharpEdge1 #HouseofCards View conversation · Barbara @ barb_rulez
23s Replying to
@prayingmedic @TheSharpEdge1 Tic-toc
View conversation · Chay @ eyecatcher2021
2m Replying to
@prayingmedic @TheSharpEdge1 He is a POS!
View conversation · ropes & lampposts @ EvoKram
1m Replying to
@prayingmedic @TheSharpEdge1 Kerry's son got paid by Burisma too.
View conversation · A B Jackson @ ABJackson10
1m Replying to
@prayingmedic @TheSharpEdge1 His step son is butt deep in it too
View conversation · Enter a topic, @name, or fullname
Settings Help Back to top ·
Turn images off
VIDEO-G L I T C H - 'If you get a pic in your phone and tap on it... that's it, you can have a virus' - inthemorning
Tue, 04 Feb 2020 09:55
3
VIDEO-Schiff: If Trump Isn't Removed He 'Could Offer Alaska to the Russians In Exchange For Support In The Next Election' | Weasel Zippers
Tue, 04 Feb 2020 09:44
Pushing bogus conspiracy theories on the Senate floor, well done.
5 Shares
VIDEO-OMG-LOL, he's absolutely RIGHT! Hot mic picked up Chuck Todd accidentally being VERY honest about the #IowaCaucus (watch)
Tue, 04 Feb 2020 09:34
You gotta love it when an elected official or pundit gets caught being far too honest on a hot mic. Chuck Todd who we typically do not agree with on most things, spoke for thousands of Americans last night who were watching the Iowa Caucus debacle unfold. We're pretty sure he didn't mean to be this honest about it but it works '...
Watch and listen closely as he is clearly speaking quietly:
'OMG,' he says, 'What an effing disaster.'
Spot.
Freaking.
On.
i swear to god '' just heard chuck todd say "this is a disaster" (referring to #IACaucus) on the NBC Now live stream in a hot mic moment '' and.. he's not wrong.
'-- Izzy Andros (@IzzyAndros) February 4, 2020
Just heard Chuck Todd in the background mic'd up go "God, What an effin disaster."
'-- Tyler Gardner (@tmgm528) February 4, 2020
Did Chuck Todd just say ''what a f*cking disaster'' on a hot mic while reporting on the Iowa caucuses?? @NBCNews
'-- Liz Dosta (@Liz_Dosta) February 4, 2020
He did indeed.
Accurate reporting for once, Chuck, way to go.
***
Related:
DELICIOUS: Lefties LIGHT Robby Mook up for claiming he had NOTHING to do with #IowaCaucus app (receipts say otherwise)
'Inexcusably secretive': Thread about Shadow Inc. (company responsible for #IowaCaucus app) so VERY revealing
BOOM! Brian Cates' brutal thread details EXACTLY why Adam Schiff and Dems are spewing so much crazy in the Senate
VIDEO-CNN Panel Dump On Biden: He Doesn't Have a Great History Running for President - YouTube
Tue, 04 Feb 2020 09:22
VIDEO - Licensing for media companies in Canada would likely be proportionate: Heritage minister | CTV News
Tue, 04 Feb 2020 08:47
OTTAWA -- The minister charged with modernizing Canada's broadcast and telecommunications law says if the government is to adopt recommendations laid out by an expert panel, licensing enforcement likely won't be applied the same way for small media groups as it will be for global tech giants.
One of the report's proposals, drafted by former telecommunications executive Janet Yale, specifically suggests requiring all companies that deliver "audio, audiovisual, and alphanumeric news content" to Canadians be regulated by the Canadian Radio-Television and Telecommunications Commission (CRTC) or another body, through a licence or registration.
"If you're a distributor of content in Canada and obviously if you're a very small media organization the requirement probably wouldn't be the same if you're Facebook, or Google. There would have to be some proportionality embedded into this," said Heritage Minister Steven Guilbeault in an interview on CTV's Question Period airing Sunday.
He said the government will take time to carefully consider the 97 guidelines set out by the expert panel, most of which suggest handing over more powers to the CRTC.
Among those recommendations is a requirement for streaming companies to contribute to the production of Canadian content by applying a levy or requiring they allocate a portion of revenue to the cause. The tax model has been popularly coined as the "Netflix Tax," but Guilbeault says the two concepts are different.
"It's about fairness. Companies are paying GST in Canada and there's no reason that some of the wealthiest companies in the world who are operating on Canadian soil shouldn't pay," said Guilbeault.
"They're investing a lot of money in Canada right now. We're asking them to dedicate part of that money to specific Canadian cultural content. We're not asking them to do more."
Michael Geist, the Canada Research Chair in Internet and E-commerce Law at the University of Ottawa, told CTVNews.ca the report is "candidly extreme" and has no "physical boundaries."
He said the goal of generating more Canadian content remains unclear, given the record success the Canadian film and television sector has seen in recent years.
"The industry is enjoying massive success, so the question then shifts a bit to OK; we want to ensure there are Canadian stories. Part of the problem with that argument is the last two years have also been record years for Canadian certified content," said Geist.
Beyond that, he said the panel does not address what it means to be Canadian.
"We have a system for it, but the system, I think many would acknowledge, is really bad at it," said Geist. "Netflix can never under the current definition create Canadian content, because we require the producer to be Canadian"
Instead of rejigging the current model, Geist says the panel has instead pitched a "massive and costly" overhaul of the system.
Conservative MP Michelle Rempel Garner, who holds the title of shadow minister for industry and economic development, shares this perspective and voiced her concerns in a statement following the release of the report.
In a subsequent interview with CTVNews.ca, Rempel Garner said, "The report seeks to add further layers of bureaucracy, on a system that needs to be disrupted writ-large."
She added that the recommendations don't go far enough in protecting Canadians against the misuse of personal data by companies like Facebook or Twitter or how to navigate Canada's emerging 5G network.
Another of the panel's submissions she contends with is the notion that the CRTC would identify news sites that are "accurate, trusted, and reliable" to enhance the "diversity of voices."
"It's very paternalizing and also very frightening to think that the government would try to impose or say that's the role of the government to control. That puts us in league with countries that control the media," said Rempel Garner.
Both Rempel Garner and Geist question whether a bill reflecting the panel's proposals would hold up against a constitutional challenge.
"It's not the sort of thing we'd expect to see in Canada, to be honest," Geist said.
VIDEO - John Kerry overheard discussing possible 2020 bid amid concern of 'Sanders taking down the Democratic Party'
Tue, 04 Feb 2020 08:13
Feb. 2, 2020, 3:53 PM EST / Updated Feb. 2, 2020, 6:59 PM EST
By Jonathan Allen and Allan Smith
DES MOINES, Iowa '-- Former Secretary of State John Kerry '-- one of Joe Biden's highest-profile endorsers '-- was overheard Sunday on the phone at a Des Moines hotel explaining what he would have to do to enter the presidential race amid "the possibility of Bernie Sanders taking down the Democratic Party '-- down whole."
Sitting in the lobby restaurant of the Renaissance Savery hotel, Kerry was overheard by an NBC News analyst saying "maybe I'm f---ing deluding myself here" and explaining that to run, he'd have to step down from the board of Bank of America and give up his ability to make paid speeches. Kerry said donors like venture capitalist Doug Hickey would have to "raise a couple of million," adding that such donors "now have the reality of Bernie."
Asked about the call later Sunday, Kerry said he was "absolutely not" contemplating joining the Democratic primary race. He reiterated the sentiment in a tweet later, saying "any report otherwise is f---ing (or categorically) false." Minutes later, he deleted the tweet and reposted it without the expletive.
He told NBC News later Sunday: "This is a complete and total misinterpretation based on overhearing only one side of a phone conversation. A friend who watches too much cable called me wondering whether I'd ever jump into the race late in the game if Democrats were choosing an unelectable nominee. I listed all the reasons I could not possibly do that and would not '-- and will not under any circumstances '-- do that."
It's not clear how serious Kerry was on the call about jumping into the race. But that he would even discuss the possibility suggests that prominent members of the Democratic Party remain deeply unsettled by the current field, Sanders' strength in the polls and the ability of any candidate to defeat President Donald Trump.
It also suggests that Kerry, who has campaigned with Biden in Iowa and New Hampshire, may be nervous about the former vice president's chances ahead of Monday's first-in-the-nation primary caucuses. At a campaign event in North Liberty on Saturday, Kerry spoke after Biden did, and longer.
This browser does not support the video element.
The Biden team denied any concerns. "Everyone knows that John Kerry is all in for us," said Symone Sanders, a senior adviser to the campaign.
Kerry was the Democratic nominee in 2004, losing to President George W. Bush. He got 251 electoral votes, compared to Bush's 286.
Kerry has served as one of Biden's top surrogates in the 2020 race. Biden leads Sanders, an independent senator from Vermont, by less than 4 points in the RealClearPolitics average of national Democratic primary polls, but he trails Sanders in the Iowa and New Hampshire polling averages.
Download the NBC News app for breaking news and politics
NBC News asked Kerry last month whether he regretted not entering the 2020 race.
"I'd be a liar if I didn't say I don't come out here and have fun and your juices don't get going," he said. "But right now, they're entirely focused on helping Joe Biden become president, and I'm very happy doing what I'm doing."
Jonathan Allen reported from Des Moines, and Allan Smith reported from New York.
Jonathan Allen is a senior political analyst for NBC News, based in Washington.
Allan Smith is a political reporter for NBC News.
Mike Memoli and Adam Edelman contributed.
VIDEO - (20) Benny on Twitter: "Biden to Voter in Iowa: ''I'm beginning to see why your wife left you'' https://t.co/GrThNKgFlz" / Twitter
Tue, 04 Feb 2020 07:28
Welcome home! This timeline is where you'll spend most of your time, getting instant updates about what matters to you.
Tweets not working for you? Hover over the profile pic and click the Following button to unfollow any account.
Say a lot with a little When you see a Tweet you love, tap the heart '-- it lets the person who wrote it know you shared the love.
Spread the word The fastest way to share someone else's Tweet with your followers is with a Retweet. Tap the icon to send it instantly.
Join the conversation Add your thoughts about any Tweet with a Reply. Find a topic you're passionate about, and jump right in.
Learn the latest Get instant insight into what people are talking about now.
Get more of what you love Follow more accounts to get instant updates about topics you care about.
Find what's happening See the latest conversations about any topic instantly.
Never miss a Moment Catch up instantly on the best stories happening as they unfold.
VIDEO-Ibrahim on Twitter: "MSNBC pundit says if you support Bernie Sanders over Elizabeth Warren it's ''showing your sexism.'' https://t.co/fghFIqOF6C" / Twitter
Tue, 04 Feb 2020 00:22
Log in Sign up Ibrahim @ ibrahimpols MSNBC pundit says if you support Bernie Sanders over Elizabeth Warren it's ''showing your sexism.''
pic.twitter.com/fghFIqOF6C 4:00 PM - 27 Sep 2019 Twitter by: Ibrahim @ibrahimpols Ibrahim @ ibrahimpols
Sep 27 Replying to
@ibrahimpols If supporting Sanders over Warren means you're a sexist, then supporting Warren over Sanders means you're an anti-semite. It's only fair 🤷🏽''‚¸
View conversation · Travis Talks 🌹 @ _Travis_Talks_
Sep 27 Replying to
@ibrahimpols Lol, of course she's a CAP person.
View conversation · Ibrahim @ ibrahimpols
Sep 27 Replying to
@_Travis_Talks_ Neera Tanden has taught her well
View conversation · Yusuf @ yusufneedsarest
Sep 28 Replying to
@ibrahimpols This is sexistNot because it's misandristicBut because it's misogynisticIt's misogynistic to gloss over Warren's plans with "they're better" and dwell on genderIt means a woman President is only important for her genitalia, her record is irrelevantThis woman is a sexist
View conversation · Melting Mermaid @ charlamanesbane
Sep 28 Replying to
@LucyTreadwell01 Or just plain greed...
twitter.com/artistJohnMora'... When economic inequality is so bad that the vast majority of people aren't even getting by and civilization itself is in danger maybe stuff like this should be frowned upon and maybe just maybe legislated against.
View conversation · Chris Ray Gun @ ChrisRGun
Sep 27 Replying to
@ibrahimpols "I aGrEe wItH aLL tHaT"
View conversation · Lord B'stard esq. @ THEbstardesq
Sep 27 Replying to
@ChrisRGun ShOw YoUr sUpPoRt FoR tHe wHaMeNs
View conversation · FeudalSerfOfThe1%🌹 @ NoraNorqdo
Sep 27 Replying to
@ANTIFA_lawyer Why are people not directing all of these responses to cnn and brian stelter and jessica mcintosh? It does no good to be battered and accept this slander. Where is winifred? Where is nina?
View conversation · Greg C (Bernie 2020) @ greg06897
Sep 27 Replying to
@NoraNorqdo @ANTIFA_lawyer It's msnbc and Bernie's team for whatever reason refuses to go after the media despite the nonstop lying and smearing by them. Only explanation is they think their coverage doesn't matter because not enough people watch or something like that
View conversation · 🌹ðŸ...º Justin has an orange vest & yellow on standby @ ACleverNickname
Sep 27 Replying to
@IDontEvenKnow42 Thanks for informing me of my privilege, rich person that got married at a ceremony presided over by Cory Booker.
nytimes.com/2015/05/31/fas'... View conversation · 🌹ðŸ...º Justin has an orange vest & yellow on standby @ ACleverNickname
Sep 27 Replying to
@IDontEvenKnow42 @EmTSuss @MSNBC @EmTSuss @MSNBC want to add a clarification on this?
View conversation · Enter a topic, @name, or fullname
Settings Help Back to top ·
Turn images off
VIDEO-Gordon Chang: Chinese authorities are falsifying the death toll from Coronavirus - Sara A. Carter
Mon, 03 Feb 2020 23:40
''Local Chinese authorities have just lost the ability to pick up corpses due to a breakdown in government,'' said Gordon Chang, a well known expert on China on ''Tucker Carlson Tonight.''
''So really what we are having right now is, they are completely overwhelmed,'' Chang added. ''They are not able to keep accurate statistics. So what we are witnessing is essentially a breakdown in government and keeping accurate statistics is a very minor part of their priorities right now.''
CORONAVIRUS LIVE UPDATES: Currently 19,700 Infected, 426 Deaths Globally, 11 U.S. confirmed infectedChang said that while he understands the preventative measure, he believes the quarantine has ''made the problem worse.''
''I can understand why they want to quarantine but remember, the Wuhan mayor said about 5 million people from his city left before the quarantine was imposed,'' he said. ''Also right now the quarantine has aggravated a problem and that is [that] people can't get to hospitals, so they are at home'...they are dying.''
''They are infecting other people in their households because they are not, in a sense, quarantined from wives, husbands, brothers, sisters,'' he continued.
''The quarantine has made the problem worse. It's also created panic. That panic has had consequences on, for instance, social cohesion which is absolutely necessary if you want to beat an epidemic.''
''It's not just Wuhan,'' he said. ''Many Virologists think that [conditions in] Wuhan will be duplicated in cities like Shanghai, maybe even Beijing. Clearly there is fear everywhere throughout China right now.''
''This is only going to get worse,'' Chang concluded, adding the virus will likely not be contained until ''April or May.''
VIDEO-Iowa Caucus 2020 Live Results And Updates : NPR
Mon, 03 Feb 2020 23:16
Get Caught UpThree hours into the Iowa caucuses, the state Democratic Party says ''quality checks'' are delaying results. The party later clarified that the issues were not due to a ''hack or an intrusion.'' Follow our liveblog below for the latest updates and analysis.
Trump wins the Republican caucusesSatellite caucuses at five Islamic centers mark historic momentHere's how the caucuses work and why they're importantWhat are SDEs? What you need to know as the results come in. Notify me about new posts
Biden Campaign Condemns Iowa Reporting System FailuresFormer Vice President Joe Biden's campaign condemned the Iowa Democratic Party's caucus results system after a delay in reporting results.
''The app that was intended to relay Caucus results to the Party failed; the Party's back-up telephonic reporting system likewise has failed. Now, we understand that Caucus Chairs are attempting to '-- and, in many cases, failing to '-- report results telephonically to the Party. These acute failures are occurring statewide,'' Biden campaign general counsel Dana Remus said in a letter to the state party.
As the night winds down with no results reported, the Biden campaign said they plan to focus on campaigning in New Hampshire.
'†‘ Back to top How Do You Break A Tie During A Caucus? A Coin TossAcross some of Iowa's more than 1,600 precincts on Monday night, two candidates garnered the same number of votes. How is the tie broken? With a coin toss.
The coin flip victors do not usually have an impact on who takes the state. In 2016, for instance, about a dozen coin tosses were reported. But it is yet another quirk in the rules governing the state's in-person presidential nominating process.
According to Iowa state law, ''If more than the requisite number of persons, including presidential electors, are found to have an equal and the highest number of votes, the election of one of them shall be determined by lot.''
It's unclear how many times a guess of heads or tails determined deadlocked districts on Monday night, but a number of recorded coin tosses shared on social media indicate that some precincts reached finality only after flipping a coin.
Back in 2016, videos of coin tosses stoked outrage among supporters of Democratic candidates who lost, as campaigns demanded recounts of the raw votes. But party officials defended the practice, saying tossing a coin was a legitimate way of choosing a winner when voter totals created a deadlock.
'†‘ Back to top Major development
'Not A Hack': Iowa Democratic Party Addresses Delay In ResultsThe Iowa Democratic Party has released a statement related to the delay in results tonight, insisting the issues are ''simply a reporting issue'' and not related to a hack of the system.
"We found inconsistencies in the reporting of three sets of results,'' IDP Communications Director Mandy McClure said in a statement. ''In addition to the tech systems being used to tabulate results, we are also using photos of results and a paper trail to validate that all results match and ensure that we have confidence and accuracy in the numbers we report. This is simply a reporting issue, the app did not go down and this is not a hack or an intrusion. The underlying data and paper trail is sound and will simply take time to further report the results."
According to aides with various Democratic campaigns, the IDP is holding a briefing call with campaigns. Details on the contents of the call were not immediately available.
But on the ground, there are reports of app malfunctions that delayed reporting, according to Des Moines County Democratic Party Co-Chairman Tom Courtney.
''The app didn't work. Things didn't work out right. I've been trying to call for several hours to report my results,'' Courtney told NPR. ''And I can't, I can't, get through the phone. It's a phone number, and I can't get through. That number is constantly busy.''
Instead, Courtney said, he's now going home and will call and report his precinct's results in the morning.
NPR's Miles Parks previously reported on concerns over the new use of a smartphone app for reporting results.
'-- Dana Farrington and Jessica Taylor
'†‘ Back to top A View From The Biden Watch Party As Supporters Await ResultsThe crowd is starting to fill in at Joe Biden's caucus-night party in Des Moines, held in a small event space on the campus of Drake University. Cable TV is blaring on big screens as volunteers and supporters mill around the venue floor, nursing beers and plastic cups of wine.
The staging is more stately than at most of the campaign events we've seen this week. Instead of hand-painted signs, there's a stage at the front of the room set with a backdrop of Iowa and American flags.
Firefighters Reese Isaacson, 29, and Brian Peppmeier, 47, caucused for Biden tonight. ''He's supported firefighters for 40-plus years, and I was happy with how things went in the Obama years, and he was a big part of that,'' Isaacson said. ''He's the best candidate to beat Trump in the election.''
Isaacson said Biden was in the top three at his precinct. At Peppmeier's precinct, Biden came in fourth. ''I think we have a lot of good candidates, but whoever comes out of this in the end is who I'll support,'' Isaacson said.
Holding drinks and munching on party mix, sisters Margaret and Mary Fitzgerald volunteered at a caucus site in Mitchellville, Iowa, about 12 miles east of here. ''We grew up on a farm near Des Moines. Our parents were politically active, so we have politics in our genes,'' Mary Fitzgerald said. ''I'm from Chicago, Margaret lives in Minneapolis, and I have a sister who's still on the family farm, and we said, 'We have to do something.' Putting signs up and canvassing is not enough, so we worked the caucus.''
Just 127 people were at that caucus site. Mary Fitzgerald says Biden won the site, followed by Pete Buttigieg and then Bernie Sanders. The Fitzgerald sisters are rooting for Biden. ''He's the only one that has the r(C)sum(C) who can possibly rescue our democracy,'' Mary Fitzgerald said. ''And his moral compass has been steady for 50 years. That will be such a refreshing change.''
'†‘ Back to top Bloomberg Is Not 'Buying a Campaign,' Adviser SaysBillionaire presidential candidate Mike Bloomberg's team is pushing back on the perception that his vast wealth is paving his way in the race for the White House.
''This isn't a rich guy buying a campaign,'' said Tim O'Brien, the senior adviser for Bloomberg's campaign. ''This is a purposeful, publicly spirited individual who sees this election as the culmination of his life's work and he's putting his resources behind it,'' O'Brien told NPR.
Bloomberg has shelled out more than $250 million since his campaign launched in November. The New York Times estimated Bloomberg's 60-second Super Bowl ad alone set the campaign back $10 million.
O'Brien noted that some national polls show Bloomberg sitting among the top four Democratic candidates '-- a result O'Brien said could not happen through advertising alone. Voters have come to know about Bloomberg from the ''thorough'' campaign structure the candidate has built, O'Brien said.
'-- Meredith Roaten, NPR Washington Desk Intern
'†‘ Back to top Major development
Iowa Democratic Caucus Results Delayed Due To 'Quality Checks'It's almost three hours since the Iowa Democratic caucuses began, and we are no closer to knowing who may win the most delegates out of the state.
Just before 11 p.m. ET, the Iowa Democratic Party put out a statement saying that the complicated reporting process is at least one reason for the delay.
"The integrity of the results is paramount. We have experienced a delay in the results due to quality checks and the fact that the IDP is reporting out three data sets for the first time. What we know right now is that around 25% of precincts have reported, and early data indicates turnout is on pace for 2016,'' said state party communications director Mandy McClure.
At this time in 2016 and even 2008 '-- the largest caucuses ever '-- there was a clear picture emerging about who had the best night. And while there are sparse reports about individual precincts, the Iowa Democratic Party has yet to report its state delegate equivalent numbers, which are the benchmarks that the Associated Press and NPR will use to determine a winner.
But, as McClure notes, the party is now also reporting out the first wave of caucus alignments, followed by the final alignment once caucusgoers decided to caucus for other campaigns if their first choice was not viable. NPR's Domenico Montanaro explained the differences between the three data sets that will be reported.
Des Moines County Chair Tom Courtney told the AP that technology issues appeared to be contributing to the delay. In his county, he said, ''an app created for caucus organizers to report results was 'a mess' and organizers were instead having to call in results to the state party.''
'-- Jessica Taylor, Cook Political Report
'†‘ Back to top GOP Secretary of State Denounces Conservative Group For Pushing 'Fake News'Iowa's secretary of state publicly denounced a conservative activist group and a number of prominent conservative media figures Monday for sharing misleading information about the Iowa caucuses online.
''It's disappointing to see you spread this #FakeNews,'' wrote Secretary of State Paul Pate, a Republican, on Twitter, in reply to Fox News' Sean Hannity.
The misinformation started with the group Judicial Watch, which published an ''analysis'' that purported to show that there were counties in Iowa with more registered voters than adult residents.
The Washington Post has a detailed analysis debunking that claim, but here is the crux of it:
''Of the eight Iowa counties listed by Judicial Watch, a single one '-- Lyon County '-- has more registered voters (8,490) than adult residents (8,430), based on five-year estimates released by the Census Bureau in 2018. The estimates, however, do not account for population growth over the past two years. And the total number of registered voters includes both active and inactive voters.''
Still, the claim went viral and is continuing to gain traction. A Judicial Watch post about it on Facebook has 12,000 shares. A tweet by the conservative activist Charlie Kirk has more than 41,000 retweets.
Disinformation experts often talk about how it's exponentially more difficult to debunk a viral claim than it is to make one.
This is another example. Pate's tweet pushing back against the claims on Twitter has fewer than 1,000 retweets.
'†‘ Back to top Fake News: How To Spot MisinformationNow that voting in the 2020 presidential election is officially underway, NPR's Miles Parks has some key ways to spot misinformation as you take in news about the campaign.
Exercise skepticism
Take in any new information, whether it is headlines on social media or a story from a buddy at happy hour, with a bit of doubt. Expect the source to prove their work and show how they came to their conclusion. And try to compare information from a number of different outlets, even if you have a favorite.
Understand the misinformation landscape
Misinformation, as a concept, isn't new. But the social media platforms for engaging with it are constantly changing and increasing their influence in the media world. Those platforms have no financial obligation to tell the truth '-- their business models depend, instead, on user engagement. Reducing your dependence on social media will be good for your news judgment (and for your sleep).
Pay extra attention when reading about emotionally-charged and divisive topics
Misinformation is most effective on hot-button issues and breaking news. Ask yourself: Is this a complicated subject, something that's hitting an emotional trigger? Or is it a developing news story where the facts are still being assembled? If the answer is yes, then you need to be especially skeptical.
Investigate what you're reading or seeing
What does that skepticism look like in practice? It means asking some questions of what you're reading or seeing: Is the content paid for by a company or politician or other potentially biased source? Is there good evidence? And are the numbers presented in context?
(The News Literacy Project created an app to help people test and strengthen their media literacy skills.)
Yelling probably won't solve misinformation
It's important to value the truth, but correcting people is always delicate. If someone in your life is spreading objective falsehoods and you want to help, be humble. Don't assume bad intentions or stupidity, just meet the other person where they are and be curious '-- think about opening with common ground and a question. Try to have the conversation in person or at least in a private online setting, like an email.
For more information on spotting ''fake news,'' check out the episode from NPR's Life Kit podcast.
'†‘ Back to top Impeachment Energizing Trump Supporters, Campaign SaysThe impeachment trial has energized President Donald Trump's base and expanded his coalition, said Kayleigh McEnany, the national press secretary for Trump's re-election campaign.
''Without a doubt, it sent a lightning rod through our base. They're more energized than ever before,'' McEnany told NPR, recalling crowds of people waiting in line overnight in New Jersey last week to get into a rally.
Trump, who easily won Republican caucuses in Iowa tonight, with a quick victory over former Massachusetts Gov. Bill Weld and former Illinois Rep. Joe Walsh, is widely expected to be acquitted in his Senate impeachment trial on Wednesday.
McEnany said Democratic candidates '-- ranging from former Vice President Joe Biden to Sen. Bernie Sanders, (I-Vt.) '-- have tacked too far to the left for voters. ''We view this entirety of the Democrat field as one socialist organism with many heads,'' McEnany said.
'-- Maya Gandhi, NPR Washington Desk Intern
'†‘ Back to top Rep. Ryan Touts Biden's Electability For 'Revolution' In White HouseOhio congressman and Joe Biden surrogate Tim Ryan told NPR that he expects the former vice president to stand out from the large field of Democratic candidates because of his electability in larger ''key states'' that are still to hold their primary races.
Citing Biden's high poll numbers, Ryan said he expects that Biden will perform well in the primaries of Michigan, Wisconsin, Ohio, Pennsylvania and Florida.
''There's lots of talk in the campaign about 'revolutions,''' Ryan said, referencing a buzzword used by Sen. Bernie Sanders' supporters in calling for progressive change within the Democratic Party. ''To me, the revolution is getting Donald Trump out of the White House. That is the revolution.''
Ryan pointed to President Trump's push for an investigation into Biden '-- a request at the heart of Trump's impeachment trial '-- as another signal of Biden's strength. ''When you look at Donald Trump risking his entire presidency to try to destroy Joe Biden, I think that tells you all you need to know about who the best candidate is that can beat him,'' Ryan said.
'†‘ Back to top Sanders Surrogate Counters 'Communist' CriticismAttorney and progressive activist Zephyr Teachout, a surrogate for Bernie Sanders' campaign, pushed back against Republican criticism of her candidate's far-left-leaning ideology with praise for his character and for the substance of his ideas in an interview with NPR on Monday night.
Teachout described Sanders as ''trustworthy'' and well positioned to take on President Trump. The self-described Democratic socialist has amassed a large following, particularly among younger voters, with his poll numbers rising in recent weeks. But the brand of politics that makes him popular on the left also makes him vulnerable to attacks from the right, which has branded him a socialist and communist.
''Well, we already see Bernie Sanders beating Trump in head-to-head polls, and people know that he identifies as a Democrat socialist. What they care about is what he is talking about,'' Teachout told NPR.
''I think sometimes there's a myth of the swing voter as being a voter who is sort of extremely centrist, as opposed to a voter who is independent, a voter who is anti-establishment, a voter who votes on character and trust,'' she said.
'-- Rachel Treisman, NPR Producer
'†‘ Back to top An Iowa Endorsement RecapAccording to the Iowa Starting Line, most candidates have received endorsements from various local officials '-- state senators, representatives and mayors '-- although a group of key endorsements continues to be up for grabs.
The Des Moines Register publishes a list of ''50 Most Wanted Democrats,'' made up of politicians and public figures from the Hawkeye State who are crucial endorsements in 2020, and as of tonight, only 14 have publicly endorsed candidates.
Sen. Elizabeth Warren has received the most, at five endorsements, with the latest coming in from Deidre DeJear, the 2018 Democratic nominee for Iowa's secretary of state. DeJear most recently worked as the Iowa director for Sen. Kamala Harris' presidential campaign.
Former Vice President Joe Biden has received endorsements from some of the top Iowa Democrats: former Iowa Gov. Tom Vilsack and his wife, Christie Vilsack, Rep. Abby Finkenauer, Rep. Cindy Axne and Iowa Attorney General Tom Miller.
Sen. Bernie Sanders has received one endorsement, from Stacey Walker, the chairman of the Linn County Board of Supervisors, and former Mayor Pete Buttigieg has been endorsed by Rep. Dave Loebsack.
Sen. Amy Klobuchar, an underdog in the Iowa polls, has secured three endorsements from the Des Moines Register list, including those of Cedar Rapids state Sen. Liz Mathis and Sioux City state Rep. Chris Hall.
'†‘ Back to top Buttigieg Ready To Tackle Racial Inequality, Surrogate SaysThe mayor of an Iowa city that is home of one of the largest African American communities in the state is making the case for Pete Buttigieg tonight. Quentin Hart, the mayor of Waterloo, Iowa, told NPR he supports Buttigieg '-- the former mayor of South Bend, Indiana '-- because he is confident he will work for positive change.
''Our conversations have always included deep conversations about race and inclusion,'' Hart said.
Hart called Buttigieg's plan to fight racial inequality one of the most ''comprehensive'' of the primary candidates and he said it addresses systemic issues that African Americans face across the country.
Buttigieg has struggled to win over black voters during his campaign. His handling of a police shooting of a black man in his hometown prompted Buttigieg to admit he could do more to address the racial disparity in the police force.
'-- Meredith Roaten, NPR Washington Desk Intern
'†‘ Back to top Satellite Caucuses At 5 Islamic Centers Mark Historic MomentThis year's satellite caucus sites include five Islamic centers, marking the first time in the caucuses' history that a mosque has served as a caucus site.
Graham Ambrose, a political reporter at the Quad-City Times, captured the scene at one of the caucus sites in Des Moines. He reports support swelled around former vice president Joe Biden and Sen. Bernie Sanders, I-Vt., as supporters switched between English and Bosnian to talk about their candidates.
At the Muslim Community Organization in Des Moines, Sanders swept support, according to Middle East Eye reporter Ali Harb.
Last week, Sanders won the endorsement of the Muslim Caucus of America, a nationwide political network.
The homogeneity of the Iowan electorate has become a prominent discussion in advance of this year's Iowa caucuses, drawing the ire of figures like Julin Castro, the presidential candidate-turned-Elizabeth Warren surrogate who's argued that Iowa should no longer be first in the primary process. Muslims make up around one percent of Iowan adults, according to the Pew Research Center.
But caucus sites like these five Islamic centers, or another at a South Sudanese Center in Des Moines, signal the significance these communities can play.
'-- Maya Gandhi
'†‘ Back to top Caucus AccessibilityThere has been renewed attention this year on the accessibility of the caucuses. Parents who don't have child care options, employees who work irregular schedules and can't take time off, and people with disabilities may struggle to navigate a process that demands a lengthy amount of physical presence, often in a crowded room.
Iowa is home to more than 3 million people, of whom about 2 million are registered voters, but the most who have participated in a presidential caucus was about 240,000 for the 2008 Democratic contest between Barack Obama and Hillary Clinton. In 2016, slightly more than 171,000 people turned out for the Democratic caucuses.
With an eye toward making the caucuses more accessible for all voters, the Iowa Democratic Party has ushered in some changes, including early check-in and a streamlined process for voters to sort out their support for candidates. It has also expanded "satellite caucuses."
But some disability rights advocates say it's not enough. ''It's like trying to fix your basement foundation with some masking tape,'' said Annie Matte, voting outreach coordinator at Disability Rights Iowa. Read more here.
'†‘ Back to top The Scene From Polk County Precinct 13Shortly before proceedings officially kicked off, over 100 participants had filled the gymnasium at Moore Elementary School in Polk County, Iowa Public Radio reporter John Pemble estimated. They clustered in groups according to their candidate preference, with a sizable number standing in the ''uncommitted'' group.
Then came a fundraising pitch to support the Iowa Democratic Party. Envelopes circulated as participants were encouraged to donate $46 '-- a nod to the presidential position that the candidates are vying to fill '-- or however much the participants could.
Also making their way through the gymnasium were presidential preference cards, passed out by a volunteer. Caucusgoers stood with hands raised, lowering them in exchange for the pieces of paper.
'-- Rachel Treisman, NPR Producer
'†‘ Back to top The View From Drake University's Caucus SiteIn a giant basketball arena on the campus of Drake University, hundreds of caucusgoers crowded the stands to make their choices for president.
At the entrance, volunteers clad in campaign T-shirts waved signs and held out hands with stickers on each finger. Outside the venue, a small group chanted ''Go, Joe, Go!''
Inside, each candidate has a section of the arena marked off with campaign placards. Volunteer counters with clipboards walk around to get a head count of how many people are in each camp. That's underway now.
At first glance, Joe Biden, Pete Buttigieg, Elizabeth Warren, Bernie Sanders and Amy Klobuchar have sizable contingents of supporters.
There's also a packed observer section that includes students from Purdue University in Indiana, a group from a high school in Ohio and scores of media members.
After the first count, there will be a 15- to 20-minute break for caucusgoers to realign with a new candidate if their preferred candidate does not meet the 15% threshold to be viable.
'†‘ Back to top President Trump Wins Iowa GOP CaucusesPresident Trump is projected to easily win Iowa's Republican caucuses, according to the Associated Press.
Trump did not face a serious threat in the first nominating event of 2020. His only challengers were former Massachusetts Gov. Bill Weld and former Illinois Rep. Joe Walsh.
But it's a victory that Trump's team will be eager to tout four years after he lost the 2016 GOP caucuses to Texas Sen. Ted Cruz and only narrowly edged out Florida Sen. Marco Rubio.
Top Trump surrogates are in Iowa tonight, including Donald Trump Jr. and girlfriend Kimberly Guilfoyle, and Eric Trump and wife Lara Trump. Those family members, along with Trump campaign manager Brad Parscale, acting White House Chief of Staff Mick Mulvaney and other top House GOP lawmakers, including House Minority Leader Kevin McCarthy, held a news conference in Des Moines earlier on Monday.
'†‘ Back to top One Group Not Participating In Iowa Caucuses? The State's FelonsWhile Iowa holds the country's first presidential nominating contest, the state has the distinction of being last on something else: It is the only remaining state where felons are banned for life from voting.
Voting rights groups estimate that some 52,000 people, some of whom committed crimes decades ago, are legally prevented from participating in Monday night's Iowa caucuses.
''It doesn't matter what you did. It doesn't matter how long ago it was that you did it. It doesn't matter how old you were. If you have a felony conviction, you are disenfranchised for life unless the government pardons you,'' Myrna P(C)rez, director of the Brennan Center for Justice's Voting Rights and Elections Program, told NPR.
The law has a meaningful impact on minority voters. About one in 10 black adults in Iowa is left out of voting, according to the ACLU of Iowa.
More than 90% of Iowa residents are white. And critics of the Iowa caucuses have long pointed out that given that voters must show up in person and spend hours choosing a candidate, it is not accessible to all voters, some of whom have to work or tend to their families or have other obstacles that prevent them from turning out.
P(C)rez, with New York University's Brennan Center, said the prohibition can affect generations. ''When you have communities where the adults cannot vote, you raise children who don't vote,'' P(C)rez said.
There is a movement in Iowa to topple the law. A constitutional amendment passed the Iowa House last year and is now pending before the Iowa Senate. Even if it passes both chambers, state voters would have to approve it before it was ratified into law. Last year, the Republican-led Senate failed to advance the amendment, even though it had the support of Republican Gov. Kim Reynolds. If it moves out of the Senate this session, the earliest it would appear on the ballot would be in 2022.
Some Republicans in the state Senate claimed the proposal was too vague on whether voters would have to complete their sentences before being able to vote. Other Republicans argued that victim restitution should have to be paid in full before someone can cast a ballot. Still others said violent felons, such as those with homicide and sexual offense convictions, should still be banned from voting.
Under existing law, the only way for felons to vote is to appeal to the governor directly. Reynolds has restored the voting rights of hundreds of people who have been convicted of crimes, Iowa Public Radio has reported.
New Jersey, Florida and Kentucky have all taken steps to restore voting privileges to those who have committed crimes, making Iowa the sole state that has kept scores of voters on the sidelines over felony convictions, despite polls showing that nearly two-thirds of Iowans support giving voting rights back to felons.
''All across the country, we have seen movement on this,'' P(C)rez said. ''I believe the people of Iowa do not want to be this kind of outlier. The people of Iowa do believe in forgiveness and second chances, and I hope politicians get the message and change the policy soon.''
'†‘ Back to top Final Travel NumbersThe Iowa caucuses and New Hampshire primary may be scheduled nearly back to back, but when comparing the Democratic candidates' travel to each state, we see just how many more candidates prioritize visits to Iowa over visits to New Hampshire.
As of late afternoon on Feb. 3., the candidates have held 1,137 events in Iowa and 682 events in New Hampshire.
What's more, almost every candidate, including the top four polling candidates '-- former Vice President Joe Biden, Sen. Bernie Sanders, Sen. Elizabeth Warren and former Mayor Pete Buttigieg '-- have prioritized holding events in Iowa instead of New Hampshire.
Also, the candidates holding the most events in Iowa and in New Hampshire are not leading in the state or national polls.
As of early this afternoon, Sen. Amy Klobuchar and businessman Andrew Yang have held the most events in Iowa (at 191 each), and in New Hampshire, Rep. Tulsi Gabbard has held the most events, at 117.
The general prioritization of Iowa over New Hampshire could be because of several factors. Historically, the Iowa caucus results have been seen as more predictive for Democrats than the New Hampshire primary; Sanders and Warren have something of a home-turf advantage in New Hampshire with their being from neighboring states; Biden's name recognition is strong, so he may feel he doesn't need to campaign in New Hampshire as much; and the primary simply comes after Iowa.
'†‘ Back to top Questions Remain About Caucus Results AppWith caucusing beginning soon, questions continue to swirl about the system in place for individual precincts to report their results to the state party.
Iowa Public Radio and NPR were the first to report last month that the state party would be using a new smartphone app to transmit results.
While security questions about the app remain, the biggest question tonight is usability.
John Deeth, the caucus organizer in Johnson County, which has 57 precincts, says he has heard from "about 20" precinct leaders who have had some sort of issue with accessing the app.
''Download issues, password issues,'' Deeth said. ''It might be user error; it might just be confusing.''
Amber Mohr, a precinct chair in Shelby County, says she got a number of different error messages when she tried to download the app, so she has decided to just submit her precinct's results by phone.
Bloomberg and CNN reported similar complaints from county chairs on Monday as well.
The Iowa Democratic Party says the issues it has heard about from across the state have been in line with what it was expecting and that's why it offers multiple channels to report results.
''The IDP is working with any precinct chairs who want to use the optional tabulation application to make sure they are comfortable with it,'' said Mandy McClure, the communications director for the state party. ''We've always been aware that many precinct chairs prefer to call in results via a secure hotline, and have systems in place so they can do so.''
Deeth, of Johnson County, said he was advising precinct chairs in his county to just use the phone if they have any trouble with the app whatsoever.
''Just get the results to Des Moines however best you can,'' Deeth said.
The party has been tight-lipped about the app, declining to name the developer or detail which security experts have performed audits on the software.
While the Iowa Democratic Party says this is to increase security, cybersecurity experts say that this strategy just makes oversight and trust more difficult.
Party officials said in January that there would be a public unveiling of the app for media members before the caucuses, but that never happened.
''It's remarkable how much opacity there is on this topic,'' said Joe Kiniry, chief scientist of the election technology company Free & Fair.
Iowa Public Radio's Kate Payne contributed to this report.
'†‘ Back to top Bloomberg And Steyer Massively Outspend Opponents In AdvertisingBillionaire businessmen Tom Steyer and Michael Bloomberg collectively make up 78% of the total amount spent on advertising in the presidential race, according to Jan. 31 data from Advertising Analytics.
Despite announcing his candidacy in late November, Bloomberg has spent over $300 million on advertising, with $254 million going to broadcast and cable TV ads as well as $44 million to digital ads.
What's more, Bloomberg is not focusing on the early caucus and primary states and is instead catering his advertisements to larger states with more delegates and later primary contests.
Steyer, who announced his candidacy in July, has also spent a significant amount of money on ads '-- totaling $145 million.
After Bloomberg and Steyer, the rest of the Democratic field has spent significantly less.
Bernie Sanders has spent $31 million on ads, followed by Pete Buttigieg ($28 million), Elizabeth Warren ($21 million) and Joe Biden ($17 million.)
As of Jan 31., President Trump's total ad spending is much lower than what either the Steyer or Bloomberg campaign is shelling out, but it's still higher than that of any of the Democratic candidates leading the field.
Trump has spent a total of $52 million on advertising, with $36 million specifically allotted to digital ads '-- numbers that are comparatively small next to the Democrats' grand total of $573 million.
'†‘ Back to top For Sanders, It's Also About Turnout''We fit a lot of people into a small room,'' said Sen. Bernie Sanders at a meet-and-greet at his Newton field office over the weekend. The room was at capacity with 150 people, all fanning themselves to keep cool.
Sanders called the campaign ''a tight race'' and said a victory in Monday's caucuses depends on turnout. ''If we have low turnout,'' he said, ''we lose.''
But despite the close quarters and heat, people were enthusiastic to see Sanders speak.
Jaxine Corum, 60, volunteered at the event and has also been housing young canvassers visiting Iowa for the first time. ''They've come from all over,'' she smiles. ''Australia, Morocco, California. '...They get so jacked up about going outside and meeting people. We try to give them a background of the community so they have an idea of what they may be running into.''
She says that she supported former Secretary of State Hillary Clinton in 2016 and that it was harder to choose this time around whom to campaign for, given the large field. She ultimately decided to support the Vermont senator after her daughter Suzanne started volunteering for him.
'†‘ Back to top Biden Surrogate Tom Vilsack Says 'Midsize Turnout Favors Joe Biden'Joe Biden supporter and former Iowa Gov. Tom Vilsack tells NPR that he is skeptical that 2020 turnout numbers will surpass the record highs set in 2008.
In an interview with NPR's Mary Louise Kelly, Vilsack added that a lower caucus turnout could actually benefit Biden.
Vilsack, who also served as agriculture secretary in the Obama administration, has been campaigning with the former vice president throughout the day.
Vilsack: I suspect the turnout is not going to be as great as it was in 2008, but perhaps a bit more than what it was in 2016. In that scenario, I think Joe Biden does very well. I think he '--
Kelly: You think high turnout favors Joe Biden?
Vilsack: No, I think '-- I think an average to midsize turnout favors Joe Biden. I think if there is a large turnout and it exceeds 2008, that may obviously support Sen. Sanders' contention that he can somehow bring additional people into the process.
Sen. Bernie Sanders has been leading in the Iowa polls for the past week, with the former vice president in second. Sanders has also visited the Hawkeye State more than Biden has '-- holding 138 events to Biden's 117.
Vilsack also stressed the importance of delegate counts over the number of raw votes, referencing that precincts will report the first and final rounds of votes in addition to state delegate equivalents '-- a change that may increase momentum for some campaigns.
''People should be very patient. It may be a long night before we know for a fact how the delegate count came out,'' Vilsack told Kelly, adding later, ''I think there's a tendency on the part of some to suggest that that [the raw vote] is equal to a victory.''
'†‘ Back to top Movie Theater Hosts Satellite Caucus In ArizonaClose to 200 people are gathering at a satellite caucus site in Queen Creek, Ariz., about an hour east of Phoenix. It's one of nearly 100 satellite caucuses that the Iowa Democratic Party set up around the state, country and world. Event organizer and lifelong Iowan Joan Koenigs said people have come from all over the state, some driving many hours.
Koenigs originally planned to hold the event at her house, but interest was so overwhelming that the caucus will be held in a movie theater instead, an expense that came out of Koenigs' pocket.
''Hosting this has been rather costly for me. This facility was more than we intended to spend, but the numbers kept growing and there was no turning back," said Koenigs. Shortly after, the caucusgoers passed around a hat and recouped her expenses.
One Iowan called it ''the most comfortable caucus'' he has ever attended.
Many present are retirees who spend part of the year in Arizona. Among them is Mary Logan of Mount Vernon, Iowa, who spends four months each year in Arizona. She says she saw the recent movie about Mister Rogers at this theater. ''Our default is love and caring. That's what we are craving '-- being aligned with each other. I may not agree with you, but let's not hate each other '-- and [hate] is what has been preached to us for three years from this White House."
'†‘ Back to top What To Know About The Iowa CaucusesVoting in the Democratic presidential nominating contest is about to kick off with the Iowa caucuses.
The stakes are high in Iowa '-- the last four Democratic nominees have all won the Hawkeye State. But after about a year of campaigning and $50 million spent here by the candidates, the outcome is unclear.
When are the Iowa caucuses?
7 p.m. CT/8 p.m. ET
How long should they last?
About an hour, maybe less this year, because of a rules change allowing only two rounds of caucusing.
When should we expect results?
The first results are expected to start coming in by 8:45 p.m. ET or so. It could take longer if results are close.
Read the full explainer here.
'†‘ Back to top The Calm Before The Caucus '†‘ Back to top Iowans Abroad: Progressive Candidates Get Support In Far-Flung CaucusesBernie Sanders could be rising in Scotland. Elizabeth Warren may take France.
The numbers are puny and aren't expected to have bearing on the final results, but some early tallies are beginning to be reported from Iowa's far-flung voting centers. It's part of the Democrats' first-time effort to hold caucuses for Iowans abroad.
Vermont Sen. Sanders won support from nine of the 19 caucusgoers in Glasgow, Scotland, The Associated Press reported, followed by Massachusetts Sen. Warren and former South Bend, Ind., Mayor Pete Buttigieg.
In Paris, meanwhile, a France24 journalist tweeted that Warren garnered the most support, followed by Sanders, Klobuchar and Buttigieg.
The AP reported that the Paris caucus was organized by a 20-year-old first-time voter.
As noted earlier on the liveblog, Iowans in the former Soviet republic of Georgia also completed caucuses. A journalist there tweeted that the results from the Georgia caucus would be made known after caucuses in Iowa take place.
These are some of the dozens of satellite caucuses taking place outside of Iowa, three of them overseas.
'-- Alex Leff
'†‘ Back to top What Are SDEs? What You Should Know As The Results Come InFor the first time, the Iowa Democratic Party is going to be releasing three separate results at the same time at the end of the night.
The preference vote after the first roundThe preference vote after recaucusingThe number and percentage of ''state delegate equivalents,'' or SDEs, that the candidates are awarded out of each of the caucus locations.The percentage of the SDEs won is traditionally how a ''winner'' is determined. NPR relies on the Associated Press to call elections. The AP will project a winner of the Iowa caucuses based on the SDE calculation. One reason for this is not just tradition but because this is the contest the campaigns play for; it is the truer measure of the campaigns' organizational strength.
Simply put, SDEs are not delegates. But with some math, SDEs are converted to the proportional amount of delegates a candidate gets in each precinct.
There are 2,107 total SDEs up for grabs on caucus night in Iowa. Here's the formula: Take the number of people in a candidate's corner at the end of the second (and final) round, multiply that by the number of delegates assigned to the precinct and then divide that by the total number of caucusgoers at the site.
So if Joe Biden hypothetically gets 20% in a precinct that awards 40 delegates, and if 100 people showed up, the math looks like this:
20 x 40 = 800 (the number of people in a candidate's corner multiplied by the number of delegates)800/100 = 8 (Divide that number by the total number of caucusgoers)Eight is the number of SDEs Biden would win out of this particular caucus site. Add that to his other SDEs from the other 1,677 caucus locations for an eventual statewide total.
'†‘ Back to top Here Are The Campaigns' Closing TV MessagesA look at what the top four candidates are saying to end their Iowa campaigns:
Joe Biden: Biden's closing argument is a recap of the very argument he made at the outset of the campaign: The soul and the character of the country are on the line.
In his campaign speeches, he focuses on morality more than policy. And in both speeches and ads, Biden suggests he has only one rival: President Trump.
''Every day he's president, Donald Trump poses a threat to America and the world,'' a narrator's voice says in one of the campaign's closing ads, called Threat.
The ad also displays a series of poll numbers showing Biden beating Trump in hypothetical matchups. ''This is no time to take a risk,'' the narrator says.
'-- Asma Khalid
Pete Buttigieg: On the stump, the 38-year-old former mayor of South Bend, Ind., portrays himself as the candidate with a vision of the future.
A closing ad '-- It's Time '-- reinforces that message in Buttigieg's own voice, heard over scenes of supporters at rallies and town halls.
It's all about the need for America to ''turn the page.'' He decries a Washington ''paralyzed by the same old thinking, polarized by the same old fights.''
And he talks about his policy priorities, including reversing inaction on climate change, as part of a ''bold vision for the next generation.''
'-- Don Gonyea
Bernie Sanders: Sanders' final advertising pitch focuses on an implied contrast with the candidate the polls view as his chief rival: Biden.
In recent weeks, the Sanders campaign has focused on his steadfast support of Social Security and other entitlement programs, and pointed to several statements Biden had made earlier in his career that indicated an openness to freezing, or even cutting, Social Security as part of broader efforts to trim government spending.
Biden has made it clear he'd work to expand Social Security as president, but the Sanders camp sees the issue as a clear contrast between the two, and one of their final ads in Iowa focuses on it.
The ad heralds Sanders as the protector of the program, arguing that to defeat Trump, ''we need a nominee who has always fought to protect Social Security.''
'-- Scott Detrow
Elizabeth Warren: Warren has crafted an identity as the candidate with an encyclopedia of policy proposals. However, her closing arguments to Iowans are focused around three other topics: accomplishments, electability and unity.
In her final ads in the state, Warren highlights her endorsement from The Des Moines Register, as well as her work on creating the Consumer Financial Protection Bureau.
She also has ads that feature Republicans (or former Republicans) who support her.
In one, an Iowa man named Stephen, who caucused for Trump in 2016, is now caucusing for Warren. ''For people who say that a woman can't win, I say nonsense,'' he says. ''I believe a woman can beat Trump, and I believe Elizabeth is that woman.''
'-- Danielle Kurtzleben
'-- NPR Staff
'†‘ Back to top Iowa's Past Winners, And Some Losers, Went On To Win NominationIowa holds just a small portion of the delegates up for grabs during the primary season, but the stakes in the state are incredibly high. A candidate's showing in Iowa can launch or sink a presidential campaign.
Seven of the last nine Democratic nominees won Iowa. But only two of those candidates became president: Barack Obama and Jimmy Carter. Most recently, Hillary Clinton beat Bernie Sanders in Iowa by the slimmest of margins '-- just 0.3%.
That said, losing in Iowa doesn't always spell trouble for a candidate. Bill Clinton, George H.W. Bush, Ronald Reagan and Donald Trump each lost Iowa caucuses during at least one of their presidential bids, but went on to win in November.
In 2016, Ted Cruz narrowly beat Trump in Iowa. And in 2012, eventual Republican nominee Mitt Romney narrowly finished second to Rick Santorum. In 2008, John McCain not only didn't win the Iowa caucus, he finished fourth. But that didn't stop him from clinching the GOP nomination.
Back in 1992, Bill Clinton opted to largely skip over campaigning in Iowa. That's because there was a very popular Iowan also competing for the nomination '-- Democratic Sen. Tom Harkin. Harkin got 76.5% of the Iowa caucus vote, compared with Clinton's 2.8%.
And in 1976, the then governor of Georgia, Jimmy Carter, actually placed second to ''uncommitted,'' but won the largest vote share of any candidate. His surprise showing in Iowa helped propel him to the nomination and the presidency.
'†‘ Back to top Caucusing For Iowa In '... The Caucasus?Iowa voters stretch far and wide, way beyond the state's borders. Here's a tweet by journalist Joshua Kucera about a caucus site all the way in Georgia '-- the former Soviet republic.
The voting site in Georgia is one of dozens of satellite locations partaking in the Iowa caucuses. They include the Washington, D.C., area and Arizona, as NPR stations have been reporting.
As Iowa Public Radio's Kate Payne noted, this is the first time ''Iowans living outside of the US could request to caucus somewhere other than their neighborhood precinct.''
'-- Alex Leff
'†‘ Back to top Meet Iowa's Teen Precinct ChairStill a few years from voting age, 14-year-old Olivia Crum will be chairing a caucus in Iowa's Polk County, according to Polk's Democratic Party chairman.
In a tweet quoted by Iowa Public Radio Caucus Land co-host Kate Payne, Sean Bagniewski said on Sunday night that Olivia will be the caucus chair in the precinct of Sheldahl. Bagniewski believes she will be the youngest caucus chair in Polk's history.
'-- Alex Leff
'†‘ Back to top 5 Facts About IowaEvery four years, candidates, reporters and political operatives flood Iowa for one of the most prominent events on the political calendar '-- the caucuses.
Iowa is basically synonymous with presidential politics, but in case you haven't been glued to campaign coverage over the past few months, here's some key trivia to impress your friends when you're watching the returns tonight:
The word caucus: The origins of the word ''caucus'' aren't 100% clear, but scholars say the name likely came from the Algonquin Indian word cau'-cau-as'u. It means ''one who advises, urges or encourages'' and ''to give counsel, promote or incite to action.''
Turnout: The share of Iowa's voters who participate is fairly low. In 2016, 18.5% of the state's more than 1.9 million active registered voters turned out for Iowa's Republican and Democratic caucuses, according to Pew Research Center. That trailed behind the country's 29.3% overall turnout for primaries.
First in line: Iowa's position in the calendar lineup was cemented in the Vietnam War era as activists called for broader participation in the nominating process. Iowa's process was so long, the state needed the extra time to get its delegates counted in time. 1976 was the first time both Republicans and Democrats held their Iowa caucuses on the same night.
Demographics: Iowa's population has grown by about 3.6% since 2010 to 3,155,070. Thirty-six percent of the population lives in a rural place. About 90% are white. The median age is just over 38.
Precincts: 1,678 precinct caucuses will gather when caucusing kicks off at 7 p.m. CT.
'†‘ Back to top Klobuchar: 'We Are On A Surge'Minnesota Sen. Amy Klobuchar says her campaign is seeing a boost as Iowans prepare to caucus tonight.
''We are on a surge in our campaign,'' Klobuchar said Monday in an interview with NPR's Morning Edition.
''The poll yesterday was literally just a few points behind some of the other candidates that have been talked about a lot, and I was in third place in two polls last week,'' she said.
Morning Edition co-host David Greene noted that opinion polls have generally put Klobuchar behind other leading Democratic candidates, and he asked where she sees the rise coming from.
''The kind of support I've gotten out there. All of the people that have turned out at all of our events,'' she said. ''The fact that we have the endorsement of The Quad-City Times, the Iowa City newspaper, every paper in New Hampshire that's endorsed so far. And we have more endorsements of legislators in Iowa than any other candidate. They're the ones that are going to be in the rooms where it happens on caucus night tonight.''
She continued, ''And I'm only one of two candidates remaining that's from the Midwest '-- the very area that we need to win.''
Klobuchar believes she has ''really built the kind of support that we need, not just to do well in a primary or a caucus, but to actually win in the general election. To bring back those voters that voted for Barack Obama and then went and turned and voted for Donald Trump.''
''That's how I've run every race,'' she said.
Listen to the full interview here.
'-- Alex Leff
'†‘ Back to top The Progressives' Choice: Warren Or Sanders?One of the big questions of the 2020 primary '-- especially in its early months '-- was what Vermont Sen. Bernie Sanders' 2016 supporters would do, now that he was running in a field with several other progressives.
As NPR's Asma Khalid reported from New Hampshire last week, many Sanders backers started out the year shopping, checking out Massachusetts Sen. Elizabeth Warren in particular, but ultimately came home to Sanders.
One of the most high-profile people to face this choice: Washington Rep. Pramila Jayapal, who chairs the House Progressive Caucus. Jayapal, a ''Medicare for All'' champion, has worked closely with Warren and Sanders, but ultimately backed Sanders, and has been in Iowa campaigning for him in the final days before the caucuses.Speaking to NPR after she met with a group of Sanders volunteers who were about to knock on doors in Greenfield, Jayapal said her decision came down to two things: First, she said, Sanders matched her policy priorities just a little more closely.
''The second point,'' she said, ''is that I think Bernie is actually the only candidate who is expanding the electorate. And for me, the myth of the likely voter and moving past that to the truth of every voter is the only way we take back this country. And so I am looking for candidates who are just as committed to investing in getting young people and folks of color and immigrants out. And that's what I see with Bernie, is that that's what he's doing. He's not relying on the regular base.''
Jayapal had just told the group how important representation is to her, and how few women '-- and women of color, in particular '-- hold federal office. She conceded it was ''tough'' to ultimately go against Warren, who's running to become the first female president. ''You know, what I tell people is that as an immigrant brown woman, I don't have the luxury to think about things from just one perspective. I can't just look at, you know, gender. I can't just look at race and I can't just look at class. My life is such that I have to look at all three and I have to make the best decision about who is going to fight for all three in the most appropriate way.''
'†‘ Back to top Buttigieg: 'We Certainly Need A Good Finish Here In Iowa'Former South Bend, Ind., Mayor Pete Buttigieg told NPR's Morning Edition that the results today will be important in determining what kind of path forward his campaign has.
''We certainly need a good finish here in Iowa,'' Buttigieg told NPR's Rachel Martin in a live interview at the Smokey Row coffeehouse in Des Moines. He refused to say whether his campaign can go on if he doesn't place first or second tonight.
Buttigieg faces an even tougher road ahead in more diverse states. He polled at just 2% with African Americans in a recent survey from The Washington Post and Ipsos.
''The African American voters who know me best in my own community, for example, are supporting me. And many of my most visible supporters here in Iowa are black elected officials,'' Buttigieg told NPR.
''No one is feeling the pain of living under the Trump presidency more than Americans of color,'' he added. ''Their top priority as I speak to them, so often, is to make sure that we have the campaign that can win. Which, when you're new, you have to demonstrate on the ground in the places where you've been campaigning the most. So our first opportunity to really prove it, not just to tell but to show, that we've got the campaign best positioned to deliver that win, that starts right here in Iowa.''
Listen to the full interview here.
'†‘ Back to top PODCAST : On The Ground In IowaThe NPR Politics Podcast is taking you to Iowa today. Follow along with Scott Detrow as he and the rest of the podcast team crisscross the entire state, touching down at candidate events in the frantic final 48 hours of campaigning.
They explore the themes of the race '-- and recover from a couple of wrong turns, as well.
Listen wherever you get your podcasts, or click here.
'†‘ Back to top Caucus Day Arrives With Energy And UncertaintyThe campaign in Iowa has been marked by uncertainty for months. Four different candidates have led the polls over the past year: Joe Biden, Elizabeth Warren, Pete Buttigieg and, lately, a resurgent Bernie Sanders.
Our reporting has added evidence to the polling that shows the Vermont senator on the rise, consolidating progressive support. Sanders is confident, but it's hard for anyone to be certain about how things will turn out tonight.
After all, those top four candidates each pulled in big crowds over the weekend. Buttigieg and Warren have fallen back from Biden and Sanders in polling, but they have strong organizations on the ground to get people out to caucus. That can make a big difference in this unique process, which requires a lot of effort and elicits much lower turnout than traditional primaries.
And while Sanders may be consolidating more support among progressives, the Democratic Party is nowhere near unified around a single candidate.
All of that means there's a good deal of uncertainty heading into tonight, unless you're a Republican.
There's no suspense about how President Trump will perform in the GOP caucuses, but his campaign is making sure the Democrats don't get all of the attention in Iowa today.
'†‘ Back to top Buttigieg Supporter Sees A Candidate With Less BaggagePete Buttigieg held his last rally before the caucuses in a round high school gym in Des Moines on Sunday afternoon.
Not much had changed in the former mayor's 11th iteration of his stump speech since Friday, but this time he was interrupted by a big crowd '-- roughly 2,000 supporters chanting ''I-O-W-A! Mayor Pete all the way!''
Not everyone in the room had always supported Buttigieg. Pam Hyde, 52, wants President Trump out of office, but she wasn't sure which candidate could do it.
''It seems like there's been a lot of discussion about whether we need to go way left in order to, like, balance out Trump, or whether we should go center to try and get other supporters to our side,'' she said.
Hyde finally decided a moderate candidate has the best chance of beating President Trump, but there are other reasons she's with Buttigieg.
''Pete has a history in the military. He has such a clean record and such a small record being a mayor, that there's a lot less to pick on.''
'-- Eliza Dennis, NPR Producer
'†‘ Back to top The Top 4 Candidates Are Seeing Big CrowdsWhat's been striking over the last two days of campaign events is just how big the crowds have been at the top candidates' events.
The largest crowd so far, by far, has been Bernie Sanders' rock concert in Cedar Rapids last night. But Pete Buttigieg also drew a massive crowd today to a very large high school gym in Des Moines.
Elizabeth Warren had a capacity crowd of a few hundred earlier today in Indianola, and Joe Biden packed a middle school gym in Cedar Rapids.
The record for turnout in the Democratic Iowa caucuses is 239,000 in 2008 during the Barack Obama-Hillary Clinton-John Edwards race.
Seeing the enthusiasm on the ground here for all the top candidates, the state party and the campaigns are preparing to set a new turnout record tomorrow.
The caveat, of course, is weather. As of this writing, it's an unseasonably warm 52 degrees and sunny here in Des Moines. Tomorrow, caucus day, it's supposed to drop 20 degrees with a chance of snow.
The Sanders campaign believes high turnout ensures a win for Sanders, but beyond Iowa, it's clear Democrats have a lot of interest in this election '-- and they hope that bodes well for November. After all, Obama won the presidency with record turnout; Clinton won the popular vote but lost the presidency and Electoral College in 2016, which saw the second-highest turnout (171,000); and, in 2004, just 124,000 turned out for the caucuses and John Kerry, who won the caucuses, lost the general election.
'†‘ Back to top As Warren Tries To Broaden Appeal, Her 'Fight' Message May Be Too Much For Some In MiddleSen. Elizabeth Warren of Massachusetts has tried to straddle the line between the no-compromise progressivism of Bernie Sanders and what she sees as the moderate incrementalism of Joe Biden.
One word has come to be a hallmark of Warren maybe more than anything else in her quest for the Democratic presidential nomination: ''fight.''
''Fight back,'' Warren implored an overflow crowd of a few hundred here on the campus of Simpson College in Indianola, Iowa, about 20 minutes outside Des Moines. She had just rattled off various regulations that have been enacted over the years that have made businesses and even kitchen appliances safer.
''Fighting back is an act of patriotism.''
But that signature word may be making it harder for Warren to win over people who might be open to her but also want to win moderates '-- and the general election in November '-- especially as Sanders has surged with dyed-in-the-wool liberals.
''The fighter message appeals to Democrats; it does not appeal to moderate people in the middle,'' said Dave Everett, 60, of Des Moines.
Everett, donning an Iowa State pullover, said he is leaning strongly toward Minnesota Sen. Amy Klobuchar, also considering Pete Buttigieg and could wind up with Biden. He said he likes Warren and has seen her at a number of events, but he has lots of Republican friends and neighbors, not enamored with President Trump and looking for something else, but Warren isn't it.
The ''fight'' message, he said, ''doesn't give them anything that's an alternative. It's a message to ride on that will not appeal to the middle.''
'†‘ Back to top Trump Prepares Counterprogramming PushWhile the Democratic presidential hopefuls are getting most of the attention in Iowa, President Trump's reelection campaign isn't ceding the state to them.
Trump held a rally at a filled-to-capacity arena in Des Moines on Thursday night. And the campaign is bringing in about 80 surrogates '-- including acting chief of staff Mick Mulvaney, Donald Trump Jr. and Eric Trump, Housing Secretary Ben Carson, and House Minority Leader Kevin McCarthy '-- to speak to local and national media on the day of the caucuses.
''All of that is part of this coordinated effort to not just reelect the president, but also help all GOP candidates down the line,'' says Jeff Kaufmann, chair of the Republican Party of Iowa.
The Trump campaign's director of strategic communications, Marc Lotter, says the campaign's presence this early in Iowa is also a message to the Democrats who stay in the race past the caucuses.
''It's good to remind people that whichever of them comes out of this mess that they call a primary you get to get into the ring with Donald Trump,'' Lotter says. ''So we're just making sure folks know we're still here.''
Republicans will also hold their own caucuses tomorrow, and the Trump campaign sees them as an important logistical test for November's general election. Still, Trump is not uncontested in Iowa. Among those challenging Trump is former U.S. Rep. Joe Walsh, R-Ill., whose pitch is, ''I'm a conservative. But I'm not mean, cruel, ugly, bigoted and chaotic like Trump.''
At a recent event before a handful of people in Polk City, Walsh said it's been a challenge taking on an incumbent president.
''They've tried to make it so difficult for me to compete. I want to surprise him in Iowa. I would be honored and blown away by anybody who wanted to caucus for me in Iowa on Feb. 3,'' Walsh said.
Polls show Trump enjoys widespread popularity among Iowa Republicans.
Trump is also counterprogramming on TV. His campaign spent millions to air two ads during tonight's Super Bowl, and he sat down with Fox News' Sean Hannity for a conversation in which Trump blasted several of his potential Democratic opponents.
'†‘ Back to top Sanders Canvassing Events Boast Strong Numbers. But They're Not All IowansAt one point during Vampire Weekend's concert for Bernie Sanders in Cedar Rapids, the group asked how many people in the crowd of more than 3,000 had come from out of state.
The crowd responded with a loud roar.
Scores of volunteers and supporters flooding in from out of state can be a good thing, of course, providing boots on the ground for door-knocking, phone-banking and other get-out-the-caucus efforts.
But it also leads to questions about how much of a candidate's support comes from people who can actually caucus or vote '-- and how much is imported.
There's no question that Sanders has a lot of support in Iowa '-- he has led several of the polls leading up to Monday's contest. But this phenomenon of Sanders supporters flooding Iowa was even more striking in a rural basement this week than it was at that concert.
On Friday, dozens of Sanders supporters gathered in a Greenfield home to eat Casey's breakfast pizza and pump themselves up before canvassing. But the majority of the people in the group can't actually caucus themselves because they're not Iowans.
Carlos Moralez drove 22 hours in one day to get from his home in Miami to campaign for the Vermont senator. He says he sees Sanders as a ''once-in-a-lifetime candidate.'' He'll spend the weekend doing outreach to the Latino community in Storm Lake.
''I love all his politics, but just his personality,'' Moralez said. ''I've seen even conservatives like him because he's someone you can trust. He has a consistency.''
Moralez and his friends thought their dedication stood out. That is, until they met Dylan Murphy, who had traveled from Ireland to canvas for Sanders.
''I need to help get this guy elected,'' Murphy reasoned, ''because what happens in America affects everyone in the world.''
Sanders enters Monday's caucuses with a surge of momentum. One of the key questions Monday night will answer: how much of that momentum comes from the Iowans who matter in the contest, and how much of it comes from excited non-Iowans who won't be able to do anything more than organize and cheer.
'-- Barbara Sprunt and Scott Detrow
'†‘ Back to top Biden Surrogate John Kerry: '70 Is The New 50'Former Secretary of State John Kerry has been making this joke at the last few events for Joe Biden: ''70 is the new 50.''
Kerry, a Biden surrogate, is alluding to the belief among some Democrats that the party should pick a nominee younger than the 77-year-old '-- and is batting it down.
But Biden draws a lot of his support from older voters, and at his events over the last few days, the crowds have been filled more with baby boomers than millennials.
That was largely the case Sunday when Biden kicked off his final full day of campaigning at Clarke University on the banks of the Mississippi River in Dubuque.
Around the corner from the campus snack shop, Nicholas Wade, a freshman, wanted to see Biden in person, but he's supporting Massachusetts Sen. Elizabeth Warren.
''They say in the primary, vote with your heart. And I like Elizabeth Warren's ideas the best,'' he said. ''But it's tough, because I think Joe Biden has the best chance of winning in 2020. I think sometimes he does struggle to connect with younger voters.''
Ross Benjamin, 30, traveled here this morning from just across the border in Wisconsin. He's planning to vote for Biden because he thinks Biden has the best shot to win over moderates and Republicans. But Benjamin says if he weren't worried about all that, he'd rather pick Warren or Vermont Sen. Bernie Sanders, who last night packed an arena for a partylike rally featuring the band Vampire Weekend.
''I've seen both Warren and Bernie, and they really bring the energizing core to our generation,'' he said. ''If it wasn't about electability, it would be one of them two. I want someone who can actually get Donald Trump out of office, so I guess I'm sacrificing self-interest for the bigger picture.''
Peter Jarka-Sellers, 23, drove down from Minnesota last night to see Biden. He describes Biden as a ''good, decent guy'' whose life experiences really resonate with him. And he thinks Biden's policy platform is more realistic.
''We're not going to get to do any of the things we want to do if [Senate Majority Leader] Mitch McConnell is blocking them, and I think Biden will help us pick up some of the key Senate seats, so I'm trying to think how we can get the most done,'' he said. ''All of these people are saying stuff that's further than Congress will let them do. You're not going to get more than a public option [on health care].''
Tucker LaBelle, a sophomore at Clarke, says he used to swing Republican and now is undecided between Sanders, 78, and Biden.
''A lot of people will say we need someone younger in the White House, but with the experience and history they have, it's kind of a no-brainer. They're legends,'' he said. ''I just like Bernie a little more over Biden because of the way he handles himself in public. I'm a communications major, and I focus on how people speak, and at that last debate especially, I saw a lot more personality out of Bernie.''
At campaign events, Biden has heavily featured freshman Rep. Abby Finkenauer as a surrogate, who in 2018 flipped a Republican district here in eastern Iowa at age 29.
''When it comes to Iowa, it is about the future of our state as well, not just our country,'' Finkenauer told NPR in an interview after the event. ''And making sure we have somebody like Joe who embodies the values I grew up with here in Iowa, where you care about your neighbors and you step up for folks, and you also get things done. And that matters '-- I don't care what generation you are. To see somebody who has done that his entire career, who has worked for working families, and that means everything to me, and that's what we've been talking about on the trail.''
'†‘ Back to top Actual, On-The-Ground Evidence Of Endorsements WorkingEvery primary season, there's coverage of which political bigwigs are endorsing whom '-- interspersed with debate over how much endorsements matter.
For Jayne Hanson from Iowa City, an endorsement is what finally made up her mind to caucus for Massachusetts Sen. Elizabeth Warren.
''I think probably when Mr. Castro dropped out and endorsed her, solidified it,'' she said at a Warren event in Iowa City today, referencing former housing secretary (and former presidential candidate) Julin Castro. ''But I had been waffling ever since Kamala [Harris] dropped out. She was my original favorite.''
It's not that Hanson had been a firm Castro supporter '-- she had only been considering him '-- but that he ''solidified'' her support of Warren.
The evidence on endorsements may be much messier on a broader scale, but cases like this one show the difficult, caucusgoer-by-caucusgoer process of how campaigns win people over.
'†‘ Back to top Bloomberg And Trump To Make Their Pitches In Super Bowl AdsMichael Bloomberg has no problem spending massive sums of money to get his message out. Since entering the Democratic primary in late November, the billionaire has already spent $300 million on ads, according to the group Advertising Analytics.
And tonight, Bloomberg will have a huge audience for one of his commercials. The campaign has a 60-second Super Bowl ad that features a Texas mother whose son was fatally shot in 2013.
According to the campaign, the woman, Calandrian Simpson Kemp, has become an active member of Moms Demand Action, which is part of Everytown for Gun Safety, the gun violence prevention organization that Bloomberg helped launch.
''I know Mike is not afraid of the gun lobby,'' Simpson Kemp says in the video. ''They're scared of him '-- and they should be.''
For his part, Bloomberg said in a statement: ''I chose to devote the entire sixty-second ad to gun safety because it matters to communities across the country and it will be a top priority for me as president.''
The former New York City mayor isn't the only presidential candidate with a national Super Bowl ad. President Trump's reelection campaign will air two 30-second ads, including one called ''Stronger, Safer, More Prosperous.''
''Just as the Super Bowl crowns the greatest football team, nothing says 'winning' like President Donald Trump and his stellar record of accomplishment for all Americans,'' Brad Parscale, Trump 2020 campaign manager, said in a statement.
Trump's campaign was quick to note that it reserved the minute of commercial time in December, marking ''the first time in history that a presidential campaign had purchased national Super Bowl advertising.''
According to The New York Times, Trump and Bloomberg each spent $11 million for the 60 seconds.
It's clear that Trump has noticed Bloomberg's commercials blanketing the airwaves. Just after midnight last night, he tweeted that Bloomberg ''is going nowhere, just wasting his money.''
Bloomberg has even run at least one ad criticizing the president that aired only on Fox News.
Bloomberg is not competing in Iowa, instead focusing on the delegate-heavy states that come on Super Tuesday, March 3. He travels in California, which has 415 delegates up for grabs, tomorrow on Iowa's caucus day.
'†‘ Back to top Expat Iowans Prepare For Satellite Caucuses In Sunny ClimesCaucusing requires people to show up in person for several hours on a cold winter night. Facing criticism that the process is exclusionary, Iowa Democrats are trying to find ways to bring more caucusgoers into the mix.
After a previous effort to allow online and teleconference caucusing was scrapped over security concerns, the state party introduced so-called satellite caucus sites that will enable people who work nights, don't speak English as a native language, or are living outside of the state to take part.
In Queen Creek, Ariz., outside of Phoenix, Joan Koenigs is running a remote caucus site that's expected to be filled with retired Iowans who spend their winters in sunny Arizona.
''I always felt bad when we missed caucus because we've been political all our lives,'' Koenigs says. When she found out about this year's satellite caucuses, she applied to host one at her house, planning to have people gather in bedrooms, the kitchen and patio.
The response was overwhelming, as more than 100 people said they wanted to attend. So instead of hosting at her home, Koenigs is now going to host the caucus at a nearby movie theater.
'-- Jimmy Jenkins (KJZZ) and Kate Payne (IPR)
'†‘ Back to top Yang: 'We Think We're Going To Surprise A Lot Of People'Entrepreneur Andrew Yang has seen a lot of Iowa in recent weeks. The candidate, who's long been in low-single digits in polls there, wraps up a 17-day bus tour throughout the state tomorrow on Caucus Day.
He also made a stop today on ABC's This Week, where he said after that investment of time and energy in Iowa, ''We think we're going to surprise a lot of people on Monday night.''
Yang has raised a solid amount of cash '-- $16.5 million in the fourth quarter of 2019 '-- but, like several other candidates, spent more than that over the three-month period.
Regardless of what happens tomorrow night, Yang is set to be on Friday's debate stage in Manchester, N.H., four days ahead of the primary there.
'†‘ Back to top What This Election Is Really AboutOn the eve of the Iowa caucuses, President Trump is the overwhelming factor determining not just Democratic voters' choices but which direction voters will go in the general election.
Check out the new essay by national political correspondent Mara Liasson: ''What The 2020 Election Is All About.''
'-- NPR Staff
'†‘ Back to top Analysis: Sanders' Saturday Rally A Show Of ForceBernie Sanders' rally in Cedar Rapids last night was a clear show of force. An estimated 3,000 diehards came out to see the Vermont senator, who has been surging in Iowa polls of late, and it's pretty clear from everything on the ground here that Sanders is the narrow favorite.
Crowd size isn't everything, but in a caucus, energy, enthusiasm and activism matter far more than in a primary. And Sanders has that on his side. His speech last night was almost like a pre-''victory speech'' speech. The jubilation, not just from the crowd, but also from the warmup acts of filmmaker Michael Moore to Reps. Ilhan Omar and Pramila Jayapal to academic Cornel West, it felt like a celebration, like kids before Christmas ready to open their presents.
Sanders was clear, confident and delivering the kind of bold message that really does appeal to the progressive wing of the Democratic Party, a wing that has been smarting during the presidency of Donald Trump.
''We are taking on the establishment '-- both the Republican establishment and the Democratic establishment!'' Sanders stressed.
Sanders, almost more than any other candidate, channels the values argument not only against this president but also emphasizing what the country should look like.
If the last few presidential elections have been pendulum swings '-- Bush to Obama, Obama to Trump '-- Sanders is hoping it's swinging his way this time. After all, what is more opposite of Trump than Sanders?
It's notable that Sanders and his surrogates are not just making a pie-in-the-sky argument for Utopia; they are also making an electability argument and paying very close attention to polls showing him beating Trump in hypothetical matchups.
There is a whole debate in the analytical political class about whether Sanders can win in a general election. There are very good arguments on both sides of it, but we will leave that for another post. What is clear here in Iowa is that Sanders is the one to beat in the Democratic caucuses. And at this point it is a must-win for Sanders.
He has raised the bar and needs Iowa to propel him into New Hampshire and beyond and create a sense of inevitability. That's why his performance tomorrow night here is so key.
'†‘ Back to top Good Morning! It's Caucus EveThe 2020 campaign has stretched on for over a year already. Now it's actually Groundhog Day, but the campaign in Iowa will soon be finished.
Polls have indicated a very unpredictable race. Many were eagerly anticipating the results of the final poll before Monday's caucuses, but it was scrapped at the last minute because of an apparent error made by someone conducting the survey.
Meanwhile, candidates are competing with two other big events that happen before the caucuses.
The Super Bowl is tonight, so some of the Democrats are wrapping up their time on the stump by mid-afternoon. Others are holding watch parties for the big game. (There are plenty of Kansas City Chiefs fans in Iowa, by the way'...)
Then, once again, Amy Klobuchar, Bernie Sanders and Elizabeth Warren will head back to Washington for the final arguments in the impeachment trial on Monday. They should have time to jet back to Des Moines for the results, though Warren told reporters on Saturday she wasn't sure whether that would be her plan.
And it's not just the Democrats on the ground in Iowa. President Trump's campaign plans to send dozens of surrogates to the state tomorrow '-- everyone from acting White House chief of staff Mick Mulvaney to the inventor of MyPillow, Mike Lindell.
We'll continue to bring you the latest news here until the dust settles on Monday night (or early Tuesday morning).
'†‘ Back to top Final Iowa Poll Scrapped After Candidate 'Omitted' During SurveyIt was called ''the most consequential poll in politics'' by Politico just hours ago, but it won't be released.
The final pre-caucus survey from vaunted Iowa pollster J. Ann Selzer was supposed to come out on Saturday night, but the Des Moines Register, which sponsors the poll along with CNN and Mediacom, says a candidate's name may have been left out in at least one interview.
''Today, a respondent raised an issue with the way the survey was administered, which could have compromised the results of the poll,'' wrote executive editor Carol Hunter. ''It appears a candidate's name was omitted in at least one interview in which the respondent was asked to name their preferred candidate.'' Some reports suggest that former South Bend, Ind., Mayor Pete Buttigieg's name may have been skipped during a survey interview.
''While this appears to be isolated to one surveyor, we cannot confirm that with certainty,'' Hunter added.
CNN political director David Chalian said, ''We take the standards that we apply to our polling very seriously, and to keep the highest possible standards we wanted to present this information to the public.'' The news broke just before the network was planning to broadcast a primetime special unveiling the final Iowa Poll results.
In just 48 hours, we may know how the race turned out anyway.
'†‘ Back to top Steyer Keeps An Eye On Upcoming PrimariesCampaigning in Davenport on Friday, billionaire businessman and activist Tom Steyer told NPR that he's focused on where voters take the race beyond Iowa.
''There was a poll this week '... that had me at an average of 17% in the four early primary states of Iowa, New Hampshire, Nevada and South Carolina,'' Steyer told NPR's Mary Louise Kelly on All Things Considered.
He added: ''Whoever is going to be the Democratic candidate is going to have to appeal to a diverse coalition. And I'm sure you know as well that I'm doing really well in Nevada and South Carolina.''
Pressed on whether his vast personal fortune is giving him an unfair advantage, Steyer responded, ''I'm not saying money doesn't matter, but it by no means is determinative. What really determines in the end is, do you, in fact, have something differential to say, and do people trust and relate to you and feel that your history supports the idea that you're the person that they can get behind.''
Hear Steyer's full interview from All Things Considered.
'†‘ Back to top Klobuchar Campaign's Fate May Rest On IowaMinnesota Sen. Amy Klobuchar is touting an accomplishment that can mean something in a state where meeting voters face-to-face is held in high regard. She's visited all of Iowa's 99 counties, crossing the final one off the list in late December. Her schedule was accelerated to get that done before the impeachment trial started.
Minnesota Public Radio reporter Brian Bakst was with Klobuchar in Cedar Falls on Saturday afternoon where the campaign leg work was part of her pitch.
All of that effort shows how important Iowa is to Klobuchar's path ahead in the race, particularly as a senator from a neighboring midwestern state. If she can come in a strong position on Monday, perhaps in one of the top four spots, that can give her a boost. But for past candidates who bet so much on doing well in Iowa, a disappointing showing has sometimes meant the end of the road.
'†‘ Back to top Assessing Enthusiasm And Expectations For BidenThe rap on Joe Biden coming into Iowa was that there really isn't much energy on the ground for him.
That's not exactly the case. A middle school gymnasium in Cedar Rapids was packed on Saturday with a few hundred strong supporters of the former vice president. About a third of the crowd were curious reporters, but the rest were intently listening, some calling out, and focused on one thing '-- beating President Trump. There's a worried urgency to the crowd the way there is about the candidate himself.
For all the affection Biden gets from this crowd, there is a clear disconnect between Biden and younger Democrats. It shows up in polling and in conversations here. Biden isn't even on Sanders supporters' list of choices. The mention of Biden's name makes many of them shudder.
And those lines will be drawn on caucus night. Warren and Buttigieg also clearly have strong supporters on the ground here, which could mean record-breaking turnout '-- something Democrats all seem to expect.
One thing is becoming clear, however '-- the pressure is really on Sanders. He's got the wind at his back right now, but he has to win or some of that wind will come out. Biden doesn't have to. He just needs to do well enough to make it to South Carolina, where he's the heavy favorite.
'†‘ Back to top Sanders Surrogate Tlaib Apologizes For Booing Hillary ClintonOne of Sen. Bernie Sanders' top surrogates, Rep. Rashida Tlaib, D-Mich., has apologized for booing Hillary Clinton, the 2016 Democratic presidential nominee, last night.
The comments came during an event for Sanders in Clive, Iowa, where supporters gathered for a panel made up of progressive campaign surrogates: Reps. Tlaib, Ilhan Omar, D-Minn., and Pramila Jayapal, D-Wash.
The moderator, Dionna Langford, tried to quell audience boos when she referenced Clinton, saying, ''We're not going to boo. We're classy here.''
Tlaib jumped in and said, ''No, no, I'll boo.'' She then booed. ''You all know I can't be quiet. No, we're going to boo. That's all right. The haters will shut up on Monday when we win.''
She was quickly criticized for harming party unity so close to the caucuses and offered an apology on Twitter, explaining she allowed her ''disappointment with Secretary Clinton's latest comments about Senator Sanders and his supporters get the best of me. You all, my sisters-in-service on stage, and our movement deserve better.''
On a podcast published earlier yesterday, Clinton, who topped Sanders in the 2016 primary, reportedly said that Sanders can't unify Democrats against President Trump. ''That's not our experience from 2016,'' she said.
'†‘ Back to top Amid The Buttigieg Fans, Some Still UndecidedPete Buttigieg started his Saturday in a suit and tie at the historic National Cattle Congress Electric Park Ballroom in Waterloo, Iowa. Rallygoers filed past neon signs into a domed hall that once hosted musical acts like Buddy Holly.
Overwhelmingly, the crowd was already committed to the former mayor of South Bend, Ind., but there were a few undecided voters who were torn between other more centrist candidates, like Amy Klobuchar and Joe Biden.
Laura Sniffin, 62, came from nearby Cedar Falls. Newly retired, her first pick is the Minnesota senator and her second choice is the 38-year-old Buttigieg.
"But that's the ticket I'd love to see, is Amy and Pete with Amy at the top of the ticket,'' she said. ''She is a get-it-done individual and I believe Pete is also.''
Sniffin doesn't think she will know who she's voting for until she walks into the caucus on Monday. But no matter who wins the Democratic nomination, Sniffin would vote for him or her in November with ''no hesitation.''
And that's because of President Trump.
"He's made it OK for all these groups to come out in the open and say things and encourage hate and I don't like that at all," Sniffin said. "All this stuff that has been shoved down, I guess, for many years, all the racism, all the hate and I thought we were doing better, but now it's worse than ever."
A previous version of this post misspelled Laura Sniffin's last name as Smiffin.
'-- Eliza Dennis, NPR Producer
'†‘ Back to top Caucus Organizers Expect High TurnoutIowa Democrats across the state are bracing for what could be record turnout for this year's caucuses. The biggest caucus site in the state in 2016 was at City High School in Iowa City, where 935 people showed up.
''The line of people waiting to get into their caucus site stretched out the door and down the hill some 500 feet away,'' said organizer Tom Carsner. This year, Carsner and his fellow organizers are expecting more than a thousand people '-- who are supposed to fit into a high school auditorium with a capacity for 734.
Problems with high turnout date to at least the 2004 caucuses when John Deeth remembers running out of voter registration cards and signup sheets.
''I never saw the pizza box that people supposedly signed in on, but I did get paper towels back with people signed in,'' Deeth recalled.
Still, even if caucus turnout is relatively high, it's likely that fewer than 20% of Iowa's registered voters will take part.
'†‘ Back to top Republicans Slightly Outpacing Democratic Voter RegistrationDespite all of the activity around the Democratic caucuses, Republicans have slightly outpaced Democrats in Iowa voter registration, going up 4% to Democrats' 3.9% since late 2015.
That's a surprising detail that should worry Democrats who are hoping to make Iowa competitive this fall against President Trump.
Overall, Republicans have about a 15,000-voter advantage in the state, which is partly why Trump starts out with an advantage in the state. Trump won the state by almost 10 points in 2016, or 147,000 votes, after it went twice for Barack Obama.
Overall registration:
2,087,884 (Dec. 2015)2,160,405 (Jan. 2020)% change: +3.5%Democrats:
633,549 (Dec. 2015)658,191 (Jan. 2020)% change: +3.9%Republicans:
647,092 (Dec. 2015)673,194 (Jan. 2020)% change: +4.0%Undeclared:
807,243 (Dec. 2015)829,020 (Jan. 2020)% change: +2.7% '†‘ Back to top 'I Want A More Moderate Candidate'Joe Biden kicked off a Saturday swing through eastern Iowa at a packed community center in North Liberty, just outside of Iowa City.
Neighbors Rosanne Cook, 75, and John Gross, 77, of Iowa City staked out a pair of seats in a coat closet in the back of the event space.
Cook is planning to caucus for Minnesota Sen. Amy Klobuchar, but is checking out the former vice president as a potential second choice pick '-- if Klobuchar does not clear the threshold to stack up delegates.
''I want a more moderate candidate, but I'm looking for someone who has more recent experience in Congress,'' Cook said. ''Also, to be honest, someone who is younger. I think Joe Biden is a great guy. I've liked him for a long time. But I'm not sure he's the right choice at this time.''
Cook's neighbor, John Gross, is fully in Biden's camp.
''There's nobody better,'' he said.
Biden has focused a lot of his stump speech the last few days talking about his ability to bring the country back together.
''We'll never see normal again, I think,'' Gross said. ''And the actions of the Senate yesterday [in the impeachment trial] indicate [Republicans are] not interested in governing, only protecting [President] Trump. And I think the Republican Party will never be the same again. And I don't think it's going to be easy to bring that back.''
Gross says he knows that's a monumental task, but he thinks Biden has the best shot at it.
'†‘ Back to top Sanders Supporters Talk About The FutureZ-Shan Bhaidani says he wasn't sure who he'd caucus for a few weeks ago, but the narrowing of the field and Sen. Elizabeth Warren's environmental and foreign policy plans ''have put me in the [Sen. Bernie] Sanders camp pretty strongly.''
His fianc(C) Qynne Kelly says she's supported Sanders from the beginning, after caucusing for him in 2016. Kelly works as an associate principal for Des Moines public schools and says Sanders' education proposals make her hopeful for the future.
''My everyday is seeing kids come in as victims of oppression, whether it be poverty or barriers they face as immigrants, lack of health care, huge medical costs '-- I know what that looks like,'' she says. ''And for me, if those basic needs are met [along with] free college, what would this school be like if every single kid actually had a true shot at college? This is a world I have yet to see but thinking about it and now that it could potentially become a reality is truly exciting for me.''Meanwhile, Kira Weldon started volunteering for Sanders in Columbus, Ohio, in 2015 but calls the Vermont senator a compromise candidate.
''I'm an actual socialist. I'm to Bernie's left,'' Wedin explains. ''But I appreciate that he's interested in building a workers' movement.''
Wedin says what happens on caucus night matters beyond the campaign.
''I'm really interested in building the movement in Columbus and using Sanders as a process by which to build socialist organizing in Ohio,'' Wedin says. ''If he can't do well here, do we have a chance to do the kinds of things we want to do?''
'†‘ Back to top Democrats Spent Big Last QuarterWith voting getting closer, the top-tier Democratic candidates sure spent big in the last quarter of 2019.
Vermont Sen. Bernie Sanders spent $50 million over the final three months of the year, according to new figures filed with the Federal Election Commission. That's some $15 million more than he raised over the period.
But Sanders wasn't alone in spending more than he took in.
Pete Buttigieg, the former mayor of South Bend, Ind., spent $34 million, though he raised about $25 million; Massachusetts Sen. Elizabeth Warren spent nearly $34 million, but took in nearly $22 million; and former Vice President Joe Biden both raised and spent about $23 million.
The large expenditures left the four candidates with dwindling cash on hand, as the primary season kicks off in earnest.
In addition, their spending was dwarfed by the two self-funding billionaires in the race, who've blanketed the television airwaves with ads.
Former New York City Mayor Michael Bloomberg spent $188 million '-- remember, he just launched his campaign in late November '-- while activist Tom Steyer spent nearly $154 million over the final three months of the year.
You can find all of these data points and more in our updated campaign finance tracker.
'†‘ Back to top How The Iowa Caucuses Work For DemocratsDemocratic and Republican caucuses are held in separate locations and are structured fairly differently, with Democratic voters publicly deciding in groups whom they are supporting (as well as now writing down from whom they are caucusing).
There are 41 delegates at stake on caucus night (with an additional eight automatic delegates '-- previously referred to as ''superdelegates'' '-- who bypass this process and go straight to the Democratic National Convention).
There are 1,678 precinct locations in schools, public buildings and sometimes private homes or places of worship. (There will also be 97 satellite locations located in the state, around the country and internationally to accommodate voters.)
The caucuses will begin at 7 p.m. CT and will last roughly around an hour.
There are two rounds of caucusing, and the only way a candidate can get any delegates is if the candidate attains 15% of the room's support. Here's how it works step by step:
There's a call to order, and a caucus chair and secretary are elected.Caucusgoers separate into groups by their candidate of choice.Time is usually made for supporters of each candidate to make their cases.When the groups are formed, the elected chair adds up how many supporters are in each group. Also, caucusgoers will write down whom they are supporting.Each candidate has to meet a viability threshold of 15%, meaning that the number of people in each cluster has to be at least 15% of the entire group participating.After Step 5, these caucusgoers' votes are ''locked in'' for candidates who surpassed the 15% threshold. This leaves the people who caucused for candidates who did not get 15% of the room's votes to then ''recaucus.''
For any candidate who did not get 15% of the people in the room, that candidate's supporters have to make a new choice for the second and final alignment.During the recaucusing process, those remaining will have to do one of the following: choose one of the candidates who did get 15%; choose ''uncommitted''; leave; or convince others recaucusing to join their nonviable group and make it viable.Once recaucusing is settled, caucusing is over. The numbers are tallied and sent to party headquarters via a mobile app.From there, the 1,678 precinct caucuses create 11,402 delegates, who are filtered to 41 national convention delegates at a mix of county, congressional district and state conventions.
But the number you need to watch for Monday night is the state delegate equivalent. More on those SDEs as we get closer to caucusing.
'†‘ Back to top How The Iowa Caucuses Work For RepublicansThe Iowa Republican Party still plans to hold caucuses for GOP candidates, despite several other state Republican parties choosing not to amid tepid support for President Trump's challengers.
While Democratic voters publicly declare their candidate preference with movement and debate, the Republican process is much simpler, with Iowans gathering together and voting on private paper ballots.
There are 40 delegates at stake for Republicans on Monday night. Iowa Republicans have 1,680 precinct caucus locations, ranging from spaces in libraries to fire stations and sometimes private homes.
The caucuses will begin at 7 p.m. CT. Here's how it works step by step:
There's a call to order, and a caucus chair and secretary are elected.Presidential candidate representatives speak and make their cases.Caucusgoers pick a candidate through paper ballot.Votes are tallied and reported to party headquarters. The information will be sent via a mobile app.Delegates are then elected to attend county conventions and are assigned to candidates based on the same proportion of votes each individual candidate received on caucus night. This is a change that the Republican National Committee instituted in 2016, after the 2012 Ron Paul campaign garnered an outsize share of the delegates and took over the state party.
'†‘ Back to top Night Flight: D.C. To Des MoinesWhen the Senate impeachment trial of President Trump ended for the day Friday night, the senators who are running for president returned as fast as possible to the campaign trail.
After landing late in Des Moines, Massachusetts Sen. Elizabeth Warren headed to a packed local brewery to rally her supporters.
Warren is one of four senators who have been off the campaign trail during impeachment proceedings. Surrogates including former Housing Secretary Julin Castro, members of Congress and Warren's husband have been campaigning for her in her absence.
The other three senator-candidates affected by the impeachment trial are Vermont Sen. Bernie Sanders, Minnesota Sen. Amy Klobuchar and Colorado Sen. Michael Bennet.
The trial resumes on Monday '-- the day of the caucuses.
'†‘ Back to top Welcome To Iowa Coverage! It's Almost Caucus TimeIt's almost time for voters to weigh in.
We're now two days away from the official kickoff of the 2020 Democratic presidential primary, and it begins in Iowa with its traditional (and convoluted) caucuses.
Polls show a very crowded race '-- by one measure, it's the tightest Iowa contest at this stage since at least 1980 '-- with the top tier of candidates all bunched up: Vermont Sen. Bernie Sanders, former Vice President Joe Biden, former South Bend, Ind., Mayor Pete Buttigieg and Massachusetts Sen. Elizabeth Warren. Amy Klobuchar, a senator from next-door Minnesota, has also been rising in recent state surveys. And sizable numbers of would-be caucusgoers have told pollsters they're unsure of their preferred candidate or are open to changing their minds.
The fluid nature of the large field of candidates and the party's overarching desire to boot Republican President Trump out of office have contributed to a fair bit of anxiety among Democratic partisans.
And that means all eyes are on the Hawkeye State.
This page will provide the latest news, context on the caucuses themselves, dispatches from the field and some of what Iowans are telling us about the race and the candidates. And then on Monday night, it'll offer live-updating results. So bookmark it, and come back through Monday.
'†‘ Back to top
VIDEO-Despite Election Security Fears, Iowa Caucuses Will Use New Smartphone App : NPR
Mon, 03 Feb 2020 23:03
Precinct leaders across Iowa will use their own smartphones to transmit the results of next month's Iowa caucuses. JGI/Tom Grill/Tetra images RF/Getty Images hide caption
toggle caption JGI/Tom Grill/Tetra images RF/Getty Images Precinct leaders across Iowa will use their own smartphones to transmit the results of next month's Iowa caucuses.
JGI/Tom Grill/Tetra images RF/Getty Images Iowa's Democratic Party plans to use a new Internet-connected smartphone app to help calculate and transmit results during the state's caucuses next month, Iowa Public Radio and NPR have confirmed.
Party leaders say they decided to opt for that strategy fully aware of three years' worth of warnings about Russia's attack on the 2016 presidential election, in which cyberattacks played a central role.
Iowa's complicated caucus process is set to take place Feb. 3 in gymnasiums, churches, recreation centers and other meeting places across the state.
As opposed to a primary in which voters cast ballots in the same way they would for a general election, Iowa's caucuses are social affairs; caucusgoers gather in person and pledge their support for a candidate by physically "standing in their corner" in designated parts of a room.
Iowa's Democrats hope the new app lets the party get results out to the public quicker, says Troy Price, the chairman of the state party.
In an interview, Price declined to provide more details about which company or companies designed the app, or about what specific measures have been put in place to guarantee the system's security.
But security is a priority, he says.
The state party worked with the national party's cybersecurity team, and with Harvard University's Defending Digital Democracy project, but Price declined to answer directly whether any third party has investigated the app for vulnerabilities, as many cybersecurity experts recommend.
"We as the party have taken this very seriously, and we know how important it is for us to make sure that our process is secure and that we protect the integrity of the process," Price says. "We want to make sure we are not relaying information that could be used against us."
Unlike many states in which local and state officials oversee the presidential primary election, in Iowa the state party is responsible for administering, staffing and funding the caucuses, relying primarily on trained but unpaid volunteers.
Cybersecurity experts interviewed by NPR said that the party's decision to withhold the technical details of its app doesn't do much to protect the system '-- and instead makes it hard to have complete confidence in it.
"The idea of security through obscurity is almost always a mistake," says Doug Jones, a computer science professor at the University of Iowa and a former caucus precinct leader. "Drawing the blinds on the process leaves us, in the public, in a position where we can't even assess the competence of the people doing something on our behalf."
Cyber concerns
The Iowa Democrats' plan is for caucus leaders to compile the results from participants and submit them to the central party via their smartphone apps. In the past, the leaders might have called in the results over the phone.
Because caucusing is an in-person process, verified by witnesses, there is virtually no risk that a cyberattack on the app could change the results of the caucus and go undetected.
If the wrong results were reported because of a hack, there would be people from each precinct who could correct it, and paper records.
But the damage to public confidence would be catastrophic, Jones says, if a hack caused the wrong winner to be called on caucus night and then that announcement had to be retracted.
"Once you report something, it's really hard to undo it, no matter how many retractions you print, no matter how many apologies you say, it's too late," Jones says. "From that point of view, someone hacking the reporting process, even though its purpose is entirely informal, not intended to have any permanent importance, is something that could be very disruptive."
A number of other potential vulnerabilities could also be introduced by using the technology, experts say.
If the app doesn't work, either because a denial of service attack clogs the system or for any other reason, then there could be confusion at precincts across the state, and a potential delay on a winner being announced.
State Dems promise contingency plan
Price, the state chairman, says Iowa Democrats have "redundancies built into the system," including a hotline to accept results, but declined to further detail those as well.
Should the app go down for any length of time, the party would need to receive hundreds, if not thousands, of phone calls from the state's 1,679 precincts.
Still, Price says he's confident in their contingency planning.
"If there's a challenge, we'll be ready with a backup and a backup to that backup and a backup to the backup to the backup," Price says. "We are fully prepared to make sure that we can get these results in and get those results in accurately."
It's unclear how similar this year's app is to one developed by Microsoft and a private contractor that was used by both parties in 2016.
Price did confirm that the app again would be downloaded onto the personal smartphones of the caucus precinct and party leaders, and not onto party-provided hardware.
That could make the system a more appealing attack target, according to Betsy Cooper, director of the Aspen Tech Policy Hub at the Aspen Institute, because peoples' phones also may contain sensitive messages, emails and passwords.
"I sure hope the engineers building it are among the best on the planet," Cooper says.
Price said when designing the app, the developer considered the close proximity to potentially sensitive information, but he again didn't detail exactly how that information would be protected.
Four years ago, Russian attackers hacked into the email accounts of prominent Democrats and weaponized the information they stole throughout the election year.
Cooper said that the party could, if it wished, disclose who developed the app or the types of testing that had been done on it without "giving away the keys to the kingdom and making it easier for hackers to get in."
"Basic transparency about how it was built, how up to date the security of the app is and how it's been tested all could be made publicly available with little cost to the DNC," she says.
Price said that some details would be unveiled about the app to reporters and the public in the days leading up to the caucuses, but he did not commit to revealing the identity of the developer. Less than three weeks before the caucuses, precinct chairs have not yet gotten access to the app.
Questions beyond security
Internet connectivity and tech literacy in Iowa have improved over the past four years. Local party leaders say they expect that more precinct chairs will own smartphones and be more comfortable using an app this cycle than during the previous one.
Still, in more rural parts of the state, some Iowans have been slow to adopt to technology, according to Gary Gelner, who chairs the Hancock County Democratic Party in north central Iowa. There may be some lingering skepticism.
"At least everybody with smartphones is gonna do it, I know that," Gelner says. "You'd be surprised how many people up here got the old flip cellphones."
Gelner was skeptical of the party moving to a caucus night reporting app in 2016. Though he's more optimistic this year, he's still wary of a process that he says could delay the release of the closely watched results.
Gelner said one of his precinct chairs in 2016 resorted to phoning in his results, only to find he couldn't connect.
"He called in and he tried for half an hour and he couldn't get through," Gelner said.
An insecure ecosystem
The Iowa Democrats' app will theoretically allow the state party to report the results much quicker than a phone-based system, and it may also help local party leaders with what's referred to as "caucus math."
A party manual says the app will "automatically calculate the number of delegates" presidential contenders are awarded, based on a formula involving the number of supporters for each candidate, the total number of delegates awarded and overall turnout.
But as is the case with much in the world of voting technology, things that make voting easier or more efficient can also introduce new unforeseen issues.
Travis Weipert is the top elections official in Iowa's most Democratic County, Johnson County, and this cycle he'll also be volunteering to oversee a caucus site as a precinct chair.
He says his experiences as an elections administrator make him skeptical of any system that mixes democracy and the Web.
"As long as you're staying off the Internet, then there's no connectivity, your chances of an issue are almost zero," Weipert said. "It's when you get on the Internet and security patches haven't been made that you open yourself up [to hacking]."
Weipert says there is a tendency for some local officials to underestimate the interest that foreign powers or bad actors may have in their elections. While he says he's doubtful "rogue states" would target the caucuses, he says it's something party leaders have to consider.
This is the second time in the past few months that the Iowa Democratic Party has had cyber experts questioning its commitment to security.
Last year, under pressure from the Democratic National Committee to increase accessibility at its famously arcane caucuses, the state party proposed a plan to allow Iowans to caucus remotely.
Internet and phone-based voting systems are considered notoriously insecure however, and the national party said there wasn't a system available secure enough to support such an idea.
So that plan was scrapped.
Jones, the University of Iowa cybersecurity specialist, says transmitting results from precincts to the state party through a smartphone app isn't as insecure as the virtual caucus plan '-- but that it's still insecure for the same reasons.
"The entire ecosystem of smartphones is extraordinarily poorly secured," Jones said. "And resting security functions on that ecosystem is something I don't trust at all."
VIDEO-CNN Anchor Calls Out Biden for Not Doing Any Sunday Shows - YouTube
Mon, 03 Feb 2020 13:06
VIDEO-Rahm to Bernie Backers: Democrats Can Win Without You - YouTube
Mon, 03 Feb 2020 12:57
VIDEO-FBI Admits Illegal Wiretapping of President '' Issues Apology (VIDEO)
Mon, 03 Feb 2020 12:55
Follow Matt on TwitterWell Well Well, what have we here America?
Director Wray issued an apology to the courts and the President.
The FBI's behaviors surveilling the Trump campaign was ''Unacceptable and Unrepresentative of the F.B.I. as an institution'' and that ''The FBI Deeply regrets the errors and omission identified'' by the Inspector General.
You don't say Christopher?
''Much of that information was inconsistent with, or undercut, the assertions contained in the FISA applications that were used to support probable cause and, in some instances, resulted in inaccurate information being included in the applications,'' the report stated.
The President was quick to respond.
''Chris, what about all of the lives that were ruined because of the so-called 'errors?' '' Trump tweeted. ''Are these 'dirty cops' going to pay a big price for the fraud they committed?'' '' President Trump
''FBI Director apologizes for FISA Errors (of which there were far to many to be a coincidence!).'' @FoxNews Chris, what about all of the lives that were ruined because of the so-called ''errors?'' Are these ''dirty cops'' going to pay a big price for the fraud they committed?
'-- Donald J. Trump (@realDonaldTrump) January 11, 2020You can watch the video below from our friends at OAN to get up to date even more on the investigation into FISA abuse.
VIDEO-Donald Trump: 'Little' Michael Bloomberg Wants a Box to Stand On
Mon, 03 Feb 2020 07:03
President Donald Trump ridiculed Michael Bloomberg for his height on Sunday, claiming that the former mayor of New York City wanted a box to stand on during the next Democrat debate.
Trump commented on Bloomberg's height in a Super Bowl interview with Sean Hannity:
I just think of little. You know, now he wants a box for the debates, to stand on. OK, it's OK, there's nothing wrong, you can be short, why should he get a box to stand on? OK? He wants a box for the debates, why should he be entitled to that? Really. Does that mean that everybody else gets a box?
Hannity previewed the clip of the interview during an episode of Fox and Friends on Sunday morning.
Trump said Democrats changing the debate rules to allow Bloomberg on the stage was unfair, particularly to Democrats who were shut out of the process.
''Corey Booker and all these other people couldn't get any of the things that Bloomberg's getting now, I think it's very unfair for the Democrats,'' Trump said. ''But I would love to run against Bloomberg, I would love it.''
Bloomberg is five-foot-eight inches tall, while President Trump is six-foot-three inches tall.
A Bloomberg spokesperson responded to Trump's insult by mocking his ''fake hair, his obesity, and his spray-on tan.''
But Bloomberg also personally responded to Trump's comment on Sunday.
''He lies about everything so it shouldn't be a surprise that he said things like that,'' Bloomberg said, adding, ''I stand twice as tall as he does on the stage, on the stage that matters.''
VIDEO: I asked '...@MikeBloomberg'(C) about the president's tweets and accusation that he and the DNC are trying to rig the election against '...@BernieSanders'(C). Bloomberg called the president a liar and said ''I stand twice as tall,'' on the ''stage that matters.'' pic.twitter.com/uLT7AHw6Bn
'-- Tim Perry (@tperry518) February 2, 2020
Other presidential candidates have used boxes to appear taller on the debate stage.
Former Housing Secretary Julin Castro, who is five-foot-nine inches tall, stood on a box in the third Democratic primary debate, but has since dropped out of the race.
Trump has begun mocking Bloomberg as ''Mini Mike'' repeatedly, criticizing him on Twitter for spending hundreds of millions on ads against the president.
''Mini Mike is part of the Fake News,'' he wrote. ''They are all working together'':
Mini Mike is part of the Fake News. They are all working together. In fact, Bloomberg isn't covering himself (too boring to do), or other Dems. Only Trump. That sounds fair! It's all the Fake News Media, and that's why nobody believes in them any more.
'-- Donald J. Trump (@realDonaldTrump) February 2, 2020
Many of the ads you are watching were paid for by Mini Mike Bloomberg. He is going nowhere, just wasting his money, but he is getting the DNC to rig the election against Crazy Bernie, something they wouldn't do for @CoryBooker and others. They are doing it to Bernie again, 2016.
'-- Donald J. Trump (@realDonaldTrump) February 2, 2020
Mini Mike is now negotiating both to get on the Democrat Primary debate stage, and to have the right to stand on boxes, or a lift, during the debates. This is sometimes done, but really not fair!
'-- Donald J. Trump (@realDonaldTrump) February 2, 2020
VIDEO-Real Time with Bill Maher on Twitter: ""We're going to do as much as we can to make sure that Donald Trump is not reelected, using all the tools in our toolbox. And some of them are pretty frickin' nasty." Watch @TheRickWilson discuss @ProjectLincol
Sun, 02 Feb 2020 23:08
Bob deRoos @ BobDeroos
23h Replying to
@RealTimers @TheRickWilson @ProjectLincoln Why not run a Republican challenger? It might split the vote, helping defeat Drumpf. But I guess that might be a goal of yours in any event.
View conversation · Barbara Monaco @ barbramon1
13h Replying to
@BobDeroos @RealTimers and
2 others There are currently two Republican challengers. They have effectively been shut out of the race by media and republican party. A number of states have cancelled their republican primaries so that trump can be coronated.
View conversation · @FireTheLiar2020 @ firetheliar2020
10h Replying to
@RealTimers @TheRickWilson @ProjectLincoln We must vote him out! Thank you Bill for Speaking your Voice
View conversation · TMW @ TMWno_bs
2h Replying to
@firetheliar2020 @RealTimers and
2 others And Rick
View conversation · Amanda Peak @ amanda_peak44
Feb 1 Replying to
@RealTimers @TheRickWilson @ProjectLincoln Bill & Rick are my favorites ''¤¸''¤¸''¤¸
View conversation · Jennifer Robin @ RobinRacruzer
Feb 1 Replying to
@RealTimers @RKCowgirl_Life and
2 others Amen to that brother '®¸ðŸ¥°
View conversation · carolyn 'ðŸ...‚ðŸ--¥ @ 1slandgirl
Feb 1 Replying to
@RealTimers @TheRickWilson @ProjectLincoln pic.twitter.com/ExqDYE8ECy View conversation · colorblind @ ru2cool2
2h Replying to
@RealTimers @TheRickWilson @ProjectLincoln Good luck, you may be our last and only hope!
View conversation · Aby ðŸ¤'Charlie,Mila, blasph¨me🍠🕊🇪🇺ðŸ"'ž¸ðŸ"¸'ðŸŒðŸ†' @ Aby0612
Feb 1 Replying to
@RealTimers @TheRickWilson @ProjectLincoln Can't waitðŸŠ
View conversation · Louie Schutz @ Unclelouieart
Feb 1 Replying to
@RealTimers @TheRickWilson @ProjectLincoln pic.twitter.com/Aj0fJouqtw View conversation ·
VIDEO - (2) Ezra Levant 🍁 on Twitter: "Trudeau cabinet minister: all news websites must now get a government licence. https://t.co/x10AhtQAPb" / Twitter
Sun, 02 Feb 2020 15:31
Welcome home! This timeline is where you'll spend most of your time, getting instant updates about what matters to you.
Tweets not working for you? Hover over the profile pic and click the Following button to unfollow any account.
Say a lot with a little When you see a Tweet you love, tap the heart '-- it lets the person who wrote it know you shared the love.
Spread the word The fastest way to share someone else's Tweet with your followers is with a Retweet. Tap the icon to send it instantly.
Join the conversation Add your thoughts about any Tweet with a Reply. Find a topic you're passionate about, and jump right in.
Learn the latest Get instant insight into what people are talking about now.
Get more of what you love Follow more accounts to get instant updates about topics you care about.
Find what's happening See the latest conversations about any topic instantly.
Never miss a Moment Catch up instantly on the best stories happening as they unfold.
STORIES
Spotify Is Caught in the Ringer - WSJ
Thu, 06 Feb 2020 07:43
The music-streaming giant's shift into podcasts offers an uncertain payoff
The messy reality of today's music-streaming business is that having all the music in the world still isn't enough.
Take Spotify Technology, the undisputed king of the field. The company's fourth-quarter results Wednesday were decent on some counts. Monthly active users grew 31% year over year to 271 million. Spotify added about 11 million new paying subscribers during the quarter'--its best growth ever for this important metric.
Paying...
The messy reality of today's music-streaming business is that having all the music in the world still isn't enough.
Take Spotify Technology, the undisputed king of the field. The company's fourth-quarter results Wednesday were decent on some counts. Monthly active users grew 31% year over year to 271 million. Spotify added about 11 million new paying subscribers during the quarter'--its best growth ever for this important metric.
Paying subscribers to the service now number 124 million. Apple Inc., Spotify's largest rival, disclosed passing the 60 million mark in subscribers to its Apple Music service last summer.
Spotify, of course, doesn't have the luxury of selling $1,000 iPhones at a high markup to fall back on so it still loses money. Its operating loss widened 70% to '‚¬73 million ($80.7 million) for 2019. And streaming music isn't cheap given the need to pay labels, artists and publishers based on consumption. Spotify's gross margin for 2019 came in at 25%'--down slightly from 26% the prior year. Netflix , the king of TV and movie streaming, closed 2019 with a gross margin of 38%.
The harsh realities of music licensing give Spotify a clear need to fill its stream without blowing up its variable costs. Hence, podcasts. Spotify has acquired four podcasting companies in the past 12 months, including the purchase of the Ringer that was announced on Wednesday. None of the prices were announced, though Spotify said during its first two deals last February that it intended to spend as much as $500 million on its podcasting effort. FactSet estimates last year's acquisition of Gimlet Media cost about $230 million, which would make it the biggest deal in Spotify's history.
Investors should expect more ahead. Spotify said Wednesday that it expects 2020 to be ''an investment year.'' That, plus disappointing fourth-quarter revenue, took the stock down nearly 5% Wednesday. Notably, it drove the stock back to the range from its direct listing in April 2018.
The underlying logic behind podcasts is sound enough given how the format is exploding in popularity. Whether it will pay off for Spotify is another question. Todd Juenger of Bernstein notes that revenue models for podcasts are ''still evolving.''
Spotify also will be limited in how much of its podcasting content it can make exclusive. High-quality podcasters'--like any other media talent'--tend to want the largest audience possible. Spotify still has a way to go to prove its own podcast talk is more than just hot air.
Write to Dan Gallagher at dan.gallagher@wsj.com
Pelosi unloads on Trump in private meeting after SOTU standoff - POLITICO
Thu, 06 Feb 2020 07:23
Democrats gave Pelosi a standing ovation after she concluded her remarks, coming just hours before the Senate will vote to acquit Trump in his impeachment trial. The California Democrat then went on to salute all seven House impeachment managers by name, according to attendees.
"She said that he disgraced the House of Representatives by using it as a backdrop for a reality show," Rep. John Yarmuth (D-Ky.) said leaving the meeting.
Pelosi's remarks follow the latest turn in the long-running feud between the two party leaders, which played out during Trump's annual address in front of the Congress and millions of viewers.
Before Trump even started the hyper-partisan speech '-- which frequently resembled one of his campaign rallies '-- the two got off on a sour note when the president seemingly snubbed Pelosi by refusing to shake her hand.
For the next 80 minutes, Trump delivered a speech that included a highlight reel of his presidency with a few reality show twists thrown in. The move enthralled Republicans, who lavished Trump with praise and disgusted Democrats, who hissed and booed, later calling Trump's speech a disgrace.
Pelosi's dramatic gesture '-- tearing up the speech on national television '-- was in some ways uncharacteristic for the speaker, who is known for being publicly restrained and has urged her members to respect the office of the presidency.
But it's also an indication that Pelosi has lost patience with Trump post-impeachment, with the president unwilling to acknowledge any wrongdoing even as some Republicans condemn his behavior.
Speaking to the caucus, some Democrats said Pelosi appeared distraught and frustrated by Trump's speech.
Pelosi specifically called out Trump's decision to award the divisive conservative radio host Rush Limbaugh with the Presidential Medal of Freedom in the middle of the speech.
''He dishonored the State of the Union as an institutional practice,'' said Rep. Hank Johnson (D-Ga.). ''It was kind of outright pandering to his base. It was just a disgraceful display.''
House Republican leaders were quick to condemn Pelosi '-- while offering no criticism of Trump's handshake snub '-- calling her late-night response a petty tantrum. Trump himself weighed in in his own way, rapidly retweeting more than a dozen people criticizing Pelosi's actions, many with the hashtag "PelosiTantrum" on Wednesday morning.
Meanwhile, the speaker's top lieutenants were quick to come to her defense.
"As far as I'm concerned, a shredder wasn't available, so she did what she needed to do," House Democratic Caucus Chairman Hakeem Jeffries (D-N.Y.) told reporters after the caucus meeting.
"When someone won't even shake the hand of the speaker of the House, it tells you where their priorities lie," added Democratic Caucus Vice Chair Katherine Clark (D-Mass.).
Adam Cancryn contributed to this report.
Trump suggests he'll endure '4EVA' in first post-acquittal tweet
Thu, 06 Feb 2020 07:21
February 5, 2020 | 5:31pm
President Trump is just getting started.
In his first reaction minutes after the Senate voted to acquit him on both articles of impeachment, Trump tweeted a video showing a mocked-up cover of Time magazine suggesting he would be president ''4EVA.''
The 30-second clip, scored to Edvard Grieg's ''In the Hall of the Mountain King,'' slowly pans over the cover, which shows a series of Trump campaign signs with years in increasing increments of four.
''How Trumpism outlasts Trump,'' reads a headline on the right side of the cover.
In the upper left corner, Trump himself is superimposed behind one sign, the numbers of which gradually tick up.
The count eventually reaches preposterously high years '-- 2300, 2500, 5000, 50000, then a series of 'E's '-- before finally reading ''4EVA.''
Trump added in a second tweet that he will issue a public statement on Thursday.
''I will be making a public statement tomorrow at 12:00 p.m. from the @WhiteHouse to discuss our Country's VICTORY on the Impeachment Hoax!'' he wrote.
Texas Democrats fear delay in presidential delegate totals on Super Tuesday | The Texas Tribune
Thu, 06 Feb 2020 06:50
Editor's note: This story has been updated to include comment from the Texas secretary of state's office.
As their counterparts in Iowa reel from a disastrously slow election returns process, Texas Democrats raised the prospect Wednesday that a change in the way Texas reports election results could delay the final tally of delegates won by presidential hopefuls in the upcoming March 3 primary past election night.
Officials with the Texas Democratic Party said the Texas secretary of state's office recently told them that it will not be able to provide on election night the numbers needed to allocate a majority of the 228 delegates up for grabs in the state on Super Tuesday. In a Jan. 23 meeting, the Democrats said, top state election officials cited limitations to their revamped reporting system, which is used to compile returns from the state's 254 counties.
"They basically said that's not built out yet," said Glen Maxey, the special projects director for the Texas Democratic Party who attended the meeting with state officials.
Late Wednesday, a spokesman for the secretary of state's office, which initially had not responded to The Texas Tribune's questions about the issue, contested that characterization, saying that "any allegations that delegate allocations will not be reported on election night are categorically false."
At issue are 149 delegates that Democratic presidential candidates will win through a complex formula that divvies them up based on the distribution of votes in each of Texas' 31 state Senate districts. Maxey said he and other officials were told the state initially will collect election returns at the county level but not at the senatorial district or precinct levels, which are needed to calculate how many delegates each candidate picks up. Party officials were told those more detailed numbers would be made available "the next day or so," Maxey said.
In an email, agency spokesman Stephen Chang said the secretary of state's office does plan to collect and publicly report votes for president at the Senate district level "in the same fashion" as previous primaries.
"In previous primaries, including the 2016 primary election, delegate allocations for both of Texas' major parties on election night have been approximate allocations based on data self-reported by the counties," Chang said. "The delegate allocations will be reported in the same fashion for the March 3rd primary election."
On Wednesday morning, the Texas Democratic party was preparing for an Iowa-like scenario in which the full delegate distribution would not be available until at least the next day. Maxey said state officials "were very clear" they would not be getting the granular level information needed to calculate the delegate distribution on election night, and the party was already considering whether it could independently collect the data from all 254 counties and calculate the delegate distribution itself.
That process would be complicated because some counties '-- including the state's most populous '-- are sliced up among several state Senate districts. Maxey said that means the party would have to wait for complete voting returns from those counties before starting its calculations, which likely would not begin until after midnight.
Unlike in Iowa, Texas in that scenario would be able to report statewide vote totals in the primary, and a Democratic candidate would be named the winner of the overall contest. But with the presidential contest expected to be at fever pitch, any full reporting delay would slow down a final delegate tally in a state representing the second-largest prize on Super Tuesday. Texas is set to award more delegates to Democratic presidential hopefuls on that day than all of the preceding primaries combined.
Democratic party officials said they were assured in September that the secretary of state's reporting system would include the data needed to determine the distribution of those district-delegates, as it did in the 2016 primary election, but that state officials reversed course at their January meeting.
In a statement Wednesday morning, Manny Garcia, executive director of the Texas Democratic Party, said if the secretary of state's office fails to report promptly the election results by Senate district, it will amount to a ''violation of the public trust.''
"Texas is more important to presidential campaigns than ever before and could make or break campaigns. With one of the largest delegations, in one of the most diverse states in the country, Texas is the pathway to winning the Democratic nomination. The public deserves to see the vote and the delegate results on election night, and we urge the Texas Secretary of State's office not to leave Texas voters and our nation in the dark."
The 149 district-delegates in question will be proportionally distributed in each state Senate district among candidates who garner more than 15% of the vote. The number of delegates up for grabs in each district is based on how those districts voted for the 2016 Democratic presidential nominee and the 2018 Democratic nominee for governor. For the upcoming primary, that number ranges from two to 10 delegates in each Senate district.
The possibility that the Democratic party would report the district-delegate distribution outside the state's election night portal would make for an unusual venue for election results. For many years, the secretary of state's office has been the keeper of election night returns. In the 2016 election, for example, the secretary of state asked county officials who administer elections across the state to send in both countywide results for the presidential primary and results by senate district.
Chang said Wednesday that such data would again be available on election night.
Disclosure: The Texas Secretary of State has been a financial supporter of The Texas Tribune, a nonprofit, nonpartisan news organization that is funded in part by donations from members, foundations and corporate sponsors. Financial supporters play no role in the Tribune's journalism. Find a complete list of them here.
Right-Wing Podcaster Seeks Lawyer To Sue NFL For Condemning Him To Hell With Salacious Halftime Show | Above the Law
Thu, 06 Feb 2020 06:48
(Photo by Kevin Winter/Getty Images)
Right-wing podcast star ''Coach'' Dave Daubenmire want to sue the Super Bowl for keeping him out of the Kingdom of Heaven, and he wants you to join in with him.
Daubenmire, who refashioned himself into a right-wing hero after the ACLU forced him to stop proselytizing to high school football players in London, Ohio, is extremely upset about the ''pandering pornography'' of Sunday night's Super Bowl halftime show. Although he refused to watch Jennifer Lopez's pole dancing and Shakira's zaghrouta because he ''didn't want to let that spirit come into my house,'' Daubenmire is very upset about a mythical 12-year-old boy (without internet access), who tuned in to watch grown men whack the crap out of each other only to find himself unceremoniously thrust into a hormonal inferno.
''Would that halftime show, would that have been rated PG? Were there any warnings that your 12-year-old son '-- whose hormones are just starting to operate '-- was there any warning that what he was going to see might cause him to get sexually excited?''¼¼
Who will join this brave patriot in demanding judicial redress for this grievous injury to our collective mortal souls, which have been willfully, knowingly, recklessly, and negligently jeopardized, with actual malice, by force, using undue influence, and per se outside the four corners of our cable contracts?
All he needs is a lawyer willing to take his case.
''That's discriminatory against the value I have in my house. You can't just do that,'' Daubenmire said on his Monday podcast. ''I wanna sue them for about $867 trillion.'' Plus punitive damages, no doubt.
Right Wing Watch was first to flag the video.
Daubenmire continued with his theme of ''Crotch shots! Dare I say that? Crotch shots!''¼ in a Facebook post later that day.
payback project
Thu, 06 Feb 2020 06:42
If you live in one of the nine target states, we'll get you plugged into the most powerful ways you can take action on your home turf. If you don't, we've still got plenty for you to do to help voters defeat these nine Trump enablers (think: texting and building capacity to win). We need everyone for this fight.
We're running a newspaper ad to call out one of the Payback Project Republicans for their impeachment trial coverup. You decide where. Yes, we could just set our sights on canceling Cornyn, or getting rid of Graham, or trashing Tillis, or ejecting Ernst, or sending Perdue packing, but after years of Senate Republicans enabling Trump and destroying democracy, we have to do more.
Realtalk: Defeating this many Senate Republicans will not be easy -- it will take a massive awareness campaign to expose the truth of their complicity to voters and a growing grassroots army on the ground ready to ensure their Democratic opponents have the funding and people necessary to knock doors, activate voters, and win. We have a comprehensive, four-pronged approach to make sure Republicans Senators are held accountable for their actions, their votes, and their enabling of Donald Trump.
Martha McSallyArizona | Trump Score: 95.3%Despite being rejected by Arizona voters in 2018, McSally rode a gubernatorial appointment into the Senate and has spent every day since refusing to do her job. Now, instead of representing Arizonans, she spends her days in office covering for the Trump administration and complaining about constituents.
Cory GardnerColorado | Trump Score: 89.3%Few senators have as much open contempt for their constituents as Cory Gardner. He refuses to meet with voters, and instead focuses on avoiding the ire of the Trump team in the hope that the president'--not Coloradans'--will carry him to victory this year.
David PerdueGeorgia | Trump Score: 94.4%We have a Donald Trump in the Senate, and his name is David Perdue. Perdue has committed himself to acting as the president's proxy in Congress, and has been a very effective representative for the White House'--but not Georgia.
Joni ErnstIowa | Trump Score: 91.3%Is it bad to ask a foreign power to investigate a political opponent? Joni Ernst doesn't care! The Iowa Senator is particularly unconcerned with the rule of law when it comes to Donald Trump. Instead, she would rather spend her days in office voting to take away health care or create tax cuts for billionaires. Who needs oversight and accountability? Not Joni, apparently.
Mitch McConnellKentucky | Trump Score: 93.9%Mitch McConnell has one goal: stay in power. To do so, he's broken our democratic institutions, exploited partisanship, and made protecting Trump his top priority. If Washington corruption has a face, it's his.
Susan CollinsMaine | Trump Score: 67%Susan Collins' self-serving political calculus gave us Brett Kavanaugh, the tax scam for billionaires and corporations, and now a coverup on behalf of the Trump campaign. Mainers deserve better representation than a politician who's only concerned with her next election.
Thom TillisNorth Carolina | Trump Score: 92.9%Thom Tillis would love for voters to forget that he cost North Carolina $80 million when he caved to Trump on emergency funding for the president's vanity project at the border (spoiler alert: we won't). Now that he's facing a tough primary challenge, Thom's poised to keep caving to Trump out of fear the president might turn on him.
Lindsey GrahamSouth Carolina | Trump Score: 86.2%Lindsey Graham is the worst kind of political opportunist. Instead of focusing on the needs of South Carolina, he caters to the needs of Donald Trump exclusively. With Lindsey, it's party and power over country at every opportunity.
John CornynTexas | Trump Score: 94.8%Texas, or Trump? John Cornyn has made his choice: Donald Trump, all the way. Instead of doing his job for Texans, Cornyn has been spending his time trying to defend Trump and fundraise off of his relationship to the White House.
Build awareness & accountability.When senators take bad votes or do something else awful, we'll be in their states to broadcast it and hold them accountable for refusing to listen to constituents. And we'll keep reminding voters of their stances on the Affordable Care Act, abortion bans, climate change, and all our other top issues. You can vote on where we place our first newspaper ad here.Boost local political power.We'll do the work to get as many people involved in the election as possible, educating folks about what's at stake, growing the size of our local Indivisible groups, funnelling voters in these nine states directly to their local Indivisible group, and increasing logistical support for their election activities and recruitment efforts through trainings, organizer support, and powerful new tools.
Organize to win.Our nationwide network of organizers will work directly with groups on the ground to leverage their power with voters, the candidates, and the media to build support for strong progressive challengers.
Get out the vote.We'll run a robust GOTV campaign to turn as many people as possible out to the polls. Remember -- these senators thrive on disenfranchisement, so it's our job to make sure voters show up to kick them out.
Give now to defeat these Republicans and fund our work to take back the Senate.
Far-right AfD kingmakers in German state election | News | DW | 05.02.2020
Thu, 06 Feb 2020 06:39
There were protests in Germany after a conservative state premier was elected with help from the far-right Alternative for Germany. However, the newly elected leader dismissed the idea of a coalition with the party.
A huge political upset in Germany's eastern state of Thuringia on Wednesday sparked a widespread outcry across the country as the ruling coalition saw its candidate for state premier lose by a single vote to the pro-business Free Democrats (FDP), who had barely cleared the 5% support hurdle to join the regional parliament.
What was even more cause for concern, however, was the historic role of the far-right Alternative for Germany (AfD) party in the victory of FDP candidate Thomas Kemmerich (above), marking the first time a German state premier was able to take office with the help of the nationalist party.
Read more: Opinion: A disgrace for Germany
Thuringia held its state election all the way back in October, with the ruling Left party winning the highest share of the votes at 31%. At the same time, however, the AfD more than doubled its own support to come in second at 23.4% of the vote.
The AfD is an ethno-nationalist party that is opposed to non-European immigration, which it perceives as the "Islamization" of Germany, and is opposed to reforms that tackle climate change.
Protesters began gathering outside the parliament building only two hours after the vote in the state capital of Erfurt:
A spontaneous demonstration also sprang up in Berlin on Wednesday evening, with witnesses saying thousands of people had appeared outside FDP headquarters to express their anger.
A single vote
The ruling Left party has spent months trying to form a coalition with the center-left Social Democrats (SPD) and the Green party. After a lot of protracted wrangling, the three parties had finally signed an agreement to rule together on Tuesday evening.
It was expected that lawmakers in Thuringia's parliament would elect the Left party incumbent, Bodo Ramelow, without much fanfare. However, in the third round of voting the AfD decided not to support the independent candidate it had previously supported and throw all of its weight behind Kemmerich.
Together with the votes of his own party and the center-right Christian Democrats (CDU), the party of Chancellor Angela Merkel, Kemmerich came away with 45 votes to Ramelow's 44.
The outrage on social media over the AfD's role as kingmakers was swift and resounding. Ordinary Germans, public figures, and politicians all expressed their consternation, saying the FDP and CDU had gotten into bed with "fascists."
On their official Twitter page, the Left party accused the FDP of believing that it was "better to rule with fascists than not to rule at all."
Left party head Bernd Riexinger told DW it was a "black day" for German politics and reminiscent of the way that mainstream parties had conceded ground to the Nazis in the 1920s.
"It appears that neither the FDP nor the CDU have learned anything from history," Riexinger said. "Before the election, every party stressed they would not seek AfD support. That promise is obviously not worth the paper it was written on."
Marie-Agnes Strack-Zimmermann, an outspoken member of the FDP in Germany's federal parliament, said that while she liked Kemmerich personally, it was "unacceptable" to allow oneself to be elected by someone like Bj¶rn H¶cke, the spokesman for the AfD in Thuringen.
H¶cke congratulated Kemmerich on his win. Kemmerich was criticized for accepting the handshake
"This is a hard day for me" as a member of the FDP, she wrote.
H¶cke is one of the most controversial figures in the AfD's leadership structure, having criticized the Memorial to the Murdered Jews of Europe in Berlin and advocated the abolition of a law that makes Holocaust denial illegal in Germany, amongst numerous other scandals.
It is unclear what will happen next as Thuringia tries to form a government, but Kemmerich has said he will refuse to form a ruling coalition with the AfD.
A sharp rebuke from Merkel's party
By the end of the day on Wednesday, various politicians had floated the idea of new elections in Thuringia.
Most prominent among them was CDU chief Annegret Kramp-Karrenbauer, who asserted that the FDP's Kemmerich had "no stable basis" to govern and said her party's leadership had decided to call for fresh state elections.
In a rebuke of her party's state-level officials, Kramp-Karrenbauer accused Thuringian CDU members of having "explicitly acted against the recommendations, demands and requests of the party" in aligning with the AfD.
Vodafone to remove Huawei from core of its European network after UK decision to restrict Chinese company's role in 5G | South China Morning Post
Thu, 06 Feb 2020 06:20
A Vodafone employee holds a 5G smartphone. The company was the first German telecommunications company to launch a commercial 5G network. Photo: Federico Gambarini/dpa
The move will take around five years to implement at a cost of approximately US$220.4 million, according to CEO Nick ReadTopic | Huawei
Reuters Published: 10:38am, 6 Feb, 2020
Updated: 10:58am, 6 Feb, 2020
A Vodafone employee holds a 5G smartphone. The company was the first German telecommunications company to launch a commercial 5G network. Photo: Federico Gambarini/dpa
Losing Track of Time in the Epicenter of China's Coronavirus Outbreak - The New York Times
Thu, 06 Feb 2020 06:08
WUHAN, China '-- In the mornings, Wuhan is so quiet that bird calls sound down once busy streets. Stray dogs trot in the middle of empty expressways. Residents wrapped in masks creep out of their homes, anxiety flitting across their eyes.
They line up at hospitals overwhelmed by a virus that most had not heard of until a few weeks ago.
They line up outside pharmacies despite the door signs declaring they have sold out of protective masks, disinfectant, surgical gloves and thermometers. They line up to buy rice, fruit and vegetables from food stores that keep operating, while nearly all other shops are closed.
Then they shuffle home to wait out this 21st-century siege. The unluckiest ones lie at home or in a hospital, stricken by pneumonia fevers that could spell death linked to coronavirus 2019-nCoV.
''I'd never heard of this thing called a coronavirus before,'' said Sun Ansheng, a man in his 50s who the other day was sitting on the steps outside Hankou Hospital in Wuhan, where his feverish wife was being treated as a suspected victim of the coronavirus. ''But now it's in my mind as soon as I wake up.''
''There's still not enough beds and not enough doctors,'' he said.
Image Wuhan on Monday. Credit... Getty Images Wuhan, a sprawling industrial city in central China at the heart of an epidemic that has affected more than 20 countries, is nearly two weeks into a state-imposed lockdown.
People here and across much of Hubei Province are subjects of a vast medical experiment conceivable only in authoritarian China: Is it is possible to halt the spread of a virus by putting tens of millions of people under a kind of house detention, warning them to stay inside their homes, and blocking their way out of cities, towns or villages?
The proliferation of the coronavirus, and the government's draconian restrictions, have given much of Wuhan, a metropolis of 11 million on the Yangtze River, the feel of a ghost city. Many residents said their lives that seemed secure a month ago have been upended, and their futures are in disorienting limbo.
Some remain stoical, carrying on with the remnants of normality: jogging, strolling by the river, taking children outdoors for a quick breath of fresh air. Many feel marooned in boredom and dread.
''I've started to lose track of the days,'' said Yang Dechao, a burly 34-year-old factory worker trapped in Wuhan. ''Is it Sunday or Monday? You forget because all normal activity has stopped. Ordinary people have just their families and their phones.''
On the morning of Jan. 23, Mr. Yang explained ruefully, he arrived in Wuhan for a medical checkup, only to hear that the government had just banned nearly everyone from leaving.
Now he talks to his aged parents in his home village outside the city in terse voice mail messages, checking in on their health and shrinking food supplies.
Updated Feb. 5, 2020
What is a Coronavirus, and how dangerous is it? Read up on the respiratory virus, including its symptoms and how it is transmitted. How bad could the outbreak be? Here are the six key factors that will determine whether it can be contained. Where has the virus spread? You can track its movement with this map. How is the United States being affected? There have been at least a dozen cases. American citizens and permanent residents who fly to the United States from China are now subject to a two-week quarantine. What if I'm traveling? Several countries, including the United States, have discouraged travel to China, and several airlines have canceled flights. Many travelers have been left in limbo while looking to change or cancel bookings. How do I keep myself and others safe? Washing your hands is the most important thing you can do. ''I have relatives here, but I wouldn't dare visit them,'' he said, pausing on his way to find a cheaper hotel to stay in. ''Everyone is afraid of visitors. Many people here also feel isolated. Me too.''
Traversing Wuhan by car and foot over the past two weeks has exposed the contrast between the clenched-smile optimism of government propaganda, and the sounds and sights of a city beleaguered by confusion, anxiety and frustrations.
''I can't stand staying inside,'' said Zhang Biao, a 52-year-old cook eating chocolate cookies on a streetside bench. ''Everyone feels irritated and jumpy.''
Neighborhood Communist Party committees have mobilized to try to provide relief and increase morale.
Soothing recorded messages playing over loudspeakers say that the government cares, and admonish residents to wear masks and minimize outings. Red banners hang on road barriers and walls, telling residents not to heed hearsay about miracle cures.
''Don't panic,'' says one banner. ''Don't allow rumors to make a mess of things.''
But after Wuhan officials silenced early talk of the virus outbreak as ''rumor mongering,'' many residents are skeptical about the reassuring official message.
In interviews, many spat out the names of the city and province officials whom they say let the virus slip out of control. But most residents said they were helpless to do much while the virus raged, preferring to vent their emotions in the relative refuge of their homes or online.
''First, we need honesty and transparency now,'' said Mao Shuo, a 26-year-old engineering company worker who had briefly tugged down her mask outside for a cigarette. ''Who's to blame, who gets punished, that must come, but now we just want to survive.''
She added: ''Where's all the medical masks? Are they hoarding them somewhere? That's what I most want to know.''
Outside the market for meat, fish and seafood, from which the virus spread, police officers and security guards sit around, yelling desultorily at passers-by to keep away. A block away, rows of neat new shops '-- Starbucks, 5G mobile stores '-- and apartment complexes exude middle-class aspirations. This epidemic took root not in a slum, but a modern city.
A little down the street, dozens of dogs locked inside a ''canine salon'' wailed. Nobody seemed to be inside, and it was unclear whether they were being cared for. On the streets, too, little dogs roam, either escapees abandoned by owners who may be in the hospital or who believe unfounded rumors that pets spread the virus.
Many residents have little energy to think about such things. Most who need a medical check for a cough or fever must endure lengthy lines to register, see a doctor and wait for possible prescription '-- often an intravenous drip.
Major hospitals are one of the few places in the city where keeping a distance from others seems difficult. At Wuhan Union Hospital, the patients, mostly elderly, crushed around doctors who wore full-body protective suits.
''We've heard about people in the neighborhood suddenly dying of pneumonia. Every cough is frightening,'' said Liu Xiaoping, a retiree in her 60s who had come for a checkup but gave up, worried it would be too late for her long walk home by the time she finished. ''But waiting hours at a hospital is also frightening. What do you think I should do?''
Jeffrey Epstein's Mystery Bank Came Alive After His Death - The New York Times
Thu, 06 Feb 2020 05:50
Southern Country International received millions of dollars from Mr. Epstein's estate in December.
In the years after Jeffrey Epstein registered as a sex offender, he closed his money management firm and started a business to develop algorithms and mine DNA and financial databases.
Then he set up a bank.
In a banking license application reviewed by The New York Times, Mr. Epstein described himself as one of the investing world's ''pioneers'' and said he wanted to pursue the ''dynamic discipline of international banking.''
Officials in the Virgin Islands, the United States territory where Mr. Epstein set up most of his businesses, approved a license for him in 2014 to run one of the territory's first international banking entities, a specialized bank that can do business only with offshore clients. The approval was unusual, given Mr. Epstein's status as a convicted sex offender.
The bank, Southern Country International, renewed its license for each of the next five years, but it's unclear whether it conducted any business or had any customers. Mr. Epstein, who died while in federal custody last summer following his arrest on sex trafficking charges, does not appear to have done any marketing for the bank or hired much staff.
The bank was created under a territorial law that lacked many of the oversight requirements banks are usually subject to, and its regulatory file is largely empty. A lawyer for Mr. Epstein told officials in the Virgin Islands in 2018 that Southern Country had not commenced operations. And regulators in the territory said they did not exercise oversight of the bank because it did not appear to be doing any business.
And yet, after Mr. Epstein's death, his estate transferred more than $12 million to Southern Country, according to court documents.
On Tuesday, at a court hearing in the Virgin Islands on motions involving Mr. Epstein's estate, a magistrate judge, Carolyn Hermon-Purcell, questioned the estate's lawyers about the transfers to Southern Country, saying the disclosure was not satisfactory. The judge said she did not know why Southern Country would be receiving checks from the estate. ''There's no explanation for it,'' she said.
A lawyer for the estate responded that some of the payment had been made in error, but the judge was not satisfied with his response and asked him to follow up with a fuller accounting.
The checks '-- listed in the estate's transactions for routine payments such as cable-TV bills and phone service for Mr. Epstein's many properties '-- stand out. The list of payments were filed with Judge Hermon-Purcell, who is overseeing his $635 million estate, including the possible establishment of a compensation fund for his victims.
That Mr. Epstein was able to get a banking license in the first place is unusual.
His 2008 conviction in Florida on a charge of soliciting prostitution from an underage girl required him to register as a sex offender. Most bank operators doing business in the United States are required to undergo rigorous background checks, and most banking institutions are subject to oversight by the arm of the Treasury that investigates suspicious financial transactions. Neither was required by the Virgin Islands when Mr. Epstein submitted the application in 2013.
The territory had passed its international banking entity law a year earlier, in hopes of enticing investment from overseas. It modeled its law on that of Puerto Rico, where international banking entities have existed for three decades.
Such organizations are attractive to offshore investors because the banks are able to offer more favorable tax treatment than the investors' own countries can. In return, the territories expect residents to manage the banks, even though they cannot use the banks' services.
These specialized banks have drawn scrutiny because of their potential for abuse, including money laundering. The Federal Reserve Bank of New York describes international bank entities in the Virgin Islands and Puerto Rico as ''high-risk'' institutions. Last year, it temporarily suspended applications for them to obtain financial services from the Fed until it can issue stricter rules for them.
Mr. Epstein was carefully evasive in answering a question on the application that was meant to reveal information about an applicant's criminal record. His response mentioned his guilty plea to state charges in Florida, but it played down other elements of the case.
''For a relatively brief period, in what has otherwise been a productive and accomplished life,'' the application said, Mr. Epstein ''did face some legal difficulties relating to matters alleged to have taken place seven years ago.'' The application noted that a federal investigation had been ''discontinued.''
But that answer was misleading, said Richard Scott Carnell, a former assistant secretary for financial institutions at the Treasury Department. The application did not reflect that Mr. Epstein's plea deal included an agreement with federal prosecutors, who promised not to bring their own charges. The agreement acknowledged that federal authorities had compiled a long list of other possible underage victims.
''Bank regulators expect applicants to be candid,'' said Mr. Carnell, now an associate professor at Fordham Law School. ''You'd never suspect there was a nonprosecution agreement. As a bank regulator, I'd be outraged to learn that an applicant had misled me in that way.''
In his application, Mr. Epstein listed as references James E. Staley, the chief executive of Barclays who had cultivated a relationship with Mr. Epstein while at JPMorgan Chase. Another reference was Andrew Farkas, a New York real estate tycoon and co-owner of a marina and office complex on St. Thomas with Mr. Epstein. Spokesmen for both men said they had been unaware they were listed as references, along with JPMorgan and FirstBank, a Puerto Rico-based lender with branches in the Virgin Islands that long held some of Mr. Epstein's accounts.
The application was submitted by Erika A. Kellerhals, a longtime tax lawyer for Mr. Epstein in the Virgin Islands. She did not return requests for comment.
Southern Country had not commenced doing business as of April 2018, according to correspondence between Ms. Kellerhals and the territory's banking department. Regulators said the bank was a ''self-reporting'' company and did not require additional regulatory oversight if it was not operational.
But court documents show Southern Country was active for some of last year.
Records filed by the estate on Friday indicate that Southern Country had $693,157 in assets when Mr. Epstein died on Aug. 10. Then, in mid-December, the estate transferred $15.5 million to Southern Country in two checks. Southern Country sent back $2.6 million, leaving the total it received at $12.9 million. The documents filed by the estate do not give a reason for the transfers.
It's also not clear what Southern Country did with that money. Two weeks later, the year-end value of Southern Country's assets was $499,759, according to the estate's filings.
The estate has told officials in the Virgin Islands that it does not intend to renew the bank's license again.
Around the time the territory granted Mr. Epstein his banking license, it also gave a lucrative tax break to Southern Trust, a company Mr. Epstein said was developing sophisticated algorithms to mine DNA and financial databases. The tax break came from the territory's Economic Development Authority, which was approved by the territory's former governor, John de Jongh Jr., while his wife, Cecile, worked for Mr. Epstein. Neither Ms. de Jongh nor her husband returned messages seeking comment.
The tax break, granted in 2013, was a boon for Mr. Epstein. Southern Trust generated about $300 million in profit in six years, and he paid an effective tax rate of about 3.9 percent. The source of Southern Trust's revenue is not clear; the bare-bones corporate filings made by the company in the Virgin Islands do not list any clients.
Although the Virgin Islands was long a place where Mr. Epstein got his way, it has lately cast itself as one of his victims.
In a lawsuit last month, the attorney general of the Virgin Islands, Denise N. George, said Mr. Epstein had sullied the territory's reputation with his conduct. She sued Mr. Epstein's estate, seeking to seize his private islands and dissolve what she said were shell companies acting as fronts for his sex-trafficking enterprise.
The suit seeks to intervene in the administration of Mr. Epstein's will to safeguard assets for dozens of his victims, claiming the coexecutors may have a conflict of interest because they were officers in many of Mr. Epstein's companies, including Southern Country and Southern Trust. The coexecutors, Darren Indyke and Richard Kahn, did not return requests for comment.
Judge Hermon-Purcell, the magistrate judge overseeing the administration of Mr. Epstein's will in the Virgin Islands, heard arguments on the attorney general's request at the hearing on Tuesday. The judge said she would issue a ruling at a later date.
Freeman Rogers contributed reporting.
BREAKING: Pelosi Could Face Harsh Penalty For Potential US Code Violation Of Destroying Official Gov Document
Thu, 06 Feb 2020 00:59
Verified Twitter user Carl Higbie set Twitter on fire when he pointed to US code that shows Nancy Pelosi could be facing HUGE punishment for ripping up Trump's State of the Union Address if it proves to be an official government document.
Check out his tweet below, which says Pelosi could be fined and even be DISQUALIFIED from holding any office of the United States if the document is deemed to be official:
sponsorDon Jr. sees a big legal problem with it as well:
Here is the full description from Cornell, and it proves Pelosi could be in big trouble:
(a) Whoever willfully and unlawfully conceals, removes, mutilates, obliterates, or destroys, or attempts to do so, or, with intent to do so takes and carries away any record, proceeding, map, book, paper, document, or other thing, filed or deposited with any clerk or officer of any court of the United States, or in any public office, or with any judicial or public officer of the United States, shall be fined under this title or imprisoned not more than three years, or both.
(b) Whoever, having the custody of any such record, proceeding, map, book, document, paper, or other thing, willfully and unlawfully conceals, removes, mutilates, obliterates, falsifies, or destroys the same, shall be fined under this title or imprisoned not more than three years, or both; and shall forfeit his office and be disqualified from holding any office under the United States. As used in this subsection, the term ''office'' does not include the office held by any person as a retired officer of the Armed Forces of the United States.
WOAH!
It's possible that Nancy Pelosi's publicity stunt is about to have some MAJOR consequences!
***FREE 'Keep America Great' hat - OFFER EXPIRES SOON***
Do you think Pelosi should be FINED and REMOVED from office? Comment below...
UPDATE: Barnes & Noble cancels launch of classic novels with new covers following online backlash - amNewYork
Thu, 06 Feb 2020 00:32
Barnes & Noble has shelved their plans to release a collection of classic books with new ''culturally diverse'' covers following internet backlash.
Penguin Random House and Barnes & Noble Fifth Avenue had originally up to give twelve classic young adult novels new covers, known as ''Diverse Editions.'' The books were meant hit the shelves on Feb. 5, and the books were to be on display in their massive storefront throughout the month of February. Barnes & Noble Fifth Avenue was also supposed to host a launch event to celebrate the release.
Each title had five culturally diverse custom covers designed to ensure the recognition, representation, and inclusion of various multiethnic backgrounds reflected across the country. The new covers are a part of a new initiative to champion diversity in literature.
Following the news of the new covers, many Twitter users expressed their anger and disappointment over the situation, citing that a better option would have been to promote authors of color.
Barnes & Noble released a statement on Twitter acknowledging the concerns of the public and ultimately canceling the release event at the store.
Updated at 6:30 p.m.
Barnes & Noble on Twitter: "The Diverse Editions event at our @BNFifthAvenue location originally scheduled for this evening has been cancelled. Please see our statement: https://t.co/jGquff9MyM" / Twitter
Thu, 06 Feb 2020 00:31
Hope Jones @ HopeJRC
12h Seems to still miss the point. Shouldn't we aim to drive engagement with titles from Black authors if it was aimed to launch as a project in conjunction with Black History Month? I think acknowledgement that it missed the mark would be more impactful than explaining intent
View conversation · Hope Jones @ HopeJRC
12h And, apologies, to further address how problematic this explanation is - BHM came into existence to, for one, counter internalized oppression (that was a result of exploitation) and highlight Black excellence. So to literally exploit Blackness to push White stories is so..obtuse
View conversation ·
Twenty-second Amendment to the United States Constitution - Wikipedia
Thu, 06 Feb 2020 00:29
The Twenty-second Amendment (Amendment XXII) to the United States Constitution sets a limit on the number of times an individual is eligible for election to the office of President of the United States, and also sets additional eligibility conditions for presidents who succeed to the unexpired terms of their predecessors.[1]
Prior to the ratification of the amendment, the president had not been subject to term limits, but George Washington had established a two-term tradition that many other presidents had followed. In the 1940 presidential election and the 1944 presidential election, Franklin D. Roosevelt became the first president to win a third term and then later a fourth term, giving rise to concerns about the potential issues involved with a president serving an unlimited number of terms. Congress approved the Twenty-second Amendment on March 24, 1947, and submitted it to the state legislatures for ratification. That process was completed on February 27, 1951, after the amendment had been ratified by the requisite 36 of the then-48 states (as neither Alaska nor Hawaii had been admitted as states), and its provisions came into force on that date.
The amendment prohibits any individual who has been elected president twice from being elected again. Under the amendment, an individual who fills an unexpired presidential term lasting greater than two years is also prohibited from winning election as president more than once. Scholars debate whether the amendment prohibits affected individuals from succeeding to the presidency under any circumstances or whether it only applies to presidential elections.
Text Edit Section 1. No person shall be elected to the office of the President more than twice, and no person who has held the office of President, or acted as President, for more than two years of a term to which some other person was elected President shall be elected to the office of the President more than once. But this Article shall not apply to any person holding the office of President when this Article was proposed by the Congress, and shall not prevent any person who may be holding the office of President, or acting as President, during the term within which this Article becomes operative from holding the office of President or acting as President during the remainder of such term.
Section 2. This Article shall be inoperative unless it shall have been ratified as an amendment to the Constitution by the legislatures of three-fourths of the several states within seven years from the date of its submission to the states by the Congress.[2]
Background Edit Notwithstanding that the Twenty-second Amendment was clearly a reaction to Franklin D. Roosevelt's election to an unprecedented four terms as president, the notion of presidential term limits has long been debated in American politics. Delegates to the Constitutional Convention of 1787 considered the issue extensively (alongside broader questions, such as who would elect the president, and the president's role). Many'--including Alexander Hamilton and James Madison'--supported a lifetime appointment for presidents, while others favored fixed terms appointments. Virginia's George Mason denounced the life-tenure proposal as tantamount to establishment of an elective monarchy.[3] An early draft of the United States Constitution provided that the President was restricted to a single seven-year term.[4] Ultimately, the Framers approved four-year terms with no restriction on the amount of time a person could serve as president.
Though dismissed by the Constitutional Convention, the concept of term limits for U.S. presidents took hold during the presidencies of George Washington and Thomas Jefferson. As his second term entered its final year in 1796, George Washington was exhausted from years of public service, and his health had begun to decline. He was also bothered by the unrelenting attacks from his political opponents, which had escalated after the signing of the Jay Treaty, and believed that he had accomplished his major goals as president. For these reasons, he decided not to stand for reelection to a third term, a decision he announced to the nation through a Farewell Address in September 1796.[5] Eleven years later, as Thomas Jefferson neared the half-way point of his second term, he wrote,
If some termination to the services of the chief magistrate be not fixed by the Constitution, or supplied by practice, his office, nominally for years, will in fact, become for life; and history shows how easily that degenerates into an inheritance.[6]
Since Washington made his historic announcement, numerous academics and public figures have looked at his decision to retire after two terms, and have, according to political scientist Bruce Peabody, "argued he had established a two-term tradition that served as a vital check against any one person, or the presidency as a whole, accumulating too much power".[7] Numerous amendments aimed toward changing informal precedent into constitutional law were proposed in Congress during the early to mid-19th century, but none passed.[3][8] Three of the next four presidents after Jefferson'--James Madison, James Monroe, and Andrew Jackson'--served two terms, and each one adhered to the two-term principle;[1] Martin Van Buren was the only president between Jackson and Abraham Lincoln to be nominated for a second term, although he lost the 1840 election, and so only served one term.[8] Before the Civil War the seceding States drafted the Constitution of the Confederate States of America which in most respects was similar to the United States Constitution, but one change was limiting the President to a single six-year term.
In spite of the strong two-term tradition, a few presidents prior to Franklin Roosevelt did attempt to secure a third term. Following Ulysses S. Grant's reelection victory in 1872, there were serious discussions within Republican political circles about the possibility of his running again in 1876. Interest in a third term for Grant evaporated however, in the light of negative public opinion and opposition from members of Congress, and Grant left the presidency in 1877, after two terms. Even so, as the 1880 election approached, he sought nomination for a (non-consecutive) third term at the 1880 Republican National Convention, but narrowly lost to James Garfield, who would go on to win the 1880 election.[8]
Theodore Roosevelt succeeded to the presidency on September 14, 1901, following William McKinley's assassination (194 days into his second term), and was subsequently elected to a full term in 1904. While he declined to seek a third (second full) term in 1908, Roosevelt did seek one four years later, in the election of 1912, where he lost to Woodrow Wilson. Wilson himself, despite his ill health following a serious stroke, aspired to a third term. Many of Wilson's advisers tried to convince him that his health precluded another campaign, but Wilson nonetheless asked that his name be placed in nomination for the presidency at the 1920 Democratic National Convention.[9] Democratic Party leaders were unwilling to support Wilson, however, and the nomination eventually went to James M. Cox, who lost to Warren G. Harding. Wilson again contemplated running for a (nonconsecutive) third term in 1924, devising a strategy for his comeback, but again lacked any support; he died in February of that year.[10]
Franklin D. Roosevelt spent the months leading up to the 1940 Democratic National Convention refusing to state whether he would seek a third term. His Vice President, John Nance Garner, along with Postmaster General James Farley, announced their candidacies for the Democratic nomination. When the convention came, Roosevelt sent a message to the convention, saying he would run only if drafted, saying delegates were free to vote for whomever they pleased. This message was interpreted to mean he was willing to be drafted, and he subsequently was renominated on the convention's first ballot.[8][11] Later, during the 1940 presidential election, Roosevelt won a decisive victory over Republican Wendell Willkie, becoming the first, and to date only, person to exceed eight years in office. Roosevelt's decision to seek a third term dominated the election campaign.[12] Willkie ran against the open-ended presidential tenure, while Democrats cited the war in Europe as a reason for breaking with precedent.[8]
Four years later, Roosevelt faced Republican Thomas E. Dewey in the 1944 election. Near the end of the campaign, Thomas Dewey announced his support of a constitutional amendment that would limit future presidents to two terms. According to Dewey, "four terms, or sixteen years (a direct reference to the president's tenure in office four years hence), is the most dangerous threat to our freedom ever proposed."[13] He also discreetly raised the issue of the president's age. Roosevelt, however, was able to exude enough energy and charisma to retain the confidence of the American public, who reelected him to a fourth term.[14]
While he effectively quelled rumors of his poor health during the campaign, Roosevelt's health was in reality deteriorating. On April 12, 1945, only 82 days after his fourth inauguration, he suffered a cerebral hemorrhage and died. He was succeeded by Vice President Harry Truman.[15] In the midterm elections 18 months later, Republicans took control of both the House and the Senate. As many of them had campaigned on the issue of presidential tenure, declaring their support for a constitutional amendment that would limit how long a person could serve as president, the issue was given top priority in the 80th Congress when it convened in January 1947.[7]
Proposal and ratification Edit Proposal in Congress Edit The House of Representatives took quick action, approving a proposed constitutional amendment (House Joint Resolution 27) setting a limit of two four-year terms for future presidents. Introduced by Earl C. Michener, the measure passed 285''121, with support from 47 Democrats, on February 6, 1947. Meanwhile, the Senate developed its own proposed amendment, which initially differed from the House proposal by requiring that the amendment be submitted to state ratifying conventions for ratification, rather than to the state legislatures, and by prohibiting any person who had served more than 365 days in each of two terms from further presidential service. Both these provisions were removed when the full Senate took up the bill, but a new provision was, however, added. Put forward by Robert A. Taft, it clarified procedures governing the number of times a vice president who succeeded to the presidency might be elected to office. The amended proposal was passed 59''23, with 16 Democrats in favor, on March 12.[1][16]
Several days later, the House agreed to the Senate's revisions, and on March 24, 1947, the constitutional amendment imposing term limitations on future Presidents was submitted to the states for ratification.[2] The ratification process for the 22nd Amendment was completed on February 27, 1951, 3 years, 343 days after it was sent to the states.[12][17]
Ratification by the states Edit A map of how the states voted on the Twenty-second Amendment
Once submitted to the states, the 22nd Amendment was ratified by:[2]
Maine (March 31, 1947)Michigan (March 31, 1947)Iowa (April 1, 1947)Kansas (April 1, 1947)New Hampshire (April 1, 1947)Delaware (April 2, 1947)Illinois (April 3, 1947)Oregon (April 3, 1947)Colorado (April 12, 1947)California (April 15, 1947)New Jersey (April 15, 1947)Vermont (April 15, 1947)Ohio (April 16, 1947)Wisconsin (April 16, 1947)Pennsylvania (April 29, 1947)Connecticut (May 21, 1947)Missouri (May 22, 1947)Nebraska (May 23, 1947)Virginia (January 28, 1948)Mississippi (February 12, 1948)New York (March 9, 1948)South Dakota (January 21, 1949)North Dakota (February 25, 1949)Louisiana (May 17, 1950)Montana (January 25, 1951)Indiana (January 29, 1951)Idaho (January 30, 1951)New Mexico (February 12, 1951)Wyoming (February 12, 1951)Arkansas (February 15, 1951)Georgia (February 17, 1951)Tennessee (February 20, 1951)Texas (February 22, 1951)Utah (February 26, 1951)Nevada (February 26, 1951)Minnesota (February 27, 1951)Ratification was completed when the Minnesota Legislature ratified the amendment. On March 1, 1951, the Administrator of General Services, Jess Larson, issued a certificate proclaiming the 22nd Amendment duly ratified and part of the Constitution. The amendment was subsequently ratified by:[2]North Carolina (February 28, 1951)South Carolina (March 13, 1951)Maryland (March 14, 1951)Florida (April 16, 1951)Alabama (May 4, 1951)Conversely, two states'--Oklahoma and Massachusetts'--rejected the amendment, while five (Arizona, Kentucky, Rhode Island, Washington, and West Virginia) took no action.[16]
Affected individuals Edit The 22nd Amendment's two-term limit did not apply (due to the grandfather clause in Section 1) to Harry S. Truman, because he was the incumbent president at the time it was proposed by Congress. Truman, who had served nearly all of Franklin D. Roosevelt's unexpired fourth term and who was elected to a full term in 1948, was thus eligible to seek re-election in 1952.[12] However, with his job approval rating floundering at around 27%,[18][19] and after a poor performance in the 1952 New Hampshire primary, Truman chose not to seek his party's nomination. He theoretically also would have been eligible in later elections.
Since coming into force in 1951, the amendment has applied to six presidents who have been elected twice: Dwight D. Eisenhower, Richard Nixon, Ronald Reagan, Bill Clinton, George W. Bush, and Barack Obama.
It could have impacted two who entered office intra-term due to their predecessor's death or resignation: Lyndon B. Johnson and Gerald Ford.[1] Johnson became president in November 1963, following the assassination of John F. Kennedy, served out the final 1 year and 59 days of Kennedy's term, and was elected to a full four-year term in 1964. Four years later, he briefly ran for a second full term, but withdrew from the race during the party primaries.[20][21] Had Johnson served a second full term '' through January 20, 1973 '' the total length of his presidency would have been 9 years and 59 days; as it happened, Johnson died two days after this date.[22] Gerald Ford, who became president in August 1974 following the resignation of Richard Nixon, served the final 2 years and 164 days of Nixon's term, and attempted to win a full four-year term in 1976, but was defeated by Jimmy Carter. Johnson was eligible to be elected to two full terms in his own right, as he had served less than two years of Kennedy's unexpired term, whereas Ford was eligible to be elected to only one full term, as he had served more than two years of Nixon's unexpired term.[1]
Edit As worded, the primary focus of the 22nd Amendment is on limiting individuals twice elected to the presidency from being elected again. Due to this, several issues could be raised regarding the amendment's meaning and application, especially in relation to the 12th Amendment, ratified in 1804, which states, "But no person constitutionally ineligible to the office of President shall be eligible to that of Vice-President of the United States".[23] While it is clear that under the 12th Amendment the original constitutional qualifications of age, citizenship, and residency apply to both the president and vice president, it is unclear whether someone who is ineligible to be elected president could be elected vice president. Because of this apparent ambiguity, there may be a loophole in the 22nd Amendment whereby a two-term former-president could be elected vice president and then succeed to the presidency as a result of the incumbent's death, resignation, or removal from office (or even succeed to the presidency from some other stated office in the presidential line of succession).[8][24]
Some argue that the 22nd Amendment and 12th Amendment bar any two-term president from later serving as vice president as well as from succeeding to the presidency from any point in the presidential line of succession.[25] Others contend that the original intent of the 12th Amendment concerns qualification for service (age, residence, and citizenship), while the 22nd Amendment, concerns qualifications for election, and thus (strictly applying the text) a former two-term president is still eligible to serve as vice president (neither amendment restricts the number of times an individual can be elected to the vice presidency), and then succeed to the presidency to serve out the balance of the term (though prohibited from running for election to an additional term).[26][27]
The practical applicability of this distinction has not been tested, as no former president has ever sought the vice presidency. In 1980, former president Gerald Ford was mentioned as a possible vice presidential running mate for Republican presidential nominee Ronald Reagan, and there were some negotiations between the two camps, but nothing ever came of the idea.[28] During Hillary Clinton's 2016 presidential campaign, she jokingly said that she had considered naming her husband Bill Clinton as her vice presidential running mate, but had been advised it would be unconstitutional.[29] Most likely, the constitutional question raised will remain unanswered unless the situation actually occurs.[1]
Attempts at repeal Edit Over the years, several presidents have voiced their antipathy toward the amendment. After leaving office, Harry Truman variously described it as: "bad", "stupid", and "one of the worst that has been put into the Constitution, except for the Prohibition Amendment".[30] In January 1989, during an interview with Tom Brokaw a few days prior to leaving office, Ronald Reagan stated his intention to push for a repeal of the 22nd Amendment, calling it "an infringement on the democratic rights of the people."[31] In a November 2000 interview with Rolling Stone, out-going President Bill Clinton suggested that, given longer life expectancy, perhaps the 22nd Amendment should be altered so as to limit presidents to two consecutive terms.[32] On multiple occasions since taking office in 2017, President Donald Trump has questioned presidential term limits and in public remarks has talked about serving beyond the limits of the 22nd Amendment. For instance, during an April 2019 White House event for the Wounded Warrior Project, he joked that he would remain president "at least for 10 or 14 years."[33][34]
The first efforts in Congress to repeal the 22nd Amendment were undertaken in 1956, only five years after the amendment's ratification. According to the Congressional Research Service, over the ensuing half-century (through 2008) 54 joint resolutions seeking to repeal the two-term presidential election limit were introduced (primarily in the House); none were given serious consideration.[1] Between 1997 and 2013, Jos(C) E. Serrano (D-NY) introduced nine resolutions (one per Congress, all unsuccessful) to repeal the amendment.[35] Repeal has also been supported by senior congressmen such as Barney Frank and David Dreier and Senators Mitch McConnell[36] and Harry Reid.[37]
See also Edit Term limits in the United StatesList of political term limitsReferences Edit ^ a b c d e f g Neale, Thomas H. (October 19, 2009). "Presidential Terms and Tenure: Perspectives and Proposals for Change" (PDF) . Washington, D.C.: Congressional Research Service, The Library of Congress . Retrieved March 22, 2018 . ^ a b c d "Constitution of the United States of America: Analysis and Interpretation" (PDF) . Washington, D.C.: Library of Congress. August 26, 2017. pp. 39''40 . Retrieved March 22, 2018 . ^ a b Buckley, F. H.; Metzger, Gillian. "Twenty-second Amendment". The Interactive Constitution. Philadelphia, Pennsylvania: The National Constitution Center . Retrieved March 19, 2018 . ^ First draft U.S.CONST., art. X, section 1. ^ Ferling, John (2009). The Ascent of George Washington: The Hidden Political Genius of an American Icon. New York: Bloomsbury Press. pp. 347''348. ISBN 978-1-59691-465-0. ^ Jefferson, Thomas (December 10, 1807). "Letter to the Legislature of Vermont". Ashland, Ohio: TeachingAmericanHistory.org . Retrieved March 19, 2018 . ^ a b Peabody, Bruce. "Presidential Term Limit". The Heritage Foundation . Retrieved January 10, 2017 . ^ a b c d e f Peabody, Bruce G.; Gant, Scott E. (February 1999). "The Twice and Future President: Constitutional Interstices and the Twenty-Second Amendment". Minnesota Law Review. Minneapolis: University of Minnesota Law School. 83 (3): 565''635. Archived from the original on January 15, 2013 . Retrieved June 12, 2015 . ^ Pietrusza, David (2007). The Year of the Six Presidents. New York: Carroll and Graf. pp. 187''200. ISBN 978-0-78671-622-7. ^ Saunders, Robert M. (1998). In Search of Woodrow Wilson: Beliefs and Behavior. Westport, Connecticut: Greenwood Press. pp. 260''262. ISBN 9780313305207. ^ Rosen, Elliot A. (1997). " ' Not Worth a Pitcher of Warm Piss': John Nance Garner as Vice President". In Walch, Timothy (ed.). At the President's Side: The Vice Presidency in the Twentieth Century. Columbia, Missouri: University of Missouri Press. pp. 52''53. ISBN 0-8262-1133-X . Retrieved March 20, 2018 . ^ a b c "FDR's third-term decision and the 22nd amendment". Constitution Daily. Philadelphia, Pennsylvania: The National Constitution Center . Retrieved June 29, 2014 . ^ Jordan, David M. (2011). FDR, Dewey, and the Election of 1944. Bloomington, Indiana: Indiana University Press. p. 290. ISBN 978-0-253-35683-3. ^ Leuchtenburg, William E. "Franklin D. Roosevelt: Campaigns and Elections". Charlottesville, Virginia: Miller Center of Public Affairs, University of Virginia . Retrieved March 20, 2018 . ^ Leuchtenburg, William E. "Franklin D. Roosevelt: Death of the President". Charlottesville, Virginia: Miller Center of Public Affairs, University of Virginia . Retrieved March 20, 2018 . ^ a b Rowley, Sean (July 26, 2014). "Presidential terms limited by 22nd Amendment". Tahlequah Daily Press . Retrieved March 22, 2018 . ^ Mount, Steve (January 2007). "Ratification of Constitutional Amendments" . Retrieved May 9, 2012 . ^ Weldon, Kathleen (August 11, 2015). "The Public and the 22nd Amendment: Third Terms and Lame Ducks". Huffington Post . Retrieved March 27, 2018 . ^ Peters, Gerhard; Woolley, John T. "Presidential Job Approval: F. Roosevelt (1941) '' Trump". Data adapted from the Gallup Poll and compiled by Gerhard Peters. Santa Barbara, California: The American Presidency Project . Retrieved March 27, 2018 . ^ "Historically, odds were stacked against any President seeking a third term". Constitution Daily. Philadelphia, Pennsylvania: The National Constitution Center. December 27, 2016 . Retrieved March 22, 2018 . ^ Wicker, Tom (April 1, 1968). "Johnson Says He Won't Run · Surprise Decision: President Steps Aside in Unity Bid'--Says 'House' Is Divided". The New York Times . Retrieved March 22, 2018 '' via The Learning Network. ^ Freidel, Frank; Sidey, Hugh (2006). "Lyndon B. Johnson Biography". The White House . Retrieved June 28, 2018 . ^ "The Constitution: Amendments 11-27". America's Founding Documents. Washington, D.C.: National Archives . Retrieved March 11, 2018 . ^ Ready, Joel A. "The 22nd Amendment Doesn't Say What You Think It Says". Blandon, Pennsylvania: Cornerstone Law Firm . Retrieved November 6, 2017 . ^ Franck, Matthew J. (July 31, 2007). "Constitutional Sleight of Hand". National Review. Archived from the original on June 13, 2008 . Retrieved June 12, 2008 . ^ Dorf, Michael C. (August 2, 2000). "Why the Constitution permits a Gore-Clinton ticket". CNN. Archived from the original on October 1, 2005. ^ Gant, Scott E.; Peabody, Bruce G. (June 13, 2006). "How to bring back Bill: A Clinton-Clinton 2008 ticket is constitutionally possible". The Christian Science Monitor . Retrieved June 12, 2008 . ^ Burr, Richard (April 7, 2017). "1980 convention launched 'Reagan Revolution ' ". The Detroit News . Retrieved May 26, 2017 . ^ LoBianco, Tom (September 15, 2015). "Hillary Clinton: Bill as VP has 'crossed her mind ' ". CNN . Retrieved October 29, 2015 . ^ Lemelin, Bernard Lemelin (Winter 1999). "Opposition to the 22nd Amendment: The National Committee Against Limiting the Presidency and its Activities, 1949-1951". Canadian Review of American Studies. University of Toronto Press on behalf of the Canadian Association for American Studies with the support of Carleton University. 29 (3): 133''148. doi:10.3138/CRAS-029-03-06. ^ Reagan, Ronald (January 18, 1989). "President Reagan Says He Will Fight to Repeal 22nd Amendment". NBC Nightly News (Interview). Interviewed by Tom Brokaw. New York: NBC. Retrieved June 14, 2015. ^ "Clinton: I Would've Won Third Term". ABC News. December 7, 2000 . Retrieved March 26, 2018 . ^ Einbinder, Nicole (June 17, 2019). "Trump suggested his supporters want him to serve more than 2 terms as president". Business Insider . Retrieved September 14, 2019 . ^ Croucher, Shane (September 11, 2019). "Donald Trump Posts Image on Twitter, Instagram Joking That He'll Stand in 2024". Newsweek . Retrieved September 14, 2019 . ^ "H.J.Res. 15 (113th): Proposing an amendment to the Constitution of the United States to repeal the twenty-second article of amendment, thereby removing the limitation on the number of terms an individual may serve as President". Washington, D.C.: GovTrack, a project of Civic Impulse, LLC. 2013 . Retrieved March 23, 2018 . ^ "FACT CHECK: Bill to Repeal the 22nd Amendment". ^ potus_geeks (February 27, 2012). "The 22nd Amendment". External links Edit The Annenberg Guide to the United States Constitution: Twenty-second AmendmentCRS Annotated Constitution: Twenty-second Amendment
$12K a Day: How White Liberals Profit From Pushing 'White Privilege'
Wed, 05 Feb 2020 22:24
White liberal academics can earn more in a day lecturing about their own ''white privilege'' than the median black household makes in three months, public records obtained by The Daily Caller News Foundation and Census Bureau data show.
Left-wing academic Robin DiAngelo is renowned in social justice circles for crafting the ''white privilege checklist'' and for coining the term ''white fragility.'' Listening to her speak comes at a steep price.
DiAngelo, who is white, charged the University of Kentucky $12,000, not counting travel expenses, housing accommodations, and meals, for a two-hour ''Racial Justice Keynote and breakout session'' in March, according to a copy of the speaking contract obtained by The Daily Caller News Foundation through public records requests.
''Dr. DiAngelo's schedule cannot accommodate phone calls related to services,'' the contract states, instructing that all communications be sent via email or through DiAngelo's assistant. ''If phone calls are deemed necessary, they will be charged at a rate of $320 per hour.''
DiAngelo's fee for the event was more than a quarter of the annual median income for black families, which is just over $40,000, according to U.S. Census data.
The description for the two-hour event said DiAngelo would be talking about her book, ''White Fragility: Why Is It So Hard for White People to Talk About Racism?''
Her website defines ''white fragility'' as ''a state in which even a minimal challenge to the white position becomes intolerable, triggering a range of defensive responses. These responses function to reinstate white racial equilibrium and maintain white control.''
The consulting and keynotes section of DiAngelo's website says her lectures take an ''anti-racist'' approach based on ideas.
''Racism is the foundation of Western society; we are socialized into a racial hierarchy,'' it says. It also touts her ''expertise'' in ''clearly and accessibly presenting information that is politically and emotionally charged.''
The author is in high demand: DiAngelo's website says she's booked through March 2020. Tickets for a half-day workshop she led in San Francisco earlier this month started at $130 for adults and $65 for kids.
DiAngelo's fee typically runs between $10,000 and $15,000, a city official in Everett, Washington, where DiAngelo keynoted a conference in April, told The Daily Caller News Foundation.
The city government promoted the conference on its website, but the official said all costs were covered by an outside nonprofit, Communities of Color Coalition. The nonprofit didn't return The Daily Caller News Foundation's inquiries.
DiAngelo's clients include Amazon, the Bill & Melinda Gates Foundation, the Hollywood Writer's Guild, the YMCA Seattle Public Schools, and the city of Oakland, among others, according to her website.
DiAngelo did not reply to multiple requests for comment.
Left-wing academic Tim Wise, author of the book ''White Like Me,'' charges handsome speaking fees that rival DiAngelo's.
A speaker's booking agency lists Wise's speaking fee in the $10,000-$20,000 range. Wise told The Daily Caller News Foundation in an email that his asking fee is typically limited to $10,000, ''unless I am doing multiple events at a venue.''
Wise added that the agency, which receives 25% of his fees, ''puts money back into grassroots organizing and leadership development led by individuals and groups of color.''
''So between that, and the fact that they promote an overwhelming share of [people of color] on their roster, my working through them actually helps to amplify the voices of people of color, not just my own,'' he said.
The University of Michigan, a taxpayer-funded institution, paid Wise $10,000 to speak at a Martin Luther King Jr. symposium in January, public records show.
''I am brought in, in almost all cases, by people of color on campuses: staff, faculty, or students of color,'' Wise told The Daily Caller News Foundation. ''They are the ones making the decision to bring me in, and pay me, typically because they surmise (probably quite accurately) that it would be helpful to have a white voice speaking to these issues, rather than having to always do the heavy lifting themselves, or leave it up to folks of color to be the ones educating others about issues of racism.''
''In other words, I am responding to the decision by people of color in most cases to have a white speaker like myself come and add my voice to a conversation they are already leading in most instances,'' he said.
In most all of these cases, the schools have also brought in people of color throughout the year to speak to these matters, but feel that it is not pedagogically helpful to give the impression that these are just black and brown folks' issues, or things about which white folks shouldn't be speaking out, too.
One can agree or disagree with their thinking on this matter, but at least let's be clear: It is people of color who are making that call, and I tend to assume they know the climate on their campuses better than I do. If they think I can be helpful, so be it. This is why they request me when they do. It is what they say explicitly to me, and to my agency/organization.
Wise added that ''if a school wants to have an event with me and a person of color, perhaps in conversation, that if my fee is normally higher than the other person's that they must either raise that person's fee to meet mine, or if they can't afford that, I will lower mine to meet theirs.''
''Most of the time the people of color with whom I've done these actually charge more than me, or the same, so this becomes moot. But it has always been my policy that if the person of color would normally have made less, I insist on leveling the pay structure,'' he said.
Content created by The Daily Caller News Foundation is available without charge to any eligible news publisher that can provide a large audience. For licensing opportunities for this original content, email [email protected] .
dr paul maxwell - Google Search
Wed, 05 Feb 2020 22:20
Paul Maxwell (@paulcmaxwell) | Twitter1189 — 1239 - 115k - jpgtwitter.com Paul Maxwell | Desiring God240 — 240 - 9k - pngdesiringgod.org Dr. Paul Maxwell, Cardiologist in Sterling, IL | US News Doctors320 — 320 - 12k - jpghealth.usnews.com Masculinity with Paul Maxwell '-- Doctrine and Devotion1000 — 417 - 45k - jpgdoctrineanddevotion.com A1DgE06lkXL._US230_.jpg230 — 230 - 9k - jpgamazon.com Dr. Paul Maxwell200 — 250 - 8k - jpgwestpoint.edu Paul Maxwell - Wikipedia220 — 171 - 6k - jpgen.wikipedia.org Paul Maxwell - IMDb1173 — 1657 - 186k - jpgimdb.com Dr Paul Maxwell - ABC News (Australian Broadcasting Corporation)940 — 627 - 74k - jpgabc.net.au Paul Maxwell - Wheaton College, IL812 — 611 - 81k - jpegwheaton.edu Artists of Picacho Hills "Holly Day House" to benefit Mesilla ...280 — 291 - 32k - jpgkrwg.org Dr. Paul Courtney, MD '' Philadelphia, PA | Orthopaedic Surgery320 — 320 - 23k - jpgdoximity.com P. Courtney MD | Doylestown Health260 — 260 - 17k - ashxdoylestownhealth.org Holly Day House at St. Paul's United Methodist Church | KRWG1000 — 878 - 145k - jpgkrwg.org While researching my next article, I found Dr. Paul Maxwell ...1368 — 1712 - 1856k - pngpinterest.com TheoFit974 — 787 - 278k - pngtheo.fit Paul Maxwell1920 — 1440 - 176k - jpg
thegospelcoalition.org Dr. Paul Freeman, Jr. - John Maxwell Certified Team Member250 — 325 - 18k - jpgjohncmaxwellgroup.com TSC Interview: Dr. Paul Maxwell ' The Shepherd's Crook828 — 828 - 256k - jpgtheshepherdscrook.co Dr. Karl Maxwell "Max" Irwin - Obituaries - Cornwall, ON - Your ...235 — 320 - 49k - jpgyourlifemoments.ca
Paul Maxwell
Wed, 05 Feb 2020 22:19
Download the PDF here.I'll also send you a weekly list of my favorite tools for writing, fitness, and self-optimization.
We respect your privacy.
Your book will be in your inbox shortly!
Barack H. Obama, 44th President of the USA is related to George W. Bush, 43rd President of the United States!
Wed, 05 Feb 2020 21:50
George W. Bush, 43rd President of the United States
Dorothy Wear Bush his mother
'†'
Lucretia 'Loulie' Walker her mother
'†'
Joseph Walker Wear her brother
'†'
Adaline Coleman Wear his wife
'†'
Elizabeth Vanuxem Goodman her sister
'†'
Private her son
'†'
Private his son
'†'
Private his wife
'†'
Anne Carpenter her mother
'†'
Charles William Schwartz, Jr. her father
'†'
Charles Wheeler Schwartz, Sr. his father
'†'
Mary Schwartz his sister
'†'
Phoebe Johnson her daughter
'†'
LaVaughn Delores Robinson her daughter
'†'
Fraser C. Robinson, III her son
'†'
Robin DiAngelo - Google Search
Wed, 05 Feb 2020 21:40
About Me | Robin DiAngelo, PhD2648 — 3310 - 3194k - jpgrobindiangelo.com Author Robin DiAngelo: Debunking the most common myths white ...760 — 428 - 33k - jpgnbcnews.com Academic Robin DiAngelo: 'We have to stop thinking about racism as ...300 — 180 - 8k - jpgtheguardian.com KUOW - Robin DiAngelo: 'I think you're racist. I think I am, too.'924 — 634 - 48k - jpgkuow.org Robin DiAngelo, White Fragility: Why It's So Hard For White People ...629 — 328 - 322k - pngfinditcambridge.org What's My Complicity? Talking White Fragility With Robin DiAngelo ...400 — 277 - 162k - pngtolerance.org What white people '' and white feminists '' get wrong about race704 — 396 - 36k - jpgsbs.com.au Robin DiAngelo Says Colorblindness is 'Dangerous'912 — 516 - 48k - jpgpluralist.com Examining White Identity Is the Antidote to White Fragility ...650 — 380 - 387kbeaconbroadside.com White fragility: Robin DiAngelo's workshop, and the idea that ...3540 — 1770 - 1005k - jpegslate.com Robin DiAngelo Gets Real on Racism | American Libraries Magazine970 — 610 - 97k - jpgamericanlibrariesmagazine.org Robin DiAngelo | ALA Midwinter 2019800 — 450 - 36k - jpg2019.alamidwinter.org Why white people can't face up to racism | Crosscut960 — 640 - 70k - jpgcrosscut.com Dr. Robin DiAngelo discusses 'White Fragility' - YouTube480 — 360 - 21k - jpgyoutube.com White Fragility': A conversation with Robin DiAngelo | Goldsmiths ...960 — 540 - 28k - phpgold.ac.uk KUOW - Why is it so hard for white people to talk about race?924 — 634 - 149k - jpgkuow.org Robin DiAngelo on why it's so hard for white people to talk about ...600 — 450 - 32k - jpgmprnews.org Why white people should see color, and more from the author of ...780 — 501 - 75k - jpgseattletimes.com The Wheeler Centre: Robin DiAngelo: White '-- The Wheeler Centre1920 — 1080 - 338k - jpgwheelercentre.com Notre Dame diversity and inclusion conference to feature Robin ...1000 — 562 - 130k - jpgnews.nd.edu
Robin DiAngelo - Wikipedia
Wed, 05 Feb 2020 21:38
American academic
Robin J. DiAngelo
Born ( 1956-09-08 ) September 8, 1956 (age 63) Known forWhite Fragility (book)Academic backgroundAlma materUniversity of WashingtonAcademic workInstitutionsWestfield State University, University of WashingtonNotable ideas"white fragility"Robin J. DiAngelo (born September 8, 1956)[1] is an American academic, lecturer, and author working in the fields of critical discourse analysis and whiteness studies.[2][3] She formerly served as a tenured professor of multicultural education at Westfield State University and is currently an Affiliate Associate Professor of Education at the University of Washington in Seattle. She is known for her work pertaining to white fragility, a term which she coined in 2011.
Born to a European American family, DiAngelo received a PhD in multicultural education from the University of Washington in 2004; her thesis constituted a discourse analysis of whiteness. Becoming a professional academic, she taught at Westfield State University, where she became a tenured professor. In a 2011 academic paper she put forward the concept of white fragility, the notion that the tendency for white people to become defensive when confronted with their racial advantage functions to protect and maintain that advantage. She further promoted the idea through her 2018 book White Fragility: Why It's So Hard For White People To Talk About Racism.
Education and career [ edit ] DiAngelo received her Ph.D. in multicultural education from the University of Washington in 2004, with a dissertation entitled "Whiteness in racial dialogue: a discourse analysis".[4] Her Ph.D. committee was chaired by James A. Banks.[3] In 2007, she joined the faculty of Westfield State University,[5] where she was named a tenured professor of multicultural education in 2014. She later resigned from her position at Westfield.[3] She now holds the position of Affiliate Associate Professor of Education at the University of Washington.[6] She holds two Honorary Doctoral degrees from Starr King Seminary (2019) and Lewis & Clark University (2017).[7] She frequently gives seminars discussing racism, which she argues is embedded throughout America's political systems and culture.[2]
Work [ edit ] DiAngelo is known for her work regarding "white fragility", a term she coined in a 2011 peer-reviewed paper.[8][9][10] She has defined the concept of white fragility as "a state in which even a minimum amount of racial stress becomes intolerable, triggering a range of defensive moves." As of 2016, she regularly gives workshops on the topic.[11][12]
In June of 2018, DiAngelo published the book White Fragility: Why It's So Hard for White People to Talk About Racism.[13]
Reception [ edit ] In a 2019 article for The New Yorker, the columnist Kelefa Sanneh characterized DiAngelo as "perhaps the country's most visible expert in anti-bias training, a practice that is also an industry, and from all appearances a prospering one".[14]
The economist and journalist Jonathan Church has published multiple articles appraising her "white fragility" thesis as a fallacy of reification brigaded by faulty science.[15][16]
Bibliography [ edit ] DiAngelo, R. (2012). What Does it Mean to be White?: Developing White Racial Literacy. Counterpoints (New York, N.Y.). Peter Lang. ISBN 978-1-4331-1116-7. DiAngelo, R. (2018). White Fragility: Why It's So Hard for White People to Talk about Racism. Beacon Press. ISBN 978-0-8070-4741-5. Sensoy, O.; DiAngelo, R. (2017). Is Everyone Really Equal?: An Introduction to Key Concepts in Social Justice Education, Second Edition. Multicultural Education Series. Teachers College Press. ISBN 978-0-8077-5861-8. References [ edit ] ^ "Robin J. DiAngelo". Library of Congress. ^ a b Demby, Gene (23 November 2016). "Is It Racist To Call Someone 'Racist'?". NPR. ^ a b c "About Me". Robindiangelo.com. ^ DiAngelo, Robin (2004). Whiteness in racial dialogue: a discourse analysis (Ph.D. thesis). University of Washington. ^ "Education Faculty & Staff". Westfield State University. Archived from the original on 2014-11-24. CS1 maint: BOT: original-url status unknown (link) ^ Devore, Molly (2 April 2019). "Author of 'White Fragility' discusses dangerous impacts of internalized white superiority". The Badger Herald. ^ "Highlights: 2019 UUA General Assembly". Starr King School for the Ministry. 2 July 2019. ^ DiAngelo, Robin (2011). "White Fragility". The International Journal of Critical Pedagogy. University of North Carolina at Greensboro. 3 (3). ^ Adler-Bell, Sam. "Why White People Freak Out When They're Called Out About Race". Alternet. ^ Bouie, Jamelle (13 March 2016). "How Trump Happened". Slate. ^ Springer, Dan (17 August 2016). "Seattle offers classes on 'white fragility,' to explain roots of guilt". FoxNews.com. ^ Hanchard, Jenna (28 July 2016). "Local workshop explores 'white fragility ' ". King5. ^ Waldman, Katy (23 July 2018). "A Sociologist Examines the "White Fragility" That Prevents White Americans from Confronting Racism". New Yorker. ^ Sanneh, Kelefa (August 12, 2019). "The Fight to Redefine Racism". The New Yorker . Retrieved August 14, 2019 . ^ Church, Jonathan (24 August 2018). "The Problem with 'White Fragility' Theory". Quillette . Retrieved 2019-06-25 . ^ Church, Jonathan (21 December 2018). "The Epistemological Problem of White Fragility Theory". areomagazine.com . Retrieved 2019-06-25 . External links [ edit ] Official website Why It's So Hard to Talk to White People About Racism, article written by DiAngelo for the Good Men Project
Lamar Jackson - Wikipedia
Wed, 05 Feb 2020 21:37
American football quarterback
Lamar Demeatrice Jackson Jr. (born January 7, 1997) is an American football quarterback for the Baltimore Ravens of the National Football League (NFL). He played college football at Louisville where he won the Heisman Trophy, Maxwell Award, Walter Camp Award, and was unanimously selected as an All-American as a sophomore in 2016.
Jackson was selected with the 32nd overall pick by the Ravens in the first round of the 2018 NFL Draft. He began his rookie season as a backup, but became the team's starting quarterback following an injury to starter Joe Flacco. During the season, Jackson helped the team clinch the AFC North division title and became the youngest quarterback to start a playoff game. In 2019, his first full season as starter, Jackson set a record for the most rushing yards in a season by a quarterback[1] and led the league with 36 touchdown passes.[2] Jackson was named the NFL Most Valuable Player for 2019, becoming only the second-ever unanimous selection for the award.[3]
Early years Jackson was born to Felicia Jones and Lamar Jackson, Sr., on January 7, 1997,[4] and grew up in the center of an economically distressed section of Pompano Beach, Florida. Lamar Sr. died in a car accident on the same day Lamar's grandmother died in 2005 when Jackson was eight and he and his siblings were thereafter raised by their mother.[5][6] He attended public schools and played Pop Warner football in the same Florida league with Ravens wide receiver Marquise Brown, though they were on different teams, with Jackson playing for the Pompano Beach Cowboys.[7][6] Jackson's cousin, Oakland Raiders cornerback Trayvon Mullen, and Atlanta Falcons wide receiver Calvin Ridley also competed against Jackson in that league.[8] Growing up, his favorite player was Michael Vick.[1] At age 8, Jackson could throw a football 20 yards according to his first quarterback coach, Van "Peanut" Wilson and while he was in high school a homemade video shows him throwing a football 100 yards.[6][9][10]
High school career Jackson first attended Santaluces Community High School where he played football sporadically and sat out his sophomore year. He then transferred to Boynton Beach High School in Boynton Beach, Florida.[11]
At Boynton Beach, Jackson played two seasons of varsity football. Boynton Beach coach Rick Swain remembered Jackson as a hard worker who continually improved his passing accuracy and decision-making and who watched hours of film each week.[12] In his two years (16 games) at Boynton Beach, Jackson threw for 2,263 yards and 31 touchdowns, ran for 1,624 yards and 22 touchdowns, and a high school career accumulated quarterback rating of 102.7.[13] Jackson's last high school game came against a nationally ranked Miami Central High School team during the first round of the 2014 Florida High School Football Playoff 6A tournament. Boynton Beach was soundly defeated 49-6, with Jackson throwing two interceptions.[14] He also competed for his high school track team, posting a personal record of 11.45 seconds in the 100 meter dash.[15] Jackson was named the Lou Groza Palm Beach County High School Player of the Year in 2014,[16] was rated by Rivals.com as a four-star recruit and had dozens of offers from big college football programs but he committed to the University of Louisville after head coach Bobby Petrino gave his word to Felicia Jones that her son would be playing quarterback and nothing else.[5][17][18][19]
Florida High School 6A career statistics[13]Boynton Beach TigersSeasonGamesPassingRushingGPGSCompAttPctYardsTDIntRateAttYardsAvgTD2013997016342.91,26419693.71029609.410201477539854.1999123116.5906647.412Career161612326147.12,263319102.71921,6248.522College career Freshman year As a freshman at Louisville in 2015, Jackson played in 12 games and made eight starts. He completed 135-of-247 passes for 1,840 yards with 12 touchdowns and eight interceptions and ran for 960 yards and 11 rushing touchdowns.[20] He was named the MVP of the 2015 Music City Bowl after passing for 227 yards with two touchdowns and rushing for a Music City Bowl-record 226 yards and two touchdowns.[21][22]
Sophomore year During the first game of his sophomore year, against the Charlotte 49ers, Jackson set a school record for total touchdowns with eight, all of them in the first half.[23] Against Syracuse, Jackson completed 20 of 39 passes for 411 yards, one touchdown, and one interception, with 199 rushing yards and 4 rushing touchdowns, with all five touchdowns coming in the first half.[24] Against #2 Florida State, Jackson completed 13 of 20 passes for 216 yards, threw one touchdown and one interception, and had 146 rushing yards and 4 rushing touchdowns. He scored 4 of the 5 total touchdowns in the first half. The game made Jackson the Heisman front runner,[25] and gave the Cardinals a No. 3 ranking, their highest since 2006.[26][27] Against Marshall, Jackson completed 24 of 44 passes for 417 yards and 5 touchdowns, and had 62 rushing yards and 2 rushing touchdowns.[28] Against No. 5 Clemson, Louisville's offense totaled 586 yards, with Jackson accounting for 295 passing yards, 162 rushing yards, and three total touchdowns (1 passing, 2 rushing). The Cardinals eventually lost the game 42''36.[29] On December 8, Jackson was awarded the Walter Camp Award as the player of the year and the Maxwell Award as the best all-around player in college football.[30]
On December 10, 2016, Jackson was selected as the 2016 Heisman Trophy winner over fellow finalists Deshaun Watson, Dede Westbrook, Jabrill Peppers, and Baker Mayfield. He became Louisville's first Heisman Trophy winner in school history, and the youngest-ever recipient of the award at the age of 19 years and 337 days.[31][32][33]
Aside from nationally recognized awards, Jackson also won prestigious awards within the University of Louisville. In 2017, Jackson won a Louie for being named the Adidas High Performance Male Athlete of the Year for his outstanding sophomore campaign. He also won a Louie for Play of the Year after the leap he made in the 2016 Syracuse game.[34]
Junior year When Jackson entered the 2017 season, his fan base and media had high expectations of his performance. College GameDay announced their return to the University of Louisville to host the opening matchup on September 16 between the returning National Champions, Clemson Tigers, and the Cardinals. Despite the 47''21 blowout the Tigers achieved,[35] Jackson did not let the numbers affect his playing ability. His remarkable statistics for the season resulted in his being a Heisman finalist for the 2017 season. He finished in third place in the Heisman voting, losing out to Baker Mayfield and Bryce Love.[36] Jackson played in 13 games, finishing with 3,660 passing yards, 27 touchdowns, and 10 interceptions.[37]
Following the 2017''18 school year, Jackson was named the men's ACC Athlete of the Year for all conference sports, sharing honors with women's winner Arike Ogunbowale of Notre Dame basketball.[38]
Collegiate statistics Jackson's career college statistics were as follows:[4]
NCAA collegiate career statisticsLouisville CardinalsSeasonGamesPassingRushingGPGSCompAttPctYardsTDIntRateAttYardsAvgTD201512813524754.71,840128126.81639605.9112016131323040956.23,543309148.82601,5716.0212017131325443059.13,6602710146.62321,6016.918Career38346191,08657.09,0436927142.96554,1326.350Professional career On January 5, 2018, Jackson announced that he would enter the 2018 NFL Draft.[39] Some draft pundits doubted Jackson's quarterback abilities and suggested that he switch positions due to his athleticism, but he remained adamant about his intention to play quarterback professionally. He declined to run drills such as the 40-yard dash during the NFL Scouting Combine, in order to focus on displaying his passing skills.[40]
Jackson was drafted by the Baltimore Ravens in the first round with the 32nd overall pick in the draft; they traded up for the selection with the Philadelphia Eagles.[43][44] He was the fifth quarterback selected that year.[45] On June 5, 2018, Jackson signed his rookie contract, reportedly worth $9.47 million with a $4.97 million signing bonus.[46]
2018 season: Rookie year Jackson made his NFL debut relieving starting quarterback Joe Flacco in the second half of a 47''3 victory against the Buffalo Bills, finishing with 24 passing yards and 39 rushing yards.[47] During Week 7, Jackson scored his first NFL touchdown on a 1-yard run as the Ravens narrowly lost to the New Orleans Saints by a score of 24''23.[48] Jackson threw his first NFL touchdown pass, a 26-yard completion to fellow rookie tight end Hayden Hurst, the next week in relief of Flacco in the fourth quarter of a 36''21 loss to the Carolina Panthers.[49]
Jackson rushing against the Bengals in 2018
On November 18, 2018, Jackson made his first NFL start against the Cincinnati Bengals in place of the injured Joe Flacco, who injured his hip two weeks prior against the Pittsburgh Steelers. Jackson went 13 for 19 for 150 yards and an interception and rushed for 117 yards, which was a Ravens franchise record for rushing yards by a quarterback in a single game in a 24''21 victory.[50] The following week against the Oakland Raiders, Jackson threw for 178 yards, one touchdown, and two interceptions. He also rushed for 71 yards and a rushing touchdown. The Ravens won by a score of 34''17.[51] During Week 13 against the Atlanta Falcons, Jackson passed for 125 yards and rushed for 75 yards and a touchdown in a 26''16 victory.[52] In a Week 14 27''24 overtime loss to the Kansas City Chiefs, Jackson threw two touchdowns for the first time in his career.[53]
Jackson helped the Ravens defeat the Los Angeles Chargers in Week 16, completing 12 of 22 passes for 204 yards and a touchdown in a 22''10 upset victory.[54] The following week against fellow rookie quarterback Baker Mayfield and the Cleveland Browns, Jackson passed for 179 yards and rushed for two touchdowns on 95 rushing yards, despite fumbling a third potential touchdown at the goal line, as the Ravens beat the Browns 26''24 to clinch the AFC North title.[55] In the seven regular season games in which Jackson had started, the Ravens went 6''1 to close out the 2018 season.[56] Overall, he finished with 1,201 passing yards, six passing touchdowns, and three interceptions.[57] In addition, he led all quarterbacks with 695 rushing yards and added five rushing touchdowns.[58]
Postseason Jackson became the youngest quarterback to ever start a playoff game when the Ravens faced off at home against the Chargers in a rematch during the Wild Card Round of the playoffs. Despite being held to just 25 passing yards at one point in the fourth quarter by a stout Chargers defense, Jackson then passed for two touchdowns in four minutes to bring the Ravens back from a 20-point deficit to within a touchdown. After forcing the Chargers to punt with less than a minute left, the Ravens had one last chance to win the game down six points, but Jackson was strip-sacked by Chargers linebacker Uchenna Nwosu. With the Chargers recovering the ball, the Ravens lost 23''17 and were knocked out of the playoffs. He finished the game completing 14 of 29 passes for 194 yards, the two aforementioned touchdowns, and an interception while rushing for 54 yards, losing one fumble.[59]
Once the 2018 season was over, the Ravens's coaching staff decided to abandon the offensive strategy that had been designed for Joe Flacco and create a new offensive philosophy centered around the specific skills of Jackson. That philosophy included changing every play in the playbook, the terminology used and drafting players or acquiring free agents that would complement Jackson's skills.[60]
2019 season: Unanimous NFL MVP In the season-opener against the Miami Dolphins, Jackson went 17 of 20 for career-high 324 yards and five touchdowns, making him the youngest quarterback to achieve a perfect passer rating in the 59''10 road victory. He was named AFC Offensive Player of the Week due to his performance.[61][62] During Week 2 against the Arizona Cardinals, Jackson rushed for 120 yards and threw for 272 yards and two touchdowns, as the Ravens won by a score of 23''17. His two touchdown passes set the Ravens' franchise record for the most touchdown passes in the team's first two games of a season.[63][64] Jackson became the first player in NFL history to pass for more than 250 yards and rush for 120 yards in one game.[65]
During Week 6 against the Cincinnati Bengals, Jackson finished with 236 passing yards, 152 rushing yards, and a rushing touchdown as the Ravens won 23''17. He also became the first player in NFL history to pass for more than 200 yards and rush for 150 yards in a regular-season game,[66] and had more rushing yards than any player at any position in Week 6.[67] During Week 7 against the Seattle Seahawks, Jackson finished with 143 passing yards and 116 rushing yards with a rushing touchdown as the Ravens won 30''16.[68] After a Week 8 bye, the Ravens faced the unbeaten New England Patriots. In that game, Jackson threw for 163 yards and a touchdown and rushed for 61 yards and two touchdowns in the 37''20 victory.[69] For his performance, Jackson earned his second AFC Offensive Player of the Week award.[70]
In the next game, the Ravens routed the Bengals 49''13 with Jackson throwing for 223 yards and three touchdowns and rushing for 65 yards and a touchdown, finishing with a perfect passer rating. He became only the second player in NFL history to produce two perfect passer ratings in the same season.[71] Jackson joined Aaron Rodgers (2019) and Joe Montana (1989) as the only players in the Super Bowl era with 15-plus completions, 3-plus passing touchdowns, 1-plus rushing touchdowns, and a perfect passer rating in a single game.[72] Jackson also earned his third total, and second consecutive, AFC Offensive Player of the Week award, matching his predecessor Joe Flacco's career total.[73]
During Week 11 against the Houston Texans, Jackson became the first quarterback in franchise history to throw four or more touchdowns in a game multiple times during the regular season after he threw for 222 yards and four touchdowns in a 41''7 victory.[74] Jackson also rushed for 86 yards during the victory over the Texans making him the only quarterback in NFL history to rush for more than 60 yards in seven consecutive games.[75] In the next game against the Los Angeles Rams, Jackson threw for 169 yards and five touchdowns in the 45''6 road victory, making him the first player with that many touchdowns in a Monday Night Football debut and the youngest player with multiple five touchdown passing games in NFL history.[76] He earned his fourth AFC Offensive Player of the Week award due to his performance.[77] He was named the AFC's Player of the Month for November.[78] In the next game against the San Francisco 49ers, Jackson finished with 105 passing yards, 101 rushing yards, and two total touchdowns as the Ravens won 20''17,[79] and Jackson became the first quarterback in NFL history with four 100-yard rushing games in a season.[80] In Week 14, in the 24''17 victory over the Buffalo Bills, Jackson became the first quarterback since Michael Vick to rush for 1,000 yards in a single season.[81]
In a nationally televised Thursday Night Football game against the New York Jets in Week 15, Jackson had 212 passing yards for five touchdowns, and eight rushes for 86 yards during the 42''21 win, breaking Vick's single-season rushing record for a quarterback.[1] His five passing touchdowns in the game made him the sixth player since the merger to have three games with at least five passing touchdowns in a season, and tied the Ravens franchise season record with 33.[82][83] After his performance against the Jets, Jackson was named AFC Player of the Week for week 15.[84] In Week 16 against the Cleveland Browns, Jackson was held to 38 passing yards and a lost fumble in the first 28 minutes, before exploding for 142 yards and two touchdowns in the last two minutes before halftime. He added a third touchdown pass in the second half of the 31''15 win, setting the Ravens single season record for touchdown passes at 36,[85] finishing with 238 passing yards and 103 rushing yards.[86] On the day after the Ravens' victory over the Browns, and due to the Ravens' having clinched home-field advantage, head coach John Harbaugh announced that Jackson, guard Marshal Yanda, safety Earl Thomas and defensive tackle Brandon Williams would be inactive for the Week 17 game against the Pittsburgh Steelers.[87] Even without playing in the Ravens final game, Jackson led all quarterbacks with 36 touchdown passes and a QBR of 81.10; he also led all rushers with a 6.9 yards per carry average.[88] During the 2019 season he was also first with 43 total touchdowns and a 9.0 passing touchdown percentage.[89]
Postseason In the Divisional round versus the Tennessee Titans, Jackson and the Ravens were not able to recreate the same success that they had in the regular season, losing 28-12.[90] Jackson finished the game completing 31 of 59 passes for 365 yards, 1 touchdown and 2 interceptions. He also rushed 20 times for 143 yards becoming the first player to throw for 300+ yards and rush for 100+ yards in a playoff game.[91][92] In total, Jackson personally accounted for over 500 yards of offense.
Jackson was the starting quarterback at the 2020 Pro Bowl in Orlando, Florida. He threw for 185 yards and two touchdowns with one interception and was named the offensive Most Valuable Player. He became the youngest quarterback in NFL history to start a Pro Bowl game.[93]
Jackson was voted the MVP of the 2019 season.[3] He became the second player in history after Tom Brady to be voted unanimously[94] and the second-youngest player to win, behind only Jim Brown.[3] Jackson, along with Patrick Mahomes, Cam Newton and Steve McNair, is one of the four African-American quarterbacks to win the AP MVP award.[95]
NFL statistics LegendLed the leagueNFL record for quarterbackAP NFL MVPBoldCareer highRegular season TeamsPassingRushingSeasonTeamGPGSCompAttPctYdsAvgTDIntRateAttYdsAvgTD2018BAL1679917058.21,2017.16384.51476954.752019BAL151526540166.13,1277.8366113.31761,2066.97Career312236457163.74,3287.6429104.73231,9015.912Postseason TeamsPassingRushingSeasonTeamGPGSCompAttPctYdsAvgTDIntRateAttYdsAvgTD2018BAL11142948.31946.72178.89546.002019BAL11315952.53656.21263.2201437.20Career22458851.15596.33368.3291976.80Awards and highlights College Heisman Trophy (2016)Maxwell Award (2016)Walter Camp Award (2016)Associated Press Player of the Year (2016)Sporting News Player of the Year (2016)Unanimous All-American (2016)2— ACC Player of the Year (2016, 2017)2— ACC Offensive Player of the Year (2016, 2017)ACC Athlete of the Year (2018)Total yards: 5261 (2017)[96]Unanimous selection to Louisville Cardinals Team of the Decade (2010-2019)[97]First Louisville Cardinals quarterback named to All-American team: (2016)[98]Most career rushing attempts by a quarterback: 655 (2015-2017)[99]Most career rushing yards: 4132 (2015-2017)[99][100]Most career rushing touchdowns: 50 (2015-2017)[99][100]Most passing touchdowns in a game: 6 (tied with Chris Redman) (2016)[101]NFL NFL Most Valuable Player (2019)[94]5— AFC Offensive Player of the Week (2019: Week 1, Week 9, Week 10, Week 12, Week 15)[102][84]NFL Offensive Rookie of the Month (December 2018)[103]2x AFC Offensive Player of the Month (December 2018)[104] (November 2019)[105]FedEx Air Player of the Year (2019)[106]Pro Bowl (2019)[107]Pro Bowl Offensive MVP (2019)First-team All-Pro (2019) [108]Sporting News Offensive Player of the Year (2019)[109]NFL records First player to throw 30 touchdowns and rush for 1,000 yards in a single season[110]First player to throw for at least 250 yards and rush for at least 120 yards in the same regular-season game: Week 2, 2019[65]First player to throw for at least 200 yards and rush for at least 150 yards in the same regular-season game: Week 6, 2019[111]First player to complete at least 75% of his throws with 12+ touchdown passes over a three-game span[112]First player to rush for 1,000+ yards and pass for 3,000+ yards in a single season[113]First player to rush for 1,500+ yards and pass for 3,000+ yards in his first two seasons[76]First player with 5+ touchdown passes in a Monday Night Football debut[114]First player with four touchdown passes and at least 50 yards rushing in consecutive games [115]First player with at least 2,000 passing yards and 800 rushing yards through a season's first 11 games.[115]First player with 300 passing yards and 100 rush yards in a playoff game.[116]First quarterback to finish a game with a perfect passer rating (minimum 15 attempts), at least 50 yards rushing and one touchdown run[117]First quarterback with five 100-yard rushing games in a season (2019)[118][103]First quarterback with 1,000+ yards rushing and a 100+ passer rating in a season.[119]Most rushing yards by a quarterback in a season: 1,206 (2019)[1][120]Most rushing attempts by a quarterback in a season: 159 (2019)[121]Most rushing yards by a quarterback in a 3-game span: 338 (Week 5''7, 2019)[122]Most consecutive games by a quarterback rushing for more than 60 yards: 8 (Week 4''12, 2019)[115]Most perfect passer ratings in a season (tied with Ben Roethlisberger): 2 (2019)[123]Most games in a season throwing at least 4 touchdowns: 4[103]Most games in a season throwing at least 3 touchdowns: 8[103]Youngest player with multiple five-touchdown-pass games in NFL history: 22 years, 322 days[115]Youngest player to be named Offensive Player of the Week 4 times in one season: 2019[124]Youngest player with 5 touchdown passes in multiple games.[115]Youngest quarterback to ever start a playoff game: 21 years, 364 days (2018 Wild Card Round against the Los Angeles Chargers)[125]Youngest quarterback to achieve a perfect passer rating: 22 years, 244 days (Week 1, 2019)[126]Youngest quarterback to start a Pro Bowl game.[93]Highest touchdown passing percentage (7.4%) in the Super Bowl Era (minimum 500 attempts)[127]Ravens franchise records First player to produce multiple games with at least 4+ touchdown passes: Week 1, Week 11, Week 12, Week 14 2019[128]First player with at least 4 touchdown passes in consecutive games[115]First player to throw 12 touchdown passes over a three-game span[112]First quarterback to start in a Pro Bowl game.[129]Most rushing yards by a quarterback in a game: 152 (Week 6, 2019)Most passing touchdowns in a season: 36 (2019)[85]Most Player of the Week awards by a quarterback: 4 (all 2019)[130]Most pass attempts without an interception: 248[131]Most games with a perfect passer rating: 2[89]Most passing touchdowns in a game: 5 (tied with Joe Flacco and Tony Banks)[89]Most games with 5 passing touchdowns: 3[89]Most touchdown passes in the first (n) games of a season (all 2019):First game: 5First 2 games: 7First 3 games: 7 (tied with Joe Flacco)First 4 games: 10First 5 games: 11First 11 games: 24 (tied with Vinny Testaverde)First 12 games: 25First 13 games: 28First 14 games: 33First 15 games: 36Highest completion percentage in a game: 88.2[89]Highest completion percentage in a season: 66.1 (2019)[132]Highest passer rating in a season: 113.3 (2019)[103]Highest touchdown/pass percentage in a season; 9% (2019)[103]Popular culture Prior to the start of the 2019 NFL season, Jackson appeared on ABC's Celebrity Family Feud, pitting current NFL players against former NFL players.[133][134] Jackson's athletic abilities were featured in GEICO and Pizza Hut commercials which aired during the 2019 season.[135][136][137] During week 12 of the 2019 NFL season, the makers of Madden NFL, a video game series that has sold more than 130 million copies, announced that Jackson's character speed would be upgraded from 94 to 96, making Jackson the fastest quarterback in that game's history.[138][139] In 2018, Jackson announced the launch of his sportswear line, "Era 8 Apparel".[140][141]
On Cyber Monday 2019, major sportswear retailer Fanatics announced that its Lamar Jackson sportswear outsold every other professional athlete's sportswear.[142] That same week, Pope Francis was gifted a Lamar Jackson Ravens jersey.[143]
In December 2019, Academy Award winning actor Al Pacino, who starred in the football themed movie Any Given Sunday, said:[144][145]
I watch this guy Lamar Jackson. There are occasionally these players that are inspiring because you can see the game that they play is a game, and you can actually sense the joy they have in what they do. That's inspiring. Watching Lamar Jackson is an inspiration to actors.
Personal life As of 2019[update], Jackson lives in Owings Mills, Maryland, about 20 minutes from the Ravens training complex with his mother, brother, and sisters.[146] Jackson is a Christian.[147] Jackson's pre-game meal is shrimp alfredo pasta and his favorite superhero is Superman.[148]
See also List of NCAA major college football yearly total offense leadersList of NCAA Division I FBS career rushing touchdowns leadersReferences ^ a b c d Mink, Ryan. "Michael Vick's Quarterback Rushing Record". baltimoreravens.com. Baltimore Ravens . Retrieved December 13, 2019 . ^ Schiller, Joe. "Late for Work 12/30: Ravens Finish Regular Season in Style vs. Steelers". baltimoreravens.com. Baltimore Ravens . Retrieved December 30, 2019 . ^ a b c Jamison, Hensley. "Ravens QB Lamar Jackson unanimous pick for NFL MVP after historic season". ESPN . Retrieved February 2, 2020 . ^ a b "Lamar Jackson". ESPN.com . Retrieved April 6, 2019 . ^ a b Rosenberg, Todd. "Lamar Jackson, His Mother, and the Plan They've Always Had". si.com. Sports Illustrated . Retrieved November 28, 2019 . ^ a b c Walker, Childs. "How Lamar Jackson used more than talent to rise from the fields of South Florida: 'He continued to work ' ". baltimoresun.com. Baltimore Sun . Retrieved November 28, 2019 . ^ "Marquise Brown" (PDF) . Baltimoreravens.com. Baltimore Ravens . Retrieved September 11, 2019 . ^ "8 Lamar Jackson weekly bio update" (PDF) . baltimoreravens.com. Baltimore Ravens . Retrieved November 29, 2019 . ^ "Do You Believe the Legend of Lamar Jackson's 100-Yard Throw?". YouTube. Baltimore Ravens . Retrieved November 28, 2019 . ^ "Louisville Quarterback Lamar Jackson Once Threw a Football 100 Yards, and Here's the Video to Prove it". stack.com. Stack Sports . Retrieved November 28, 2019 . ^ Richardson, Shandel (April 24, 2018). "Former Boynton Beach quarterback Lamar Jackson out to silence NFL doubters". Sun-Sentinel.com . Retrieved October 29, 2018 . ^ Jones, Steve. "4-star QB Lamar Jackson picks U of L". courier-journal.com. USA Today Network . Retrieved December 1, 2019 . ^ a b "Lamar Jackson's Football Stats". Max Preps . Retrieved November 21, 2016 . ^ Furones, David. "Miami Central near perfect against Boynton Beach". miamiherald.com. Miami Herald . Retrieved November 28, 2019 . ^ "Lamar Jackson". Athletic.net . Retrieved May 31, 2019 . ^ Dusenbury, Wells. "Boynton Beach High alum Lamar Jackson makes NFL history with electric performance". sun-sentinel.com. South Florida Sun-Sentinel . Retrieved February 3, 2020 . ^ "Lamar Jackson, 2015 Dual-threat quarterback". Rivals.com . Retrieved December 11, 2016 . ^ Jones, Steve (August 30, 2014). "Four-star Florida QB Lamar Jackson picks Louisville". Courier-Journal . Retrieved December 11, 2016 . ^ Dorsey, Steve (February 4, 2015). "Gator bait? QB Lamar Jackson fakes Florida, goes Louisville". Sun Sentinel . Retrieved December 11, 2016 . ^ Adelson, Andrea (January 14, 2016). "Behind Lamar Jackson, expectations rising at Louisville". ESPN.com . Retrieved December 11, 2016 . ^ Fornelli, Tom (December 30, 2015). "Lamar Jackson introduces himself to the world in Music City Bowl win". CBS Sports . Retrieved December 11, 2016 . ^ Clements, Ron (December 31, 2015). "Music City Monster: Louisville's Lamar Jackson unstoppable against Texas A&M". Sporting News . Retrieved December 11, 2016 . ^ Easterling, Luke (September 2, 2016). "Watch Louisville's Lamar Jackson score eight first-half touchdowns". USA Today . Retrieved October 29, 2018 . ^ Kekis, John (September 10, 2016). "Jackson leads No. 13 Louisville past Syracuse, 62''28". AP NEWS . Retrieved October 29, 2018 . ^ Culpepper, Chuck (December 10, 2016). "Lamar Jackson's Heisman Trophy triumph a story over 20 years in the making". The Washington Post . Retrieved December 12, 2016 . ^ Goodbread, Chase (September 17, 2016). "Lamar Jackson accounts for five TDs in 63''20 rout of FSU". NFL.com . Retrieved October 29, 2018 . ^ "Louisville Cardinals AP Poll History". College Football at Sports-Reference.com . Retrieved October 29, 2018 . ^ Parr, Dan. "Louisville's Lamar Jackson scores 7 TDs in rout of Marshall". NFL.com . Retrieved October 29, 2018 . ^ Patterson, Chip. "Clemson shows it still has guts in surviving epic performance from Lamar Jackson". CBSSports.com . Retrieved October 29, 2018 . ^ "Louisville QB Lamar Jackson wins Camp, Maxwell awards". The Boston Globe. December 9, 2016 . Retrieved December 10, 2016 . ^ Martin, Jill; Almasy, Steve. "Louisville's Lamar Jackson wins Heisman". CNN.com . Retrieved December 11, 2016 . ^ "Lamar Jackson 2016". heisman.com. Heisman Trust . Retrieved December 10, 2019 . ^ Willis, Zack. "The 5 Youngest Heisman Trophy Winners Reveal Growing Trend". sportscasting.com. EndGame360 . Retrieved December 10, 2019 . ^ Jones, Steve. "Lamar Jackson a big winner at U of L 'Louie' awards". The Courier-Journal . Retrieved October 29, 2018 . ^ "No. 3 Clemson blows out Jackson and No. 14 Louisville, 47''21". ESPN.com. Associated Press . Retrieved January 29, 2018 . ^ "2017 Heisman Trophy Voting". College Football at Sports-Reference.com . Retrieved October 29, 2018 . ^ Yang, Nicole (April 23, 2018). "Patriots are reportedly 'intrigued and impressed' after hosting Lamar Jackson". BostonGlobe.com . Retrieved October 29, 2018 . ^ "Louisville's Jackson, Notre Dame's Ogunbowale Voted ACC Athletes of the Year" (Press release). Atlantic Coast Conference. July 5, 2018 . Retrieved July 6, 2018 . ^ "Louisville QB Lamar Jackson intends to enter 2018 NFL Draft". NFL . Retrieved January 5, 2018 . ^ Bell, Jarrett (March 2, 2018). "It's insulting to suggest Louisville quarterback Lamar Jackson should switch to wide receiver". USA Today Sports . Retrieved December 27, 2018 . ^ "NFL Draft Prospect Profile '' Lamar Jackson". nfl.com. March 1, 2018 . Retrieved March 1, 2018 . ^ "Louisville QB Lamar Jackson : 2018 NFL Draft Scout Player Profile". NFLDraftScout.com . Retrieved May 12, 2018 . ^ Wesseling, Chris (April 26, 2018). "Ravens trade up to take Lamar Jackson at No. 32". NFL.com. ^ "Vegas odds against Lamar Jackson starting for Ravens in 2018". NBC Sports Washington. May 14, 2018 . Retrieved May 30, 2018 . ^ "2018 NFL Draft Listing". Pro-Football-Reference.com . Retrieved February 1, 2019 . ^ Patra, Kevin. "Lamar Jackson signs rookie contract with Ravens". nfl.com. National Football League . Retrieved December 10, 2019 . ^ Lourim, Jake (September 9, 2018). "Lamar Jackson plays plenty in NFL debut as Baltimore Ravens win big". The Courier-Journal . Retrieved October 1, 2018 . ^ Jones, Kaelen (October 21, 2018). "Ravens' Lamar Jackson Scores First Career TD vs. Saints". Sports Illustrated . Retrieved October 25, 2018 . ^ Oestreicher, Kevin (October 28, 2018). "Watch: QB Lamar Jackson throws 1st NFL touchdown pass". Ravens Wire. USAToday.com . Retrieved October 28, 2018 . ^ Hudson, Jamar (November 18, 2018). "Lamar Jackson has 117 rushing yards in win". NBC Sports Washington . Retrieved November 30, 2018 . ^ Ginsburg, David (November 25, 2018). "Lamar Jackson, Gus Edwards and Baltimore Ravens run over Oakland Raiders". The Denver Post . Retrieved November 30, 2018 . ^ Conway, Tyler (December 2, 2018). "Lamar Jackson Remains Undefeated as Starter as Ravens Beat Falcons 26''16". Bleacher Report . Retrieved December 11, 2018 . ^ Shaffer, Jonas (December 9, 2018). "Instant analysis: Ravens fall apart late, fade in overtime of wild 27''24 loss to Chiefs". baltimoresun.com . Retrieved December 11, 2018 . ^ "Lamar Jackson leads Ravens to 22''10 victory over Chargers". The Associated Press. Sports Illustrated. December 23, 2018 . Retrieved December 31, 2018 . ^ Wagner-McGough, Sean (December 30, 2018). "Browns vs. Ravens final score, takeaways: Baltimore holds off Baker Mayfield's final charge to win AFC North". CBS Sports . Retrieved December 31, 2018 . ^ Hensley, Jamison (December 31, 2018). "Lamar Jackson leads Ravens to first postseason berth since 2014". ESPN.com . Retrieved September 19, 2019 . ^ "2018 NFL Passing". Pro-Football-Reference.com . Retrieved January 23, 2019 . ^ "2018 NFL Rushing". Pro-Football-Reference.com . Retrieved January 23, 2019 . ^ Shaffer, Jonas (January 6, 2019). "At the end of a breakthrough rookie season, quarterback Lamar Jackson leaves Ravens needing more". The Baltimore Sun . Retrieved September 19, 2019 . ^ Kilgore, Adam. "The Ravens are all-in on Lamar Jackson, and their remade offense proves it". washingtonpost.com. Washington Post . Retrieved November 29, 2019 . ^ "Watch Baltimore Ravens vs. Miami Dolphins [09/08/2019] including a live Drive Chart and real-time highlights". NFL.com . Retrieved September 8, 2019 . ^ "Lamar Jackson, Dak Prescott among Players of the Week". NFL.com. September 11, 2019 . Retrieved September 19, 2019 . ^ Hensley, Jamison (September 15, 2019). "Ravens' Jackson sets team record with 7th TD". ESPN.com. ESPN . Retrieved September 15, 2019 . ^ "Cardinals v Ravens". nfl.com. National Football League . Retrieved September 15, 2019 . ^ a b Platko, Frank J. (September 16, 2019). "Ravens vs. Cardinals: By the numbers". Baltimore Beatdown. SB Nation . Retrieved September 16, 2019 . ^ Patra, Kevin (October 14, 2019). "Lamar Jackson sets records in dual-threat performance". NFL.com . Retrieved October 14, 2019 . ^ "2019 Week 6 Leaders". ^ "Jackson's legs, Ravens defense roll past Seahawks 30''16". www.espn.com. Associated Press. October 20, 2019 . Retrieved October 20, 2019 . ^ "Unbeaten no more, Patriots fall to Jackson and Ravens 37''20". www.espn.com. Associated Press. November 3, 2019 . Retrieved November 3, 2019 . ^ "Lamar Jackson, Russell Wilson among Players of the Week". NFL.com. November 6, 2019 . Retrieved November 9, 2019 . ^ Hensley, Jamison. "Lamar Jackson joins elite club with perfect passer rating". ESPN.com . Retrieved November 11, 2019 . ^ Patra, Kevin (November 11, 2019). "Lamar Jackson adds signature moment to MVP resume". NFL.com . Retrieved November 20, 2019 . ^ Alper, Josh (November 13, 2019). "Lamar Jackson takes second straight AFC offensive player of the week". ProFootballTalk . Retrieved November 13, 2019 . ^ Purdum, David (November 18, 2019). "Ravens QB Lamar Jackson favored by Las Vegas to win MVP". ESPN.com . Retrieved November 18, 2019 . ^ Reed, Jesse. "LAMAR JACKSON MAKES NFL HISTORY SURPASSING MICHAEL VICK IN RECORD BOOKS". sportsnaut.com. SPORTSNAUT, LLC . Retrieved November 20, 2019 . ^ a b Hensley, Jamison. "Lamar Jackson throws 5 TDs, rushes for 95 yards in 45''6 rout vs. Rams". espn.com. ESPN . Retrieved November 26, 2019 . ^ Gordon, Grant. "Lamar Jackson, Chris Godwin among players of the week". nfl.com. The National Football League . Retrieved November 27, 2019 . ^ Gordon, Grant (December 5, 2019). "Lamar Jackson among Players of the Month for Nov". NFL.com. The National Football League . Retrieved December 5, 2019 . ^ Shpigel, Ben (December 1, 2019). "Ravens Outlast 49ers With a Strong Finishing Kick". The New York Times . Retrieved December 11, 2019 . ^ "100-yard QB rushers, by season". Pro-Football-Reference.com. ^ "Baltimore Ravens' Lamar Jackson hits 1,000 rushing yards, but Bills stay close". PennLive. December 8, 2019 . Retrieved December 11, 2019 . ^ "New York Jets at Baltimore Ravens - December 12th, 2019". Pro-Football-Reference.com. ^ "Lamar Jackson has another five touchdown game as Baltimore rolls". CBSSports.com . Retrieved December 14, 2019 . ^ a b Bergman, Jeremy. "Lamar Jackson, Drew Brees among Players of the Week". nfl.com. National Football League . Retrieved December 18, 2019 . ^ a b Hensley, Jamison. "Lamar Jackson sets TD record as Ravens get No. 1 seed". eson.com. ESPN . Retrieved December 22, 2019 . ^ "Ravens vs. Browns - Play-By-Play - December 22, 2019 - ESPN". ESPN.com. ^ Shaffer, Jonas. "Lamar Jackson, three other Ravens starters will sit out regular-season finale vs. Steelers". baltimoresun.com. Baltimore Sun . Retrieved December 24, 2019 . ^ "2019 NFL Leaders and Leaderboards". pro-football-reference.com. Pro Football Reference . Retrieved December 31, 2019 . ^ a b c d e "8 Lamar Jackson Bio" (PDF) . baltimoreravens.com. Baltimore Ravens . Retrieved November 29, 2019 . ^ "Baltimore Ravens vs. Tennessee Titans 2019 Postseason". espn.com. ESPN . Retrieved January 11, 2020 . ^ "Titans stun Ravens, head to AFC title game with 28-12 win". www.espn.com. Associated Press. January 11, 2020 . Retrieved January 11, 2020 . ^ Mink, Ryan (January 12, 2020). "Lamar Jackson Shakes Off Haters After Another Playoff Loss". BaltimoreRavens.com. Baltimore Ravens . Retrieved January 12, 2020 . ^ a b DiRocco, Michael. "Ravens' Lamar Jackson named Offensive MVP at Pro Bowl". espn.com. ESPN . Retrieved January 27, 2020 . ^ a b |title=Baltimore Ravens QB Lamar Jackson named 2019 NFL MVPsportsnet.ca. Sportsnet https://www.sportsnet.ca/football/nfl/baltimore-ravens-qb-lamar-jackson-named-2019-nfl-mvp/ . Retrieved February 1, 2020 . Cite error: The named reference "2019nflmvp" was defined multiple times with different content (see the help page). ^ "MVP Patrick Mahomes is now part of the legendary black quarterback fraternity". TheUndefeated.com. ^ "2017 College Football Leaders". sports-reference.com. Sports Reference College Football . Retrieved January 27, 2020 . ^ Rutherford, Mike. "Louisville Football team of the decade headlined by Lamar Jackson". cardchronicle.com. CardChronicle SB Nation . Retrieved December 26, 2019 . ^ "Louisville Cardinals All-America Selections". sports-reference.com/. Sports Reference . Retrieved January 27, 2020 . ^ a b c "Louisville Cardinals Passing". sports-reference.com. Sports Reference . Retrieved January 27, 2020 . ^ a b "Louisville Cardinals Rushing". sports-reference.com. Sports Reference . Retrieved January 27, 2020 . ^ "Lamar Jackson accounts for 8 TDs as Louisville routs Charlotte". ESPN.com. September 1, 2016. ^ Brwon, Clifton (November 13, 2019). "Lamar Jackson Wins Back-to-Back AFC Offensive Player of the Week". Baltimore Ravens . Retrieved November 13, 2019 . ^ a b c d e f "8 Lamar Jackson" (PDF) . baltimoreravens.com. Baltimore Ravens . Retrieved December 26, 2019 . ^ "ALL-TIME AP HONORS" (PDF) . baltimoreravens.com. Baltimore Ravens . Retrieved February 3, 2020 . ^ Gordon, Grant. "Lamar Jackson among Players of the Month for Nov". nfl.com. The National Football League . Retrieved December 5, 2019 . ^ "WINNERS: JACKSON & HENRY". nfl.com. The National Football League . Retrieved February 2, 2020 . ^ "NFL reveals rosters for 2020 Pro Bowl in Orlando". nfl.com. National Football League . Retrieved December 18, 2019 . ^ "2019 AP NFL All-Pro team rosters and voting". apnews.com. Associated Press . Retrieved January 3, 2020 . ^ "NFL awards: Resurgent 49ers dominate voting for Sporting News' 2019 honors". sportingnews.com. Sporting News . Retrieved February 5, 2020 . ^ "Lamar Jackson Broke Another Record And He's The 1st One To Do This In The NFL". baltimore.cbslocal.com. CBS Baltimore wjz-tv . Retrieved December 19, 2019 . ^ Patra, Kevin (October 14, 2019). "Lamar Jackson sets records in dual-threat performance". NFL.com . Retrieved October 14, 2019 . ^ a b Baltimore Sun Staff. "Lamar Jackson watch: The most mind-boggling stats from Ravens QB's historic start to career". baltimoresun.com. Baltimore Sun . Retrieved November 28, 2019 . ^ "NFL Week 15 early odds: Ravens open as fourth-largest favorite in team history, Steelers favored over Bills". cbssports.com. CBS Sports . Retrieved December 10, 2019 . ^ "L. Jackson passes Vick as Madden's fastest QB". ESPN.com. November 27, 2019 . Retrieved November 27, 2019 . ^ a b c d e f Mink, Ryan. "17 Records, Feats, Benchmarks Lamar Jackson and the Ravens Hit on MNF". baltimoreravens.com. Baltimore Ravens . Retrieved November 27, 2019 . ^ Mink, Ryan (January 12, 2020). "Lamar Jackson Shakes Off Haters After Another Playoff Loss". BaltimoreRavens.com. Baltimore Ravens . Retrieved January 18, 2020 . ^ Hensley, Jamison (November 10, 2019). "Jackson joins elite club with perfect passer rating". ESPN.com . Retrieved November 20, 2019 . ^ "Jackson, Ravens beat 49ers 20-17 to extend win streak to 8". ESPN.com. Associated Press. December 1, 2019 . Retrieved December 2, 2019 . ^ Hensley, Jamison. "Is Lamar Jackson putting up the best season ever at quarterback?". espn.com. ESPN . Retrieved January 6, 2020 . ^ Hensley, Jamison (December 12, 2019). "Ravens QB Lamar Jackson breaks Michael Vick's single-season rushing yards record". espn.com. ESPN . Retrieved December 13, 2019 . ^ Kasinitz, Aaron (September 8, 2019). " ' Not bad for a running back': Ravens' Lamar Jackson sends message to critics, preps for more scrutiny". PennLive . Retrieved October 1, 2019 . ^ "Lamar Jackson: Game Logs at NFL.com". www.nfl.com . Retrieved October 23, 2019 . ^ "Lamar Jackson 2019 Game Log". Pro-Football-Reference.com. November 18, 2019 . Retrieved November 11, 2019 . ^ Hensley, Jamison (November 26, 2019). "Ravens' Lamar Jackson passes Michael Vick as Madden's fastest QB". espn.com. ESPN . Retrieved November 27, 2019 . ^ Patra, Kevin (January 3, 2019). "Lamar Jackson will be youngest QB to start in playoffs" . Retrieved November 26, 2019 . ^ Kerr, Jeff (September 9, 2019). "Lamar Jackson joined an elite group of Super Bowl winning quarterbacks with Week 1 performance". CBSSports.com . Retrieved October 1, 2019 . ^ "For combined seasons, from 1970 to 2019". pro-football reference.com. Pro Football Reference . Retrieved January 27, 2020 . ^ Hensley, Jamison (November 17, 2019). "Jackson first Raven with multiple 4-TD games". ESPN.com . Retrieved November 20, 2019 . ^ "Baltimore Ravens All-Pros and Pro Bowlers". pro-football-reference.com. Pro Football Reference . Retrieved January 27, 2020 . ^ "NFL Players of the Week". Pro-Football-Reference.com . Retrieved January 1, 2020 . ^ Branch, Erick (November 28, 2019). "49ers know they've never seen anyone like Ravens QB Lamar Jackson". sfchronicle.com. San Francisco Chronicle . Retrieved November 28, 2019 . ^ "Baltimore Ravens Single-Season Passing Leaders". pro-football-reference.com. Pro Football Reference . Retrieved February 3, 2020 . ^ Shaffer, Jonas (February 26, 2019). "Ravens quarterback Lamar Jackson to appear on 'Celebrity Family Feud ' ". Baltimore Sun . Retrieved November 27, 2019 . ^ Mink, Ryan (July 15, 2019). "The Caw: Recapping Lamar Jackson's Performance on 'Celebrity Family Feud ' ". baltimoreravens.com. Baltimore Ravens . Retrieved November 27, 2019 . ^ "Pizza Hut TV Commercial, 'Hut of the Week: Ravens v. Texans ' ". iSpot.tv. 2019 iSpot.tv, Inc . Retrieved November 28, 2019 . ^ "GEICO TV Commercial, 'Play of the Day: Lamar Jackson". iSpot.tv. 2019 iSpot.tv, Inc . Retrieved November 28, 2019 . ^ "GEICO Play of the Day". tvcommercialad.com . Retrieved November 28, 2019 . ^ Reyes, Lorenzo (November 27, 2019). "Ravens' Lamar Jackson surpasses Michael Vick as fastest QB in Madden history". usatoday.com. USA Today . Retrieved November 28, 2019 . ^ Schapiro, Michael (November 26, 2019). "Lamar Jackson Passes Michael Vick as Fastest QB in Madden History". si.com. Sports Illustrated . Retrieved November 28, 2019 . ^ "Nike? Under Armour? As Ravens QB Lamar Jackson's star rises, marketers wonder if and where he'll sign". pennlive.com. PA Media group. November 25, 2019 . Retrieved November 29, 2019 . ^ "8 Lamar Jackson" (PDF) . baltimoreravens.com. Baltimore Ravens . Retrieved November 29, 2019 . ^ DeArdo, Bryan (December 4, 2019). "Lamar Jackson merchandise reportedly outsells all athletes on Cyber Monday, but Tom Brady jerseys still reign". cbssports.com. CBS Sports . Retrieved December 5, 2019 . ^ Hensley, Jamison (December 4, 2019). "Pope Francis gifted custom Ravens jersey signed by Lamar Jackson". espn.com. ESPN . Retrieved December 5, 2019 . ^ Kring-Schreifels, Jake (December 19, 2019). "Football Is a Dark Place": The Oral History of 'Any Given Sunday ' ". theringer.com. The Ringer . Retrieved December 20, 2019 . ^ Kalland, Robby (December 19, 2019). "Al Pacino Looks At Lamar Jackson As An 'Inspiration ' ". uproxx.com. Uproxx . Retrieved December 20, 2019 . ^ Miller, Hallie (December 1, 2019). "You've heard about Lamar Jackson, the star Ravens QB. Here's what we know about Lamar Jackson, the person". Baltimore Sun . Retrieved December 10, 2019 . ^ Ackerman, Jon (December 19, 2019). "Baltimore Ravens QB Lamar Jackson on who keeps him humble: 'The Lord ' ". Sports Spectrum . Retrieved December 22, 2019 . ^ "LAMAR JACKSON" (PDF) . baltimoreravens.com. Baltimore Ravens . Retrieved February 2, 2020 . External links Lamar Jackson on TwitterBaltimore Ravens bioLouisville Cardinals bioLamar Jackson at the Heisman Trophy official websiteLamar Jackson'--awards and honors
Iowa Caucus App Developer Was Deeply Embedded in Democratic Establishment
Wed, 05 Feb 2020 18:22
Democratic operative Tara McGowan is denying that her high-profile liberal firm ACRONYM played a role in the Monday evening caucus debacle, claiming that her firm was merely an investor in the company Shadow Inc., which developed the app at the center of the controversy. But internal company documents, a source close to the firms, and public records show a close and intertwined relationship between Acronym and Shadow.
In addition, ahead of the caucuses, questions swirled inside Shadow over the company's ability to deliver a quality product, and there was concern from at least one staff member that senior leaders of Shadow and Acronym '-- both of which were launched as a new Democratic bulwark against President Donald Trump '-- have been far from neutral in the Democratic primary.
Throughout the caucus yesterday, Democratic officials reported widespread problems downloading the app and inconsistencies uploading caucus results, leading to the Iowa Democratic Party's decision to take the unusual step of delaying the release of the results. This is the first year the app was used, and ahead of the caucuses, the Iowa Democratic Party asked that the app's name be kept secret. The New York Times reported that ''its creators had repeatedly questioned the need to keep it secret.''
Kyle Tharp, a spokesperson for Acronym, released a statement on Monday night downplaying his company's affiliation with Shadow.
''ACRONYM is an investor in several for-profit companies across the progressive media and technology sectors,'' Tharp said. ''One of those independent, for-profit companies is Shadow, Inc, which also has other private investors.''
David Plouffe, a former campaign manager to Barack Obama's 2008 presidential bid who joined Acronym's board, also distanced himself from the company during an MSNBC panel last night. ''I have no knowledge of Shadow,'' said Plouffe. ''It was news to me.''
But previous statements and internal Acronym documents suggest that the two companies, which share office space in Denver, Colorado, are deeply intertwined.
Last year, McGowan, a co-founder of Acronym, wrote on Twitter that she was ''so excited to announce @anotheracronym has acquired Groundbase,'' a firm that included ''their incredible team led by [Gerard Niemira] + are launching Shadow, a new tech company to build smarter infrastructure for campaigns.'' McGowan also noted that ''With Shadow, we're building a new model incentivized by adoption over growth.'' The acquisition was announced in mid-January of last year.
In an interview on a related podcast last month, McGowan described Niemira as ''the CEO of Shadow, which is the technology company that Acronym is the sole investor in now.''
What's more, internal documents from Acronym show a close relationship with Shadow. An internal organizational chart shows digital strategy firm Lockwood Strategy, FWIW Media, and Shadow as part of a unified structure, with Acronym staff involved in the trio's operations.
In an all-staff email sent last Friday, an official with Lockwood Strategy reminded team members about ''COOL THINGS HAPPENING AROUND ACRONYM.'' The list included bullets points such as, ''The Iowa caucus is on Monday, and the Shadow team is hard at work,'' and ''Shadow is working on scaling up VAN integration with Shadow Messaging for some Iowa caucus clients.'' (VAN refers to the widely used Democratic voter file technology firm.) Acronym staffers also attended the Shadow staff retreat.
A person with knowledge of the company's culture, who asked to remain anonymous for fear of reprisal, shared communications showing that top officials at the company regularly expressed hostility to Sen. Bernie Sanders's supporters. McGowan is married to Michael Halle, a senior strategist with the Buttigieg campaign. There is no evidence any preference of candidates had any effect on the coding issue that is stalling the Iowa results.
The Iowa Democratic Party and the Nevada Democratic Party retained Shadow to develop its caucus app. Shadow has also been retained for digital services by Buttigieg's and Biden's campaigns.
Acronym launched with a promise to compete with the Trump campaign's strong emphasis on digital media, launching Democratic messages through paid advertisements on Facebook and other platforms. But the source said the company in many ways was woefully unprepared for the many challenges it had taken on, including the Iowa caucus app.
A precinct captain for Sanders, who requested anonymity because they were not authorized to talk to the press, confirmed that the rollout was rushed. ''We didn't know about the app until like a month ago. And we didn't have access to the app until like three days ago,'' the source said.
''This app has never been used in any real election or tested at a statewide scale and it's only been contemplated for use for two months now,'' David Jefferson, who also serves on the board of Verified Voting, a nonpartisan election integrity organization, told the New York Times.
Federal campaign finance records show that the Iowa Democratic Party and the Nevada Democratic Party retained Shadow to develop its caucus app. Shadow has also been retained for digital services by Buttigieg's campaign, which paid the company $42,500 for software-related services last July, and by Joe Biden's campaign, which paid Shadow $1,225 for text messaging services, last July as well.
Shadow was launched by former staffers to Hillary Clinton's 2016 presidential campaign, including Niemira, Krista Davis, Ahna Rao, and James Hickey, according to professional biographies listed on LinkedIn. Shadow did not respond to a request for comment.
Acronym, which includes a hybrid model of a 501(c)4 entity that does not disclose donors and a Super PAC that does, has been a favorite for deep-pocketed Democratic donors. Donald Sussman, the founder of Paloma Partners, and Michael Moritz, a partner at Sequoia Capital, each donated $1 million to Acronym last year. Filmmaker Steven Spielberg gave $500,000. Investor Seth Klarman, once a major donor to Republican causes, gave $1.5 million to Acronym.
Acronym appears to have deleted portions of its website showcasing its involvement in Shadow. ''ACRONYM is thrilled to announce the launch of Shadow, a new technology company that will exist under the ACRONYM umbrella and build accessible technological infrastructure and tools to enable campaigns to better harness, integrate and manage data across the platforms and technologies they all use,'' wrote Niemira in a now-deleted blog post.
This morning, William McCurdy II, the chair of the Nevada Democratic Party, released a statement announcing that the party will not be using the Shadow app for its February caucus.
''NV Dems can confidently say that what happened in the Iowa caucus last night will not happen in Nevada on February 22nd. We will not be employing the same app or vendor used in the Iowa caucus,'' said McCurdy. ''We had already developed a series of backups and redundant reporting systems, and are currently evaluating the best path forward.''
Spotify to Acquire Bill Simmons' The Ringer to Expand Podcast Business | Hollywood Reporter
Wed, 05 Feb 2020 14:12
TECH4:17 AM PST 2/5/2020 by Natalie Jarvey
Spotify spent around $400 million in 2019 to acquire podcast companies Gimlet, Parcast and Anchor.Spotify is bulking up its podcasting business with a definitive deal to acquire Bill Simmons' The Ringer, which will add a robust slate of sports and pop culture audio shows to its growing podcasting portfolio.
Terms of the deal for the four-year-old The Ringer were not disclosed. Spotify said it expects the deal, designed to boost its sports vertical, to close in the first quarter.
"With this acquisition, Spotify continues to deliver against its goal to become the world's leading audio platform," the company said. "We look forward to putting the full power of Spotify behind The Ringer as they drive our global sports strategy."
In a call with investors on Wednesday morning, Spotify CEO Daniel Ek said, "I think we bought the next ESPN" and described The Ringer's audience as "highly loyal."
The purchase gives Spotify, which ended 2019 with 124 million paid subscribers and 271 million total active monthly users, ownership of culture website The Ringer as well as a 30-plus podcast network that includes shows on sports (flagship The Bill Simmons Podcast, The Ringer NBA Show), food (The Dave Chang Show, House of Carbs) and entertainment (The Watch, Binge Mode). The largely unscripted, chat-style shows will serve as a complement to the highly produced scripted and narrative nonfiction podcasts that Spotify already owns through its 2019 acquisitions of Gimlet and Parcast. The Ringer also has production shingle Ringer Films through which Simmons produces documentaries like Andre the Giant for HBO.
All 90 Ringer employees are expected to join Spotify and the website will continue to operate. At this time, Spotify doesn't plan to change the exclusivity of The Ringer's podcasts and shows it makes for other podcast providers, including subscription service Luminary, will continue on those platforms.
"As we set out to expand our sports and entertainment offerings, we wanted a best-in-class editorial team," Spotify content chief Dawn Ostroff said in a statement. "Bill Simmons is one of the brightest minds in the game and he has successfully innovated as a writer and content creator across mediums and platforms. The Ringer's proven track record of creating distinctive cultural content as well as discovering and developing top-tier talent will make them a formidable asset for Spotify."
Added Simmons: "Spotify has the unique ability to truly supercharge both content and creator talent across genres. We spent the last few years building a world-class sports and pop culture multimedia digital company and believe Spotify can take us to another level. We couldn't be more excited to unlock Spotify's power of scale and discovery, introduce The Ringer to a new global audience and build the world's flagship sports audio network."
Spotify sees podcasts as a way to expand beyond its music roots. The company spent around $400 million to acquire three podcast companies last year and announced, via a February 2019 letter from CEO Daniel Ek, that ''audio '-- not just music '-- would be the future of Spotify.''
Since then, the company, under the leadership of Ostroff, has invested in its internal podcast operations, hiring television veterans like Liz Gateley to build out a pipeline of original shows from such talent as Kevin Bacon, Jordan Peele, Paul Feig and Mark Wahlberg. It also has inked deals to make several podcasts, including comedy series Last Podcast on the Left, exclusive to its platform.
The investment has paid off. Podcast consumption hours were up 200 percent year-over-year during the final three months of 2019, the company also revealed Wednesday. The company said podcasts were helping drive increased overall engagement and retention to its product. More than 16 percent of Spotify's monthly active users now engage with podcast content.
The Ringer was among those making an exclusive show for Spotify. Daily shortform series The Ringer's Hottest Take has been streaming on Spotify since September. The companies then began talking about deepening their partnership via a sale. Negotiations ultimately came down to the eleventh hour heading into Spotify's fourth quarter earnings on the morning of Feb. 5.
Simmons launched The Ringer in 2016 with backing from HBO after he left ESPN, where he started the website Grantland.
Georg Szalai in London contributed to this report.
6 a.m. Updated with additional information from Spotify's earnings call with investors.
Educational Redlining? The use of education data in underwriting could leave HBCU and MSI graduates in the dark - Student Borrower Protection Center
Wed, 05 Feb 2020 10:52
The use of education data in underwriting could leave HBCU and MSI graduates in the dark By Aryn Bussey | July 24, 2019
Access to credit can open doors to economic opportunity and determine consumers' ability to own a home, start a small business, or even purchase a vehicle. Millions of people, however, are shut out of today's credit system and the opportunities that come with it'--particularly borrowers of color. According to the Federal Reserve, Black and Hispanic consumers within every income bracket are more likely than their white peers to be denied credit or offered less credit than requested. For years, policymakers have weighed the use of alternative data like cell phone or utility payment history to help expand marginalized communities' access to credit.
Tomorrow, the House Financial Services Committee's Fintech Task Force is holding a hearing on the use of alternative data to expand access to credit. It is critical that the Committee examine what I believe is a dangerous and discriminatory trend'--the use of education data for determining creditworthiness under the guise of ''innovation.''
Recently, financial services companies have begun to explore using education data for determining creditworthiness. Education data like the type of institution attended, a student's area of study, a school's average SAT score, or even whether an applicant's parents completed college have been proposed, and even used, to determine credit eligibility and pricing. The use of this data is touted by industry as a way to expand access to credit for underserved communities. However, policymakers should consider how the use of education data in determining credit will further disadvantage the communities it is purported to help.
As a proud third-generation HBCU graduate, former legislative and executive branch education policy staffer, and a Black female consumer this approach deeply troubles me. America has a longstanding history of discrimination and inequality in education, ranging from access and affordability to predatory players and repayment. And now, lenders are seeking to introduce another potentially discriminatory practice.
Use of education data promotes social stratificationThe use of education data in credit decisions is troublesome given the history of disparate access to education in America. From standardized testing, to degree attainment, to exclusionary enrollment at ''elite schools,'' countless Americans have been deemed unworthy of an equitable education simply because of the color of their skin or the socioeconomic status of their families.
For example, although degree attainment is on the rise for many racial and ethnic groups, research shows there is a shortage of minority students, particularly African-American and Latino students, at selective institutions of higher education. Only nine percent of Black students, eight percent of Indigenous American students, and twelve percent of Latino students attend America's most elite public universities. When credit terms are tied to attendance at supposedly ''elite'' institutions, it can unfairly impact borrowers of color. Widespread adoption of educational criteria to determine creditworthiness will further stratify socioeconomic barriers to economic opportunity and mobility for Black and Brown consumers.
The use of education data in credit decisions also ignores the way most students actually select a college'--more than 57 percent of incoming freshman attending public, four-year colleges enroll within 50 miles of home. Many of these students choose to stay close to home for college because of family responsibilities, cultural norms, or factors related to working while enrolled in school. This is especially true for Latino, Black, and Native American students. As a result, the use of institutional factors in credit decisions may have a disparate impact on Black and Brown communities.
Use of education data implicates fair lending lawFurthermore, given the gross disparities that exist across the education spectrum, the use of education data has significant fair lending implications. The Equal Credit Opportunity Act prohibits creditors from discriminating against applicants in any aspect of a credit transaction on the basis of characteristics such as race, color, and national origin.
A 2017 American Enterprise Institute report found that use of education criteria in underwriting decisions ''tend to disparately affect protected classes of individuals,'' also noting that ''the quality or selectivity of the institution has only a slight effect on earnings.'' Furthermore, the report notes that there is no available data that substantiates the necessity of including these factors in underwriting decisions or its relationship to the likelihood of repayment. This is cause for alarm where the risk of discrimination is so great.
For example, back in 2007, then-Attorney General Andrew Cuomo warned Congress about this educational ''redlining.'' An investigation found that private student lenders ranked colleges and universities by default rates and used this data to set interest rates. As part of the investigation Cuomo found that borrowers with ''excellent'' credit attending non-selective institutions were given higher interest rates than borrowers with less than ''stellar'' credit attending selective institutions. Cuomo noted, ''just as lenders in the mortgage industry once made judgments about credit lending in entire neighborhoods as a whole, so too are lenders making generalized judgments about student and parent credit risk based on a student's 'school neighborhood.'''
Note that multiple federal enforcement agencies have now stated that certain educational based cohort-related factors create discriminatory ECOA risk or violations.
Lawmakers must scrutinize the use of this data before it's too lateDespite the buzz being generated by fintech companies, we must remember that all innovation is not inherently good for consumers. Subprime lending was first marketed in the early 2000s as an innovative financial product to serve underserved borrowers. Before that, payday loans were touted as a necessary product to allow vulnerable consumers quick access to small dollar loans. Now, credit products using education data are being marketed as innovative products to expand access to credit.
We must also remember that this is broader than private student loans'--this is broader than student debt. The ramifications of education data in underwriting extend across consumer financial products, and therefore across consumers' lives.
It is frightening to imagine a future where graduates of my alma mater and those alike could be thrown into a second class credit market simply because of the college we attended. We must not further the stratification of economic and racial disparities in this country in the name of purported innovation. It is important that our lawmakers seriously examine a system that could potentially penalize a second-generation Latina student who opts for the MSI (minority-serving institution) close to home so she can help care for her sick grandmother instead of going to an Ivy League institution on the other side of the country. We must ensure that a former foster youth is not penalized when buying his first home simply because he chose to become a teacher.
In closing, we cannot allow a future where borrowers'--and in particular borrowers of color'--pay more for, or are denied credit, simply based on who sits next to them in a classroom. I strongly urge lawmakers and regulators to explore the risk to consumers and potential biases that education data may introduce to the credit market. If we allow these practices to take root, we risk further marginalizing Black and Brown borrowers.
###
Aryn Bussey is an education policy expert and strategist. Aryn credits her efforts to create the White House Initiative on Educational Excellence for African-Americans as her greatest professional accomplishment to date.
The Urgent Need for a United States Space Force - Imprimis
Wed, 05 Feb 2020 10:48
Steven L. KwastLieutenant General, United States Air Force (Ret.)
Steven L. Kwast is a retired Air Force general and former commander of the Air Education and Training Command at Joint Base San Antonio-Randolph. A graduate of the United States Air Force Academy with a degree in astronautical engineering, he holds a master's degree in public policy from Harvard's Kennedy School of Government. He is a past president of the Air Force's Air University in Montgomery, Alabama, and a former fighter pilot with extensive combat and command experience. He is the author of the study, ''Fast Space: Leveraging Ultra Low-Cost Space Access for 21st Century Challenges.''
The following is adapted from a speech delivered on November 20, 2019, at Hillsdale College's Allan P. Kirby, Jr. Center for Constitutional Studies and Citizenship in Washington, D.C., as part of the AWC Family Foundation lecture series.
In June 2018, President Trump directed the Department of Defense to ''begin the process necessary to establish a space force as the sixth branch of the armed forces.'' The reason for a space force is simple: space is the strategic high ground from which all future wars will be fought. If we do not master space, our nation will become indefensible.
Since that time, entrenched bureaucrats and military leaders across the Department of Defense, especially in the Air Force, have been resisting the President's directive in every way they can. And this December, although Congress voted to approve a Space Force, it did so while placing restrictions on it'--such as that the Space Force be built with existing forces'--that will render it largely useless in any future conflicts.
At the heart of the problem is a disagreement about the mission of a Space Force. The Department of Defense envisions a Space Force that continues to perform the task that current space assets perform'--supporting wars on the surface of the Earth. The Air Force especially is mired in an outmoded industrial-age mindset. It sees the Space Force as projecting power through air, space, and cyberspace, understood in a way that precludes space beyond our geocentric orbit.
Correspondingly, the Defense Department and Congress think that the Air Force should build the Space Force. So far, this has amounted to the Air Force planning to improve the current Satellite Command incrementally and call it a Space Force. It is not planning to accelerate the new space economy with dual-use technologies. It is not planning to protect the Moon or travel corridors in space to and from resource locations'--raw materials worth trillions of dollars are available within a few days' travel from Earth'--and other strategic high grounds. It is not planning to place human beings in space to build and protect innovative solutions to the challenges posed by the physical environment. It is not developing means to rescue Americans who may get stranded or lost in space.
In short, the Air Force does not plan to build a Space Force of the kind America needs. In its lack of farsightedness, the Air Force fails to envision landmasses or cities in space to be monitored and defended. Nor does it envision Americans in space whose rights need defending'--despite the fact that in the coming years, the number of Americans in space will grow exponentially.
This lack of forward thinking can be put down to human nature and organizational behavior: people in bureaucratic settings tend to build what they have built in the past and defend what they have defended in the past.
We have seen this kind of shortsightedness before. In the 1920s, the airplane and the tank were developed by the Army. Even the most respected military leaders at the time, Generals John J. Pershing and Douglas MacArthur, opposed independent development of the airplane and the tank because they saw them as subservient to the infantry. Infantry had always been the key to military success, and the generals' reputations were built on that fact. For them, slow and cautious steps were prudent, and revolutionary steps were reckless.
These generals defended the status quo even to the point of court-martialing General Billy Mitchell, who had the audacity to say that the airplane was going to change the character of war and needed to be developed independently in order to achieve its full potential.
This type of status quo thinking in the 1920s resulted in needless loss of life during World War II. More airmen were lost in the European theater alone than were marines in the entire war. And countless soldiers died in America's Sherman tanks, whose shells would bounce off Germany's Panzer and Tiger tanks. Frontal infantry attacks were launched in order to get Sherman tanks behind the German tanks to fire at close range'--the only range at which they could be effective. Many more of our fighting men would have come home and the war would have been shorter if American generals had taken a revolutionary approach to tanks and planes from the beginning.
On the other side, consider that a major reason we won World War II when we did was the revolutionary'--not slow and cautious'--approach we took to developing nuclear weapons with the Manhattan Project. Likewise today, instead of blindly following the bureaucrats and generals in the Defense Department, we need a Manhattan-type project in order to develop the kind of Space Force needed to meet future military challenges.
***
America's greatest competitor for the high ground of space is Communist China, which is already fully engaged in building effective space capabilities. America is not, and unless it gets off the mark soon, China will dominate the economy and domain of space.
Our Air Force today can be compared to a race car that has been winning every race for the last 70 years by averaging 100 miles an hour. We are still in the lead, but China is gaining and averaging 150 miles an hour. The Chinese will quickly surpass us if we do nothing'--and when they do, they will set up roadblocks that will make catching up difficult if not impossible.
Today, while America is building lighthouses and listening stations that can see and hear what is happening in space, China is building battleships and destroyers that can move fast and strike hard'--the equivalent of a Navy in space. China is winning the space race not because it makes better equipment, but because it has a superior strategy. The Chinese are open about their plan to become the dominant power in space by 2049, the centennial of the end of the Communist Chinese Revolution and of the founding of the People's Republic of China under Mao Zedong.
If China stays on its current path, it will deploy nuclear propulsion technology and solar power stations in space within ten years. This will give it the ability to beam clean energy to anyone on Earth'--and the power to disable any portion of the American power grid and paralyze our military anywhere on the planet. America is developing no tools to defeat such a strategy, despite the fact that we are spending billions of dollars on exquisite 20th century military equipment.
Over the past two centuries, we have seen that technology drives economic prosperity and that economic prosperity is essential to sustaining national security. China's plan is to profit from the multi-trillion dollar space marketplace while simultaneously acquiring global domination. We are capable of forestalling China's plan, but only if we begin to build a Space Force soon and on the right plan. To do this, we must first understand China's strategic goal, which is to dominate the sectors of economic growth that historically have held the key to world power: transportation, energy, information, and manufacturing.
Space presents unique economic opportunities because space technology operates on network principles. A network can deliver power, information, or goods from one node to many nodes at a fraction of the increase in cost per customer, as compared to the linear system on which most of our land-based economies are modeled. Compare the cost of sending 100 letters to the cost of sending 100 emails. A space infrastructure, by its nature, is a network system'--and these types of systems will always translate to economic advantage. The first nation to build such an infrastructure will dominate the global economy of the 21st century and beyond.
China is developing the kind of technologies required to do so: hypersonic missiles and aircraft, 5G telecommunications, artificial intelligence, 3D printing, quantum computing, and robotics. Last January, China landed the Chang'e 4 spacecraft on the far side of the Moon. The mission provided valuable knowledge in terms of commercial and military applications. At one time this sort of mission was not beyond U.S. capabilities, but it is today, and it shows a commitment to space that we lack. To be sure, China has yet to achieve the ability to launch a manned spacecraft, but this is also a capability that we no longer possess'--the U.S. relies on Russian rocketry to man and resupply the International Space Station.
China's goal is to have the capability to shut down America's computer systems and electrical grids at any time or place of its choosing, using directed energy and 5G technologies from space. Space is the strategic high ground from which China will seek to gain control of our media, businesses, land, debt, and markets. Although American companies are working on these new technologies, they are doing so in separate silos. Real power lies in tethering or combining the technologies together in space to achieve a dominant economic advantage.
If we choose to compete with China in space, we have a cultural advantage. We are more creative and innovative than China, because we have an open society and a free market. But we must be ambitious and act soon.
With the right vision and strategy for space, America can develop the means to:
Deliver unlimited, clean, affordable energy to every human on the planet without power lines or terrestrial power plants. Provide fresh water for every human without the need for aquifers or pipes. Build a new low-cost internet that is designed to be secure so that every human can connect, share, and learn with assured privacy and data safety. Defend Earth against small asteroids like the one that hit Russia in 2013. Develop a deterrence capability that will render ICBMs and nuclear weapons useless relics of the past. Revolutionize manufacturing by acquiring and deploying resources from space and in space. Provide a shelter in space where we can protect and preserve people, seeds, and life-saving medicines, so humanity can recover from any unexpected contamination, illness, or disaster. Design defense capabilities to preserve our economy, our people, and our sovereignty, and to allow our allies to defend themselves instead of sacrificing American lives. Reduce the loss of life and property due to natural disasters by managing the eyes of hurricanes and the funnels of tornados with energy from space. Some of this may sound like science fiction, but technologies exist to achieve these goals if we can summon the will to act. Status quo thinkers in the Defense Department say that these goals are futuristic and unaffordable. But recall that The New York Times, relying on the opinions of leading scientists and engineers, predicted that airplanes were ''one million to ten million years'' off'--a prediction made less than three months before the Wright Brothers made history at Kitty Hawk.
Engineers at countless private companies outside the military-industrial complex will assure you that we can achieve these goals, and soon. As for those who say it's unaffordable, look to the automotive, aerospace, and tech industries, all of whose capabilities were built from profits earned in markets that valued their usefulness. The same will hold true with the marketplace of space.
***
Why the urgency? Because being first in space is imperative. Space will be a multi-trillion dollar market that will disproportionately benefit the first nation to build a vibrant space infrastructure and define the principles and rules of the marketplace of space. If America is first, its principles'--the rule of law and the protection of liberty'--will be in a position to prevail. If Communist China is first, the marketplace will look much different.
Americans must not allow themselves to be lulled into a false sense of security by reassurance from the military-industrial complex that we have the best military in the world, with the finest equipment ever made. At present this is accurate, but a superior strategy in space will render our fine equipment obsolete in short order.
To develop a proper and winning Space Force, the President and Congress should immediately enact four simple measures:
Congress should assign the Space Force the mission to defend commerce in space and define Cis-Lunar space (Earth to Moon) as an area of responsibility in the Unified Command Plan. Congress should give the Space Force complete independence from the U.S. Air Force so that funds are not diverted from the former to the latter, and so that the Space Force isn't developed as a mere support function for air power. The President should issue an executive order protecting the space industry from China's predatory practices. The President should promote policies and strategies to maximize the contribution of the private sector, such as directing the Space Development Agency to partner with private companies to develop new space capabilities. If development of the Space Force continues along the lines of what is currently planned, America will lose the strategic space race to China. This must not be allowed to happen. Our elected leaders must take action now.
Here's a List of Everything That Went Wrong at the Iowa Caucuses - The New York Times
Wed, 05 Feb 2020 10:32
An untested technology, novel reporting requirements, nearly a dozen competitors to tally across 1,600 precincts '-- what could go wrong? As the Iowa Democratic Party discovered Monday night, nearly everything.
A faulty smartphone app was at the center of a chaotic caucus night in Iowa, but technical glitches were not the only reasons behind a major delay in results from the state's first-in-the-nation presidential contest. Here's a look at all the problems.
The app was new and relatively untested. The Iowa Democratic Party commissioned Shadow Inc., a for-profit technology company, to build an app in less than two months to help report results from around the state.
The short development timeline for the app and lack of rigorous vetting may have rendered it more vulnerable to problems with its code. It was not tested statewide before the votes.
State party officials and experts stressed that there was no sign of a hack or other cybersecurity issues, though they did not yet know what caused the app to malfunction.
Volunteers were unfamiliar with the new system. Training on how to use the app was available before the caucuses.
Not everyone took advantage of it, leaving the process unfamiliar to many caucus chairs on caucus night. Users reported trouble downloading the app, which was not available on either the Apple or Android app stores and required a cumbersome installation process.
Many users who were able to download the Iowa Democratic Party's caucus reporting app could not make it past the login screen. Charlie Neibergall/Associated Press
The app did not work for everyone. Some caucus chairs were able to successfully use the app to record and transmit their precincts' results, but problems were common.
Some people faced errors when logging in and connectivity issues or difficulty using the app. Many caucus chairs chose to not use the app at all, opting to call in their results to a central hotline instead.
The Iowa caucus reporting app was supposed to let users record several rounds of voting data and calculate results. Charlie Neibergall/Associated Press
Submitting results was more complicated than usual. This is the first time in caucus history that chairs had to report alignment counts along with delegate totals. They recorded the counts both in the app and on paper worksheets.
The increase in reporting detail may have taken chairs more time to record.
Because there is a paper ballot backup, the party will be able to accurately count the votes.
Highlighted areas below show fields that would be filled out during the caucus process.
First alignment fields
Second alignment and
delegate calculations
Representative
signatures
Second alignment and
delegate calculations
First alignment fields
Representative signatures
Second alignment
and delegate
calculations
Representative signatures
The app data did not transmit properly. Chairs were supposed to use the app to transmit results and a photo of their worksheets to party officials, who would calculate the final results.
As results rolled in, officials reported a high error rate in the transmitted data and struggled to identify the source of the problem. Chairs were told to email photos of the worksheets instead.
Backup phone lines were jammed. Chairs who recognized problems with the app or opted not to use it called party headquarters to submit results via phone.
Too few staffers were available to answer phones. Caucus chairs reported being on hold for hours.
Reporting and transcribing multiple data points over the phone caused delays. Some callers had to try several times before their results were recorded. Others gave up and went to bed, opting to try again in the morning.
The party must count votes by hand. Officials said they would rely on paper records to validate the results.
Collecting the worksheets and other records from hundreds of precincts in the state and counting them by hand will take time, though party officials began to release results Tuesday afternoon.
Despite the chaos, the caucus chairs maintained a robust paper trail, and party officials said Tuesday that they would deliver complete results as soon as possible.
See our live coverage for the latest updates and live Iowa caucus results as they are reported.
Fion Li on Twitter: "a rumor that #china won't export toilet rolls prompted some panic buying in supermarkets in #hongkong. Toilet roll manufacturer and supermarkets have already denied the rumor. honestly, how many rolls do you need for, say a week?? htt
Wed, 05 Feb 2020 10:28
Log in Sign up Fion Li @ fion_li a rumor that
#china won't export toilet rolls prompted some panic buying in supermarkets in
#hongkong. Toilet roll manufacturer and supermarkets have already denied the rumor.honestly, how many rolls do you need for, say a week??
pic.twitter.com/JkAiY6TSXq 6:01 AM - 5 Feb 2020 Twitter by: Fion Li @fion_li ééŸ"@シãƒ"デレãƒ(C)7th in Osaka @ tsekityam
2h Replying to
@fion_li pic.twitter.com/NaFBf3nEZQ View conversation · kodenol @ kodenol
1h Replying to
@fion_li @DanGarrett97 'Keep 4 packs for myself then sell the rest at ridiculous prices on Facebook.'
View conversation · Hamster @ TheHKHamster
2h Replying to
@fion_li Panic and lack of thinking brings out the worst in human nature, selfishness primarily, no one needs that much paper yet they'll hoard it and let others go without!
View conversation · Rick Deckard @ turpin_rick
2h Replying to
@fion_li @ChloeWhiteaker I have an Egyptian mummy themed fancy dress party coming up. I can only apologize for having cornered the hk loo roll market.
View conversation · RickRockhill 🕰 @ RickRockhill
1h Replying to
@fion_li ðŸ¤...ðŸ>>''‚¸ðŸ§>>
View conversation · yiktin @ timdayipper
1h Replying to
@fion_li To be correct, the rumor was all paper product factories in China is diverting capacity to face masks only...HKers are so gullible
View conversation · central kingdom @ centralkingdom
1h Replying to
@timdayipper @fion_li They have no idea about China's paper production capacity.... they have no idea of a great many things.
View conversation · Randy Treibel @ therealrainfall
1h Replying to
@fion_li She probably runs a restaurant.
View conversation · Misho ILIEV @ MishoMoney
1h Replying to
@fion_li That's reminds me of communist times...
View conversation · Gordon G. Forbes 🇺🇸🗽ðŸ"¸'ðŸŒðŸŒŠ @ ggforbes
59m Replying to
@fion_li Well, Trump allegedly flushes 15 times. 🤷ðŸ>>''‚¸
View conversation · Enter a topic, @name, or fullname
Settings Help Back to top ·
Turn images off
Lame Cherry: Coronavirus First Biological Weapon Strike
Wed, 05 Feb 2020 10:23
As another Lame Cherry exclusive in matter anti matter.The Lame Cherry is going to provide an assembled scenario, based on the insight of JR Nyquist as published at ZeroHedge.I will do a short review here and keep this short, so your minds are not diverted. We now have two leading Americans, in Senator Tom Cotton and Francis Boyle who have stated that Coronavirus is a bio weapon.We know the Jews of Tel Aviv are in a panic over this weapon, as it originated in Saudi Arabia as genus specific SARS to kill Arabs. It was sent to the Netherlands and then to Winnipeg Canada to chart the virus.From Manitoba, the Chinese stole it, and the virus ended up in Wuhan and a PLA bio weapons lab.This Coronavirus was a weapon when it came out of Saudi Arabia, meaning someone built it, as in Dr. Germ, to kill Saudi's. It has HIV qualities, meaning it survives in human excrement, meaning it will survive in a septic system or through anal sex transmission, or from feces contamination. The Chinese do not wash their hands any more than Mexicans do. This blog maintains it was shit smear which was ingested in the original group. In what follows, this blog believes this was a deliberate release.Creator Of US BioWeapons Act Says Coronavirus Is Biological Warfare Weapon Francis Boyle is a professor of international law at the University of Illinois College of Law. He drafted the U.S. domestic implementing legislation for the Biological Weapons Convention, known as the Biological Weapons Anti-Terrorism Act of 1989, that was approved unanimously by both Houses of the U.S. Congress and signed into law by President George H.W. Bush.In an exclusive interview given to Geopolitics and Empire, Dr. Boyle discusses the coronavirus outbreak in Wuhan, China and the Biosafety Level 4 laboratory (BSL-4) from which he believes the infectious disease escaped. He believes the virus is potentially lethal and an offensive biological warfare weapon or dual-use biowarfare weapons agent genetically modified with gain of function properties, which is why the Chinese government originally tried to cover it up and is now taking drastic measures to contain it.The Wuhan BSL-4 lab is also a specially designated World Health Organization (WHO) research lab and Dr. Boyle contends that the WHO knows full well what is occurring.It is what JR Nyquist uncovered, and was featured on Great Game India, as in the British Great Game of world dominance, that there were evaluations taking place in the border area with China, inside India.It is not GreatGameIndia alone which is being viciously attacked. Zero Hedge, a popular alternate media blog was suspended by Twitter for publishing a story related to a study by Indian scientists finding 2019 Wuhan Coronavirus to be not naturally evolved, raising the possibility of it being created in a lab. Shockingly, the study itself came under intense online criticism by Social Media experts resulting in the scientists withdrawing the paper.In retaliation India has launched a full-scale investigation against China’s Wuhan Institute of Virology. The Indian government has ordered an inquiry into a study conducted in the Northeastern state of Nagaland (close to China) by researchers from the U.S., China and India on bats and humans carrying antibodies to deadly viruses like Ebola.The study came under the scanner as two of the 12 researchers belonged to the Wuhan Institute of Virology’s Department of Emerging Infectious Diseases, and it was funded by the United States Department of Defense’s Defense Threat Reduction Agency (DTRA).Researchers from China, India and the United States were involved, but this was coming out of the American Bio Bug Factory in research. What this blog believes took place is, China was creating another weaponized human pneumonia, but the target was not, the West, but much closer to it's border in India, the nuclear rival of Peking.In a coming Great Eurasian War, India is looked as expendable by the West to save the West, but as Richard Nixon threatened to nuke China if it did not cease an invasion of India, the West looks upon India as not completely expendable.For China, it faces the nuclear sphere of the Jews, Saudi Arabia, Pakistan, India, the United States. The major problem is India as China must march to Mideast oil through the Khyber. A military India would be a problem which China would face nuclear checks and a problem of in a United States exchange, China would be vulnerable to an untouched India, and India would go on to defeat China and expand north.The Peking PLA solution appears to have been to create a weaponized Corona for the India people, which would eliminate them as a future problem. Removing India, removes a great game piece on the board. Removing India plays the card that China believes it can maneuver the United States into war with Russia in Europe and the Mideast, allowing China to dominate in the spoils.Do not miss in this that President Vladimir Putin shut down the Russo Chinese border immediately. Putin understands the reality that if China lost 40% of her population, she still has 600 million trigger pullers. Russia loses 40% and she would be helpless for a Chinese invasion as America is being overrun by Latinos.Putin recognized this virus immediately as a weaponized clone of the Arab SARS. The SARS was to kill only Arabs, and this Corona was killing Chinese and infecting Thia. This indicated it was an open end virus, and with Russia being Asian centric in population, it was certain to be of the same carrier group as the Ashkenaz Jews who are of the same genus as Russians.This is why President Donald Trump shut down the US airports to foreign nationals, and rescued hundreds of American diplomats out of Wuhan. Even if the moneychangers are saying there is nothing to worry about, this President knows this is a bio weapon, and it is a guarantee that the US has been in possession of this virus from Wuhan for at least 30 days and confirmed at Fort Detrick Maryland this is a global threat.Which leads to the reality that Johnson and Johnson were speaking of Corona, as was Bill Gates in his planet scourge a year ago in profit and population control. Someone on the grand game, knew China stole this weapon, which it is believed was created by Sunni Islam in the infamous Dr. Germ, to kill Shia Muslims in Saudi Arabia. The Jews knew what this virus was and monitored it.In order to protect the order of battle, this group either took the Wuhan lab virus, flushed it into the septic system or went out and spread human contaminated feces into the Wuhan populace, knowing it would incubate to this epidemic stage in crippling China's economy.This group would have known that travelers, would have brought the virus as previously in China SARS to the West, as no story is a story until thee Americans have it on their news and begin reacting. With pressure on China, the Chinese who have been lying about Corona, are not going to admit that they were creating a virus to genocide the Indian people in the great game.It is on that chain of connect the dots, that it is believed that either in the Wuhan weapon's lab an agent working against Peking spliced in the Mongoloid directive of the Corona or it came from an outsource and was spread in Wuhan, as a First Biological Strike before China could release the virus in monkey and mosquito in northern India to spread like wildfire through the subcontinent.This is the projection scenario which factors out in the known events. Forces desire a coming global depression to knock stock prices down and to limit trade, for emerging powers who are about to gain control of their spheres.This once again, is another Lame Cherry exclusive in matter anti matter.Nuff SaidagtGagtG
A Majority of Voters Now Support Decriminalizing Sex Work
Wed, 05 Feb 2020 09:51
People march in support of decriminalizing sex work and against the Fight Online Sex Trafficking Act and the Stop Enabling Sex Traffickers Act on June 2, 2019, in Las Vegas.
Photo: John Locher/AP
As recently as spring 2018, every single Democratic presidential candidate who was then in Congress '-- from progressive Sen. Bernie Sanders to conservative Sen. Amy Klobuchar '-- voted for a bill that expanded the criminalization of sex work and imperiled sex workers nationwide. The Stop Enabling Sex Traffickers Act, later combined with the Allow States and Victims to Fight Online Sex Trafficking Act to form the pernicious FOSTA-SESTA legislative package, sailed through both the Senate and the House with bipartisan support. The voices of sex worker organizers, who correctly stressed that the law would deny sex workers crucial online resources and networks while failing to end trafficking, were roundly ignored.
Fast forward nearly two years and the Democratic consensus around the criminalization of sex work has, thankfully and finally, seen a most dramatic shift. As a report published today by a coalition of organizations, including Data for Progress, the American Civil Liberties Union, Mijente, and the Human Rights Campaign noted, ''For the first time in presidential primary history, 2020 candidates have competed for a progressive position on the sex trade.'' While the issue has arisen as more a talking point than a clear policy proposal for the candidates, the positioning away from criminalization is marked.
The report, released on Thursday alongside two new national polls, does not just focus on sex work decriminalization as an electoral issue '-- it also surveys and commends a significant shift in public support, especially among young people, for seeing sex work decriminalized.
The Democratic consensus around the criminalization of sex work has, thankfully and finally, seen a most dramatic shift.
National polling carried out by Data for Progress and YouGov Blue found that two-thirds of voters aged 18 to 44 support the full decriminalization of sex work; two-thirds of Democratic voters of all ages agree, compared to 37 percent of Republicans and 55 percent of independents. ''Fully 52 percent of voters somewhat or strongly support decriminalizing sex work,'' noted the report, authored by Data for Progress fellow Nina Luo, who is also an organizer with Decrim NY, a coalition pushing for decriminalization, the decarceration of sex workers, and the destigmatization of the censured industry. In a similar poll taken just seven month earlier, 45 percent of overall voters supported decriminalization; support among Democratic voters has increased from 56 to 61 percent.
Sex work decriminalization should not be considered a fringe issue. It intersects many of the most urgent political struggles of our time: the fight to end mass incarceration, racial profiling, and transphobic police violence; the demand for a social safety net; and robust and protections for all workers. To fight for the decriminalization of sex work is to fight for and with society's most vulnerable and marginalized communities, in particular women of color and of immigrant backgrounds, especially trans women who often rely on sex work when discriminated against in other industries. Black women account for 94 percent of people arrested for the absurd and capacious charge of ''loitering for the purposes of prostitution'' in the New York City boroughs of Brooklyn and Queens. Thus, to ignore the struggle for sex workers' rights is de facto to allow their lives not to matter.
According to Luo, it is in part the growing recognition of the necessity of these connected struggles that accounts for the increased support for sex work decriminalization. ''Living wages haven't risen and 13 percent of Americans know someone who has died because they couldn't afford health care,'' Luo told me, noting that ''people are in economically desperate situations and increasingly understand that people do things for survival, that survival work is work, that sex work is work.'' Full decriminalization would recognize that as work, sex work is not the business of the police and courts. For many, sex work may not be good work, or always free of exploitation, and it may be resorted to when there are few other options. But the very same is true of many jobs in which workers are nonetheless deemed worthy of rights and legal protections as workers.
Luo also attributed the changing views on decriminalization to the sex worker movement's alignment with a multiracial coalition and ''a rising left.'' There's little doubt that the infusion of new, decidedly left-wing blood into parts of the Democratic political landscape has pushed the issue to the fore in state houses nationwide. New York and D.C. have introduced bills to decriminalize sex work, and similar efforts are gaining ground in California, Oregon, Illinois, Vermont, Connecticut, and Colorado, the report noted. Progressive politicians like Rep. Ro Khanna, D-Calif., deserve credit for new efforts to repeal FOSTA-SESTA, and left-to-liberal NGOs getting behind the issue are to be commended. But the long overdue shift in political consensus was hard fought by sex worker organizers on the front lines.
The report includes testimonies from a number of sex workers and former sex workers attesting to the violences enacted through criminalization. Bianey Garcia, a trans rights organizer with immigrant advocacy group Make the Road, who emigrated from Mexico as a teenager to escape LGBTQ persecution, was fired from her restaurant job in the U.S. when she transitioned on hormones. Having previously been a victim of sex trafficking, Garcia then turned to consensual, independent, survival sex work. ''I've been arrested four times for prostitution,'' she notes in the report, ''Only once was I actually doing sex work, the other three arrests were just profiling because I'm a trans woman.'' Another testimony, from Victoria Walker, who turned to sex work for survival, recalls that each time an aspect of the industry was further criminalized, the work became more dangerous. For example, FOSTA-SESTA led to the shuttering of sites where workers could screen clients and connect to other members of the community. ''If sex work were decriminalized,'' notes Walker, ''the sex worker community could find each other again and feel safe by having each others' backs.''
''If sex work were decriminalized, the sex worker community could find each other again and feel safe by having each others' backs.''
It is only full decriminalization that can lay the ground for sex workers to obtain the rights they well deserve. The so-called Nordic model, in which only buyers of sex or third parties face criminalization, forces sex workers into the shadows and continues to entrap sex workers and their loved ones in the system of carceral injustice. Examples abound of sex workers being arrested for soliciting under such laws. The new report notes that under the Nordic model, pitched as legislation to protect sex workers, Norway ''evicted more than 400 sex workers, primarily migrant women, from their home.'' Full decriminalization will not offer economic justice and material safety for the vulnerable people who turn to sex work for survival, but it would remove at least some of the grounds used by the police and state to further oppress these communities.
And it is support for full decriminalization that the new polls reflect. Respondents were asked whether they would support sex work following the example of New Zealand, which in 2003 did away with ''criminal penalties for adults to sell and pay for consensual sex while also maintaining laws that criminalize violence.'' New Zealand has not seen the sex work industry grow since it was decriminalized, according to the report, but 90 percent of people trading sex said decriminalization gave them employment, legal, and health rights, while 64 percent found it easier to refuse clients.
Luo told me that the shift in support for decriminalization, especially among young people, is a ''momentous'' indication of ''where the future is for the issue,'' but the organizer was clear that barriers to full decriminalization, decarceration, and destigmatization remain steep. She highlighted that beliefs in carceral approaches to ending violence and exploitation, transphobia, fearmongering, and myths about trafficking persist with force, as do reactionary and powerful police unions lobbying for criminalization. She added, though, that ''perhaps the greatest barrier of all'' is that people who are inoculated from deprivation and discrimination ''find it unbelievable that people living at the intersections of marginalization and oppression often trade sex to survive.'' As Luo put it, ''it gets at the very core of who we are as a society, pretty immediately.'' And to reckon with the realities of survival sex work and the added brutality of its criminalization is to understand that this society needs changing at its core.
Trudeau Minister Proposes Forcing News Websites to Have Govt Licence
Wed, 05 Feb 2020 09:48
Canadian Heritage Minister Steven Guilbeault has stated that news websites, along with social media companies, could be forced to obtain government licences to operate in Canada.
The minister, who has been tasked with updating Canada's broadcasting laws using the Canadian Radio-Television and Telecommunications Commission (CRTC), stated that internet news sites will be ''asked'' to obtain a government-approved licence, broadcaster CTV reports.
The report, entitled ''Canada's communications future: Time to act'', was released on January 29th and included 97 recommendations. It details how the CRTC would be vastly expanded to not only regulate radio and television broadcasters but news websites as well.
''If you're a distributor of content in Canada and obviously if you're a very small media organisation the requirement probably wouldn't be the same if you're Facebook, or Google. There would have to be some proportionality embedded into this,'' he said during a CTV interview.
Global Censorship: Court Rules EU Govts Can Take Down Content Worldwide After Politician Insulted https://t.co/OIGGPh5ZZ3
'-- Breitbart London (@BreitbartLondon) October 7, 2019
When asked directly how the legislation would affect foreign websites, with Breitbart News specifically named, Guilbeault said that he did not think foreign sites would be blocked in Canada if they did not comply with the CRTC.
''Frankly I'm not sure I see what the big deal is,'' Guilbeault said. He added that other foreign companies in other industries actively comply with Canadian regulations.
''We recommend that the existing licensing regime in the Broadcasting Act be accompanied by a registration regime. This would require a person carrying on a media content undertaking by means of the Internet to register unless otherwise exempt,'' recommendation 56 of the report states.
Current CRTC regulations include forcing commercial radio-broadcasters who primarily play music to have at least 35 per cent of their content per week come from Canadian artists.
Michael Geist, the Canada Research Chairman in Internet and E-commerce Law at the University of Ottawa labelled the report ''candidly extreme'' and added it has no ''physical boundaries''.
Wexit: Separatism in Conservative Western Canada Peaks After Trudeau Win https://t.co/On6l7R3Ofg
'-- Breitbart London (@BreitbartLondon) November 7, 2019
Conservative MP Michelle Rempel Garner has also expressed concern over the proposals in the report saying: ''It's very paternalising and also very frightening to think that the government would try to impose or say that's the role of the government to control. That puts us in league with countries that control the media.''
Similar moves toward limiting free speech online have been made in Europe in recent months as well, with an October ruling by the Court of Justice of the European Union allowing governments to force social media giant Facebook to remove content.
Follow Chris Tomlinson on Twitter at @TomlinsonCJ or email at ctomlinson(at)breitbart.com
How Harvey Weinstein lawyer Donna Rotunno defends her feminism - Business Insider
Wed, 05 Feb 2020 09:39
Harvey Weinstein's lead defense attorney, Donna Rotunno, calls herself the "ultimate feminist." She's built her career defending men accused of rape.She's defending Weinstein against five felony counts of rape and sexual assault and has grilled his accusers during cross-examination.Feminists and Weinstein accusers say they've been repulsed by her comments, accusing her of victim-blaming.Rotunno says women have fought for decades to be viewed as equal to men, and now they need to start taking on some of the responsibility that comes with it.Visit Insider's homepage for more stories.Not long after the star witness in Harvey Weinstein's rape trial testified about a traumatizing sexual encounter with the Hollywood producer and another woman, defense attorney Donna Rotunno approached the lectern for her cross-examination.
She presented the accuser, Jessica Mann, a 34-year-old hairstylist, with copies of an unpublished blog post that prosecutors recovered from her phone.
"You told the jury the threesome was horrifying because it was something you didn't want to do," Rotunno said. "I would like you to read the note from your phone to the ladies and gentlemen of the jury."
"Do I have to?" Mann asked, turning her head toward Justice James Burke.
"Yes," Rotunno said.
After a long pause, Mann began reading the years-old post, describing a threesome with an unnamed "older man" and an Italian woman, seemingly the same one she mentioned in her testimony.
Loaded with jokes, expletives, and erotic descriptions of the woman's body, the written version characterized the encounter as exciting, not upsetting. At one point it compared Mann to a "14-year-old boy about to lose his virginity."
"This is what really happened," Rotunno said after Mann read.
Mann disagreed. She said she wrote the post only because she "wanted to reframe it for comedy."
Rotunno pelted Mann with questions and accusations with such force that at one point Mann had to ask her to slow down.
"You were manipulating Mr. Weinstein so you'd get invited to fancy parties, correct?" Rotunno asked. "You wanted to use the power he had, correct? You wanted to benefit from the power."
Rotunno spent months preparing for this cross-examination, an opportunity that could make or break the case as well as her career. Her approach, exacting and at times hostile, reflected a strategy she'd honed over a 15-year career defending men accused of rape. Of the 40 sex-crimes cases she's tried, she's lost one.
Rotunno joined Weinstein's defense last spring, after he burned through a number of lawyers in the leadup to his rape trial. He sought a lawyer who wouldn't appear too intimidating when cross-examining the accusers.
"He wanted a woman," Rotunno told Insider, unbothered. "The optics of it are just different, a woman walking in with him."
Weinstein and Rotunno arrive at New York City Criminal Court on January 21, 2020. Getty Images/Jeenah Moon
Every day since the beginning of the trial on January 6, she's been photographed in designer heels towering over her client, who trudges in and out of the courthouse hunched over his walker. She's become the face of Weinstein's defense team, racking up appearances on CNN and "CBS This Morning" where she's become a kind of provocateur by challenging the credibility of Weinstein's accusers and lamenting that her client's life "has been ruined."
In addition to fighting for Weinstein's acquittal, Rotunno is waging a broader crusade against both the #MeToo movement and a culture she believes infantilizes women and rewards victimhood. She relishes in the anger she provokes and calls herself the "ultimate feminist," though she's representing one of the most notorious alleged sexual predators in America.
"Our justice system has decided that just because someone says something doesn't mean it's true," Rotunno told Insider. "This notion of people saying 'this is my truth.' Well, there's no such thing. There's no such thing as your truth or my truth. There's the truth. And my job is to get to whatever it is."
Her job is not to absolve Weinstein of the roughly 100 allegations that have flooded in since 2017. The criminal case has been whittled down to two accusers: Mann, who alleged Weinstein raped her twice in 2013, and Mimi Haleyi, a former "Project Runway" assistant who alleged the producer forced oral sex on her in 2006.
But Rotunno knows she has the weight of an entire cultural movement working against her client, and that the jury may feel pressure to convict him.
Rotunno wants women to 'take on the risk of making different choices'The problem with women today, Rotunno told Insider in an interview last month, is that they don't take responsibility for their decisions.
She described growing up admiring her mother and grandmother, both independent women who did as they pleased and were subservient to no one, she says.
"These are women who never made excuses for their lots in life," Rotunno said. "Women who said, 'I can do anything.'"
But it's women today, Rotunno went on, who have refused to claim the same agency and instead blame men.
"Everybody says, 'Oh, are you telling women that if they go to hotel rooms they deserve to be raped?' No," Rotunno said. "What I'm saying is that after having drinks and being at a party and sitting in a bar with somebody and going to their hotel at midnight, don't be so ridiculous as to say, 'I thought I was going to see a script.' At some point, where is the responsibility?"
Rotunno leaves Manhattan Criminal Court after proceedings in Weinstein's sexual-assault trial January 29, 2020, in New York. Getty Images/David Dee Delgado
In Rotunno's view, women have fought for decades to be viewed as equal to men. Now, as gender equality has become more pervasive, Rotunno believes women have abdicated the responsibilities that come with it.
"Nobody wants to say, 'If you want real equality, and you want things like #MeToo to not happen to you, you have to take on the risk of making different choices,'" Rotunno said.
Those choices have become a key theme in Rotunno's defense.
On Monday, Rotunno pressed Mann on why she chose to follow Weinstein to a Manhattan hotel room the day she alleged that he raped her. Mann, who previously had consensual sexual encounters with Weinstein that she described as uncomfortable, explained that she intended to meet the producer at her hotel's restaurant for breakfast with friends, but panicked when he arrived early and asked the hotel staff to give him his own room.
Mann testified that she followed him upstairs so that she could confront him over why he was checking in to her hotel '-- but Rotunno interjected.
"You could have said, 'Harvey I'm not going up there,'" Rotunno said. "All I'm asking you is, why you didn't make the choice to walk out the door? You made the choice to go up to the hotel room, knowing what had happened in the past."
A courtroom sketch showing Harvey Weinstein as witness Jessica Mann is questioned by Donna Rotunno in front of Judge James Burke during Weinstein's trial on February 3. Reuters/Jane Rosenberg
To modern feminists and Weinstein's accusers, those questions smack of victim-blaming. The experts and victims with whom Insider spoke balked at Rotunno's views. One gender-studies professor argued that her ideology fails to account for the power imbalance between many women and the predatory men in their lives.
But Rotunno has scoffed at that supposed imbalance and grown irate in court when the prosecution has accused her of victim-blaming. At one recent hearing, Rotunno said it was "insulting" to suggest that women can't make their own decisions.
Even if the women were trying to appease Weinstein out of fear of retaliation, or to protect their jobs, Rotunno said that doesn't explain why they willingly met him when they knew he'd likely make sexual advances, if they didn't truly want those advances.
"Those are still choices," Rotunno told Insider. "You're still in a position where you are choosing a career over your own self-worth. You are saying that 'this choice may get me a job, which is more important to me than my dignity and my self-worth.'
Rotunno's vision of feminism asks women to take more responsibility for themselves. Hollis Johnson/Insider
"Men are not going to stop asking women to go to the hotel room," Rotunno went on. "Women have to stop going. Because if there's one woman left willing to do it, it's going to continue."
Rotunno describes those views as feminist, but Leigh Gilmore, a professor of women's and gender studies at Wellesley College, told Insider that Rotunno's feminism is an old-fashioned variety that lets predatory men off the hook rather than demanding they be more responsible.
Gilmore describes Rotunno's views as a "neoliberal version of feminism" that emphasizes individual choice above all else.
"In the absence of looking at the structural inequalities around gender and race and sexuality and class that obviously exist, it sort of seeks to wipe all of that away and then to task women with responsibilities that they can't access as easily as that model suggests," she said.
Rotunno's feminism essentially suggests that women should prevent their own victimization by staying out of men's way, Gilmore added. "It can hardly be an adequate and adequately robust version of feminism," she said.
'Look at yourself in the mirror,' one Weinstein accuser urged RotunnoThough Rotunno mostly declined to comment on any allegations against Weinstein not part of the criminal case, she suggested that many of the women's claims were overblown or exaggerated.
"If you look at any circumstance where a woman said no to Harvey ... you know, 'Can I have a massage?' 'No.' They leave," Rotunno said. "There was never any circumstance where he was forcing somebody to stay. And there was never any situation where those people lost work because of it."
That doesn't ring true to Rowena Chiu, Weinstein's former assistant. In fact, at least two other women have pressed criminal charges against Weinstein in Los Angeles and alleged that he prevented them from leaving hotel rooms and raped them, and actresses such as Ashley Judd and Mira Sorvino have said they believe they lost work because of him.
Weinstein's trial has been taking place in a lower Manhattan courthouse. Getty Images/David Dee Delgado
While Chiu isn't involved in the trial, she alleged that, in 1998, the producer summoned her to a hotel room, made a number of racist comments about her Chinese heritage, peeled off two pairs of tights she was wearing, and begged for "just one thrust."
Chiu said she managed to wrestle herself away from him, leave, and eventually negotiated a settlement barring her from speaking about the incident in exchange for $213,000 and a promise that no woman at the company would endure a similar attack.
But Chiu told Insider she struggled to find work in the film industry after leaving Weinstein's production company, Miramax, and she believes that was his doing. She also said her encounter with him set off a disastrous chain of events that eventually led to a suicide attempt.
Ashley Judd, left, and Rowena Chiu on the "Today" show, September 9, 2019. Nathan Congleton/NBCU Photo Bank/NBCUniversal via Getty Images
Upon hearing Rotunno admonish women like her for going to men's hotel rooms, Chiu grew indignant.
"One of the accusers was 16. I was 24. And she is trying to say that at 16 and 24 we were, like, 'Oh, well, I might get raped, but hey, I want a career in the film industry, so I'm going to put myself in the path of a rapist?'" Chiu said. "I mean, Donna Rotunno, look at yourself in the mirror. How can you excuse yourself by trying to make this argument? It's disgusting and despicable."
Rotunno has turned to lines of pointed questioning to frame the Weinstein allegations as the result of the accusers' poor choices, not from her client's wrongdoing.
When she cross-examined Annabella Sciorra, the actress who said Weinstein raped her in her apartment during the winter of 1993 or 1994, she asked why Sciorra had never gone to the emergency room, called the police, or confronted her doorman about letting Weinstein inside. She also asked why Sciorra later accepted a role in a Miramax film.
She even cast doubt on Sciorra's efforts to fight back against Weinstein during the alleged attack. Why didn't she try to scratch him? Poke out his eyes? Sciorra replied that she tried to fight back, but that Weinstein was "too big."
Actress Annabella Sciorra leaves Manhattan Criminal Court on January 23, 2020. Johannes Eisele/AFP via Getty Images
Discrediting an accuser without coming across as a rape sympathizer during cross-examination isn't easy, Lara Yeretsian, a criminal-defense lawyer in Los Angeles, told Insider. Sometimes it means putting on a friendly or empathetic face. Other instances call for a more confrontational stance. Either way, it's a necessary job.
"They've got to do it. I mean, how do you show these people are lying? There's no other way to show somebody is not a credible witness," Yeretsian said. "[Weinstein] could go to jail for life."
But Rotunno's strategy '-- reminding the jury as often as possible that Weinstein's accusers did not behave as stereotypical victims '-- could backfire.
Cheryl Bader, a law professor at Fordham University and former prosecutor, told Insider that Rotunno shouldn't underestimate the prosecution's case that Weinstein's power and wealth left women particularly vulnerable and reluctant to directly confront him or report him to police.
"Look, some attorneys, they become very focused on their own theory, to the exclusion of really seeing the potential in the prosecutor's theory," Bader told Insider. "But that tends to be more of a rookie mistake."
Rotunno is no rookie.
So far, she's lost just one sexual-assault caseRotunno said she always knew she'd be a lawyer.
As a 5-year-old, she and her father, Anthony, would watch the show "The Paper Chase," marveling at the Charles Kingsfield character, a tough and brilliant Harvard professor who specialized in contract law.
Her fascination with the law took her to the Chicago-Kent College of Law, where she developed a formidable courtroom presence, her father said.
"You're not going to outwork Donna, that much I can tell you," he told Insider. "Never."
As for her career defending accused rapists and sexual predators, it happened by chance.
"You handle one and then you handle another one, and they keep calling," Rotunno said. "This is something where I have developed a little bit of a niche, and here we are."
Rotunno began her legal career in Illinois as a Cook County prosecutor, but she left for private practice after three and a half years to take on criminal-defense work. By 28 she'd already begun winning big drug-trafficking cases. The next year, she started her own law firm.
Rotunno on her way to court. Timothy A. Clary/AFP via Getty Images
Her best friend, Kirk Williams, told Insider that it was immediately clear Rotunno's practice would be a lucrative one.
"She's meticulous," he said. "She understands facts and cases. She has a mind for detail and a recall greater than pretty much most people I've ever met."
Over the next 15 years, Rotunno's clients included dozens of sex offenders, along with alleged murderers, drug dealers, and white-collar criminals, a fairly typical caseload for a wunderkind defense attorney with a winning reputation.
In 2011 she defended Demarco Whitley, a high-school-football star accused of sexually assaulting a 15-year-old girl. The accuser alleged that Whitley and his teammate held her down in the back of the teammate's car while Whitley assaulted her.
Rotunno's first decision was opting for a bench trial, in which a judge '-- rather than a jury '-- would reach a verdict. A jury might not grasp the stakes of the charges, Rotunno reasoned. Whitley faced a minimum of 16 years in prison and a maximum of 60, and juries are not told the potential sentences during trials.
Rotunno is both feared and respected by her legal colleagues. Hollis Johnson/Insider
So she placed her faith in the judge, trusting he'd weigh the devastating effects of a conviction with such a weighty sentence. The choice would prove fatal to her defense, she now says.
Maria McCarthy, the prosecutor in the Whitley case, told Insider that Rotunno conducted a fair and professional cross-examination of the 17-year-old victim.
"She knew exactly what she wanted to get out of the victim, but I never saw her exhibit disrespect toward the victim during her cross-examination," McCarthy said.
In her closing statement, Rotunno pulled no punches, arguing that the girl consented to sex with Whitley and his teammate.
"She's a liar," Rotunno said, according to one local 2011 report. "She lies to her mother, she lies to police, she lies to her friends. Lies are lies '-- in a criminal trial, they matter."
Harvey Weinstein being escorted to court. Johannes Eisele/AFP via Getty Images
In the end, the judge convicted Whitley of all four counts of sexual assault and sentenced him to 16 years in state prison. So far, it's the only sex-crime case Rotunno has lost.
McCarthy said she respected Rotunno's conduct during the trial so much that the pair became friends and have remained so since. After losing the Whitley case, Rotunno reached out to the teenage victim, asking McCarthy to tell her that she hoped she wouldn't let the incident define her, McCarthy said.
"Donna's the type of defense attorney a prosecutor hates to try a case against because she's outstanding," McCarthy added. "And she's very prepared. And she doesn't miss anything. And she's persuasive."
Whitley's courtroom sketch is the only one Rotunno keeps in her office, she said. It's a reminder of the price her clients pay when she loses.
Rotunno says Weinstein made 'bad choices' '-- but that's not a crimeIn the coming weeks, Rotunno and her team are set to take on a number of other witnesses who will either bolster or undermine Mann's and Haleyi's testimonies.
The trial is moving faster than anticipated. A verdict could come as early as mid-February.
It's entirely unclear which way the jury '-- seven men and five women '-- are leaning. Through nearly two weeks of witness testimony, they have sat stoic, many jotting down notes in large coiled notebooks.
Rotunno said she'll try to convince them that they don't have to like Weinstein '-- but they can still find him not guilty. The two concepts are mutually exclusive.
"Has he made bad choices? Yes. Has he cheated on his wife? Yes. Has he made morally bankrupt calls? Yes. But at the end of the day, that doesn't make him a rapist," Rotunno said. "And if we start convicting people because we think they're a bad guy, or they made bad choices, we're all in trouble."
Harvey Weinstein arrives at Manhattan Criminal Court on January 22, 2020 in New York City. Raymond Hall/GC Images/Getty
Weinstein's accusers have found Rotunno's attitude toward Weinstein's "bad choices" appalling. They say her inability to empathize or understand how frightened and intimidated they were by Weinstein's advances has infuriated them.
Lauren Sivan, who has alleged that Weinstein cornered her in a restaurant in 2007 and tried to kiss her and then masturbated in front of her and ejaculated into a potted plant, called Rotunno's views "ridiculous."
"You know, I'm so glad that she had such a scot-free rise in her career that she was never put in that type of situation," Sivan said. "That she's never had to deal with harassment on any level, that all of her business meetings have gone completely smoothly ... Well then, congratulations to her."
Rotunno said she acknowledges that sexual misconduct is a problem. The question of how to handle unwanted male attention often comes up in conversations with her 14 godchildren, 10 of whom are girls.
She said she even counseled one goddaughter's friend who had been sexually assaulted, telling her it was important to contact the police immediately and that problems could arise if she waited.
Weinstein and his lawyers, Rotunno and Damon Cheronis, leave court after the start of his sex-assault trial, January 22, 2020. Getty Images/John Lamparski
Rotunno said she often receives unprompted and sometimes lewd comments from men about her appearance. But she said the difference between her and #MeToo accusers is how she handles it.
For instance, she said she recently stopped to say hello to an old boss, a former Cook County prosecutor turned judge who wanted to congratulate her on taking on the Weinstein case.
Rotunno recalled that the judge joked that he would soon be asking her for an autographed picture. "But I get to decide what you're wearing," he added, according to Rotunno.
Recounting the boorish comment, Rotunno threw up her hands, half exasperated and half amused.
"I was, like, 'You know what I'm doing right now '-- really?'" she said, before laughing it off. "Those things happen. But I'm not going to lose sleep over it, I'm not going to lose my job over it. I just sort of got a kick out of it. And I think sometimes we just take things too seriously."
If you are a survivor of sexual assault, you can call the National Sexual Assault Hotline at 800.656.HOPE (4673) or visit their website to receive confidential support.
Read the original article on INSIDER. Copyright 2020. Follow INSIDER on Facebook.
Follow INSIDER on Twitter. More: Harvey Weinstein Donna Rotunno New York City Crime Chevron icon It indicates an expandable section or menu, or sometimes previous / next navigation options.
Vulnerable Child Protection Act
Wed, 05 Feb 2020 09:32
HB 1365 2020 CODING: Words stricken are deletions; words underlined are additions. hb1365-00 Page 1 of 3 F L O R I D A H O U S E O F R E PR E S E N T A T I V ES A bill to be entitled 1 An act relating to the Vulnerable Child Protection 2 Act; creating s. 456.0335, F.S.; providing a short 3 title; defining the term "sex"; providing criminal 4 penalties for health care practitioners who engage in 5 or cause specified practices to be performed on a 6 minor under certain conditions; providing 7 applicability; providing an effective date. 8 9 Be It Enacted by the Legislature of the State of Florida: 10 11 Section 1. Section 456.0335, Florida Statutes, is created 12 to read: 13 456.0335 Vulnerable Child Protection Act.'-- 14 (1) This section may be cited as the "Vulnerable Child 15 Protection Act." 16 (2) As used in this section, the term "sex" means the 17 biological state of being female or male based on sex organs, 18 chromosomes, and endogenous hormone profiles. 19 (3) A health care practitioner who engages in any of the 20 following practices upon a minor, or who causes such practices 21 to be performed upon a minor, for the purpose of attempting to 22 change the minor's sex, or for the purpose of affirming the 23 minor's perception of the minor's sex if that perception is 24 inconsistent with the minor's sex, commits a felony of the 25
HB 1365 2020 CODING: Words stricken are deletions; words underlined are additions. hb1365-00 Page 2 of 3 F L O R I D A H O U S E O F R E PR E S E N T A T I V ES second degree, punishable as provided in s. 775.082, s. 775.083, 26 or s. 775.084: 27 (a) Performing surgeries that sterilize, including 28 castration, vasectomy, hysterectomy, oophorectomy, 29 metoidioplasty, orchiectomy, penectomy, phalloplasty, and 30 vaginoplasty; 31 (b) Performing a mastectomy; 32 (c) Administering, prescribing, or supplying the following 33 medications that induce transient or permanent infertility: 34 1. Puberty-blocking medication, which stops or delays 35 normal puberty; 36 2. Supraphysiologic doses of testosterone, to females; or 37 3. Supraphysiologic doses of estrogen, to males; or 38 (d) Removing any otherwise healthy or nondiseased body 39 part or tissue. 40 (4) This section does not apply to a health care 41 practitioner acting in accordance with a good faith medical 42 decision of a parent or guardian of a minor born with a 43 medically verifiable genetic disorder of sex development, 44 including: 45 (a) External biological sex characteristics that are 46 unresolvably ambiguous, such as the minor being born with having 47 46 XX chromosomes with virilization, 46 XY chromosomes with 48 undervirilization, or both ovarian and testicular tissue. 49 (b) A sexual development disorder whereby a physician has 50
HB 1365 2020 CODING: Words stricken are deletions; words underlined are additions. hb1365-00 Page 3 of 3 F L O R I D A H O U S E O F R E PR E S E N T A T I V ES determined through genetic testing that the minor does not have 51 the normal chromosome structure for a male or a female. 52 Section 2. This act shall take effect July 1, 2020. 53
What the Hell Is China Doing on the Dark Side of the Moon?
Wed, 05 Feb 2020 09:30
One year ago last month, a Chinese robot touched down on the dark side of the moon.
It was the first probe to land on the side of the moon that permanently faces away from Earth as both bodies circle around the sun. And if Beijing realizes its ambitions in coming years, it won't be the last time it makes history'--and threatens U.S. dominance in space.
The Chang'e 4 probe and the Yutu 2 rover it carried have stayed busy photographing and scanning minerals, cultivating cotton, potato and rapeseeds, growing yeast, and hatching fruit-fly eggs in the moon's low gravity.
The experiments are intriguing in their own right, but China's real agenda is more than scientific. For decades, Beijing has been building the infrastructure for an eventual manned mission to the moon, effectively duplicating what the United States achieved in 1969 and hopes to achieve again before 2024.
The reasons for this latter-day space race are clear, experts said, even if the real-world pay-off isn't.
''Space has always been symbolic of leadership, through prestige, that translates into strategic influence,'' Joan Johnson-Freese, a space expert at the Naval War College in Rhode Island, told The Daily Beast. ''China seeks to be acknowledged as the technology leader in Asia, and there is no more visible place to do that than space.''
While the current, high-profile U.S. moon mission is mired in Trump-era politics, China's keeps plodding forward with fewer bold pronouncements and more actual accomplishments.
As Chang'e 4 and Yutu 2 work away, the China National Space Administration is quietly planning a follow-up probe. Chang'e 5 could blast off this year. Unlike the one-way Chang'e 4, which is limited to bouncing back data via a relay satellite, its successor is designed to collect samples and bring them back to Earth.
Meanwhile, the Chinese space agency has resumed work on its Tiangong 3 space station and is also testing a new manned capsule for deep-space missions.
When the 22-year-old, U.S.-led International Space Station finally craps out some time in the late 2020s or early 2030s, Tiangong could become the only permanent habitat in low Earth orbit. If the United States wants to maintain a significant human presence over Earth after the ISS, it might have no choice but to ask China for permission to embark.
That would make Tiangong the ''de facto international space station,'' Johnson-Freese argued. Neither NASA nor the Chinese space agency responded to requests for comment.
''China is in a no-lose situation,'' Johnson-Freese added via email. ''It can 'beat' the U.S. (back) to the Moon'--or not'--but soon thereafter be able to say anything the U.S. can do, we can do, too.''
To be clear, the United States isn't standing still in space. NASA still leads the International Space Station and in recent years convinced Congress to keep the station in service as long as its basic components were safe and economical.
The U.S. space agency is also deploying a new space telescope and sending probes across the solar system as part of an ever-expanding search for extraterrestrial life.
And then there's the moon. NASA for years has mulled returning human explorers to the lunar surface for the first time since 1972. Not only is there plenty of science to be done, but the moon could also function as a staging base for astronauts heading to Mars. To say nothing of the commercial value of the moon's minerals.
Last year, the Trump administration slapped an arbitrary 2024 deadline on a new manned lunar landing. That year, of course, represents the close of a possible second term for Trump. Experts actually tend to agree 2024 is possible, but only if Congress coughs up $30 billion'--and if there are zero problems developing all the hardware a moon landing requires. Tools like a new heavy rocket, a manned capsule, and a lander.
Rather than flying astronauts directly to the moon, NASA wants to build a lunar space station that could support both moon landings and future Mars missions. That complicates an American return to the moon and underscores the difference between the U.S. and Chinese approaches to space exploration.
''What China has that the U.S. has not, is long-term program-sustainability,'' Johnson-Freese said. ''The U.S. human exploration program has been operating in fits and starts because each new administration wants to put its stamp on whatever exploration program is announced, with a timetable, but often missing the necessary budget to make it actually feasible.''
Trump's Moon shot has already shown signs of falling apart. Developing the manned lander was always the riskiest part, according to John Logsdon, a professor emeritus of political science and international affairs at George Washington University and a former NASA adviser. NASA hasn't built one in nearly half a century.
Wary of throwing good money after bad, Congress approved only half of the billion dollars NASA wanted for the mission in 2020. ''Our appetite doesn't match our allocations,'' Logsdon told The Daily Beast.
China's more deliberate journey into space could be an attractive model for other, smaller space-faring countries. For decades, the United States has been the world leader in space, organizing other nations'--including rivals like Russia'--to explore the galaxy for the benefit of all humankind.
That could change as the competing moon missions'--and the geopolitical fault lines they reflect'--come into clearer focus.
''As U.S. leadership continues to erode under President Trump, other nations, especially Japan and the E.U., may begin to consider acting more independently and join China in more substantial cooperative space projects,'' Gregory Kulacki, a space expert with the Massachusetts-based Union of Concerned Scientists, told The Daily Beast.
It could be decades before the end-game is clear, Christopher Impey, a University of Arizona astronomer, told The Daily Beast. ''If you take the long view, which the Chinese always do, in 50 to 100 years we will be living in the solar system and there will be a substantial economic activity off-Earth,'' he said.
''They want to be first,'' Impey added of the Chinese, ''and they want to be in the driver's seat for that future.''
Creator Of US BioWeapons Act Says Coronavirus Is Biological Warfare Weapon | Zero Hedge
Wed, 05 Feb 2020 09:02
In an explosive interview Dr. Francis Boyle, who drafted the Biological Weapons Act has given a detailed statement admitting that the 2019 Wuhan Coronavirus is an offensive Biological Warfare Weapon and that the World Health Organization (WHO) already knows about it.
Dr. Francis Boyle Creator Of BioWeapons Act Says Coronavirus Is Biological Warfare Weapon
Francis Boyle is a professor of international law at the University of Illinois College of Law. He drafted the U.S. domestic implementing legislation for the Biological Weapons Convention, known as the Biological Weapons Anti-Terrorism Act of 1989, that was approved unanimously by both Houses of the U.S. Congress and signed into law by President George H.W. Bush.
In an exclusive interview given to Geopolitics and Empire, Dr. Boyle discusses the coronavirus outbreak in Wuhan, China and the Biosafety Level 4 laboratory (BSL-4) from which he believes the infectious disease escaped. He believes the virus is potentially lethal and an offensive biological warfare weapon or dual-use biowarfare weapons agent genetically modified with gain of function properties, which is why the Chinese government originally tried to cover it up and is now taking drastic measures to contain it.
The Wuhan BSL-4 lab is also a specially designated World Health Organization (WHO) research lab and Dr. Boyle contends that the WHO knows full well what is occurring.
Dr. Boyle also touches upon
GreatGameIndia's exclusive report
Coronavirus Bioweapon '' where we reported in detail how Chinese Biowarfare agents working at the Canadian lab in Winnipeg were involved in the smuggling of Coronavirus to Wuhan's lab from where it is believed to have been leaked.
Watch Dr. Francis Boyle's interview with Geopolitics and Empire below:
If playback doesn't begin shortly, try restarting your device.
You're signed out
Videos you watch may be added to the TV's watch history and influence TV recommendations. To avoid this, cancel and sign in to YouTube on your computer.
Share
Include playlistAn error occurred while retrieving sharing information. Please try again later.
Dr. Boyle's position is in stark contrast to the mainstream media's narrative of the virus being originated from the seafood market, which is increasingly being questioned by many experts.
In a video accompanying his post, Cotton explained that the Wuhan wet market (which Cotton incorrectly referred to as a seafood market) has been shown by experts to not be the source of the deadly contagion.
Cotton referenced a
Lancet study which showed that many of the first cases of the novel coronavirus, including patient zero, had no connection to the wet market '-- devastatingly undermining mainstream media's claim.
''As one epidemiologist said: 'That virus went into the seafood market before it came out of the seafood market.' We still don't know where it originated,'' Cotton said.
''I would note that Wuhan also has China's only bio-safety level four super laboratory that works with the world's most deadly pathogens to include, yes, coronavirus.''
Such concerns have also been raised by J.R. Nyquist, the well known author of the books ''Origins of the Fourth World War'' and ''The Fool and His Enemy,'' as well as co-author of ''The New Tactics of Global War''. In his
insightful article he published secret speechs given to high-level Communist Party cadres by Chinese Defense Minister Gen. Chi Haotian explaining a long-range plan for ensuring a Chinese national renaissance '' the catalyst for which would be
China's secret plan to weaponiz viruses.
Nyquist gave three different data points for making his case in analyzing Coronavirus. He writes:
The third data point worth considering: the journal GreatGameIndia has published a piece titled ''Coronavirus Bioweapon '' How China Stole Coronavirus From Canada And Weaponized It.''NEVER MISS THE NEWS THAT MATTERS MOST
ZEROHEDGE DIRECTLY TO YOUR INBOX
Receive a daily recap featuring a curated list of must-read stories.
Thank you for subscribing!
Something went wrong. Please refresh and try again.
It is not
GreatGameIndia alone which is being viciously attacked. Zero Hedge, a popular alternate media blog was suspended by Twitter for publishing a story related to a
study by Indian scientists finding
2019 Wuhan Coronavirus to be
not naturally evolved, raising the possibility of it being created in a lab. Shockingly, the study itself came under intense online criticism by Social Media experts resulting in the scientists withdrawing the paper.
The study came under the scanner as two of the 12 researchers belonged to the Wuhan Institute of Virology's Department of Emerging Infectious Diseases, and it was funded by the United States Department of Defense's Defense Threat Reduction Agency (DTRA).
The study, conducted by scientists of the Tata Institute of Fundamental Research, the National Centre for Biological Sciences (NCBS), the Wuhan Institute of Virology, the Uniformed Services University of the Health Sciences in the U.S. and the Duke-National University in Singapore, is now being investigated for how the scientists were allowed to access live samples of bats and bat hunters (humans) without due permissions.
The results of the study were published in October last year in the PLOS Neglected Tropical Diseases journal, originally established by the Bill and Melinda Gates Foundation.
As the author J.R. Nyquist puts it:
We must have an investigation of the outbreak in Wuhan. The Chinese must grant the world total transparency. The truth must come out. If Chinese officials are innocent, they have nothing to hide. If they are guilty, they will refuse to cooperate.
The real concern here is whether the rest of the world has the courage to demand a real and thorough investigation. We need to be fearless in this demand and not allow ''economic interests'' to play a coy and dishonest game of denial. We need an honest inquiry. We need it now.
QuickTake by Bloomberg on Twitter: "JUST IN: More than 10 people aboard a Japanese cruise liner have tested positive for #coronavirus, Japan's @tbs_news reported, after all 3,000+ passengers were quarantined earlier Tuesday https://t.co/I6Z4iqIMEB" / Twit
Wed, 05 Feb 2020 00:41
Log in Sign up QuickTake by Bloomberg @ QuickTake JUST IN: More than 10 people aboard a Japanese cruise liner have tested positive for
#coronavirus, Japan's
@tbs_news reported, after all 3,000+ passengers were quarantined earlier Tuesday
pic.twitter.com/I6Z4iqIMEB 3:05 PM - 4 Feb 2020 Twitter by: QuickTake by Bloomberg @QuickTake QuickTake by Bloomberg @ QuickTake
5h Replying to
@tbs_news @business Latest developments of the
#CoronavirusOutbreak:- At least 490 dead, 24,324 confirmed cases in China- WHO puts outbreak costs at $675.7 million- 10 passengers on Japan cruise have
#coronavirus- WHO: 684 people recoveredMore
@business:
bloom.bg/31xaaxt #新型肺炎 pic.twitter.com/DT3HqpbIfq View conversation · QuickTake by Bloomberg @ QuickTake
4h Replying to
@tbs_news @business Here's how China is disinfecting areas during a virus outbreak: Drones
#CoronavirusChina #Coronavirus #新型肺炎 pic.twitter.com/Ot1XqJM47k View conversation · QuickTake by Bloomberg @ QuickTake
2h Replying to
@tbs_news @business China is using robots to help treat
#coronavirus patients amid a
#CoronavirusOutbreak. Here's how
#新型肺炎 pic.twitter.com/7UF4PFeqOd View conversation · QuickTake by Bloomberg @ QuickTake
20m Replying to
@tbs_news @business ''The biggest problem is the food problem.''Hong Kong is keeping 1,800+ passengers and crew members under quarantine on a cruise ship after 3
#coronavirus patients were on board
#CoronavirusOutbreak #新型肺炎 pic.twitter.com/x9HszQz5Nk View conversation · John Cook @ CookJohnC
7h Replying to
@QuickTake @tbs_news Better hope coronavirus is less infectious than norovirus...
View conversation · Drew Maw @ drewmaw
7h Replying to
@CookJohnC @QuickTake @tbs_news Recent study shows that the virus can be infectious on surfaces from 5-28 Days. Also, in enclosed environments like this, it's well documented that mutation of viruses is faster than usual, especially on cruise ships. It may have already mutated.
View conversation · ŰtakðŸ-->> @ tak15773626
8h Replying to
@QuickTake @tbs_news This is like a film.
View conversation · Chris Spavins @ EmpireChris1
6h Replying to
@tak15773626 @QuickTake @tbs_news Sci Fi horror film.
View conversation · Qgirl @ Qgirl50
7h Replying to
@QuickTake @tbs_news So are they keeping them all on the ship for 14 days?
View conversation · Chris Spavins @ EmpireChris1
6h Replying to
@Qgirl50 @QuickTake @tbs_news I think they'll need to evacuate the ship and quarantine passengers and the crew. The crew will undoubtedly be the first to get sick. Bigger question is was this first infected person a super spreader. Other question is does cruise ship industry shut down.
View conversation · Enter a topic, @name, or fullname
Settings Help Back to top ·
Turn images off
Head of Shadow Inc. feels 'really terrible' about screwing up Iowa caucus
Wed, 05 Feb 2020 00:31
News
By Ben Feuerherd
February 5, 2020 | 1:19am
Shadow Inc. CEO Gerard Niemira ACRONYM
The CEO of the tech company whose app wreaked havoc in the Iowa caucus on Monday night apologized for the debacle on Tuesday, saying they ''feel really terrible'' for the snafu.
Gerard Niemira, the head of Shadow Inc., told Bloomberg News that the reporting problems were caused by a bug that transports results to the party's main database.
''I'm really disappointed that some of our technology created an issue that made the caucus difficult. We feel really terrible about that,'' Niemira told Bloomberg.
''All the data that was produced by calculations performed by the app was correct. It did the job it was supposed to do, which is help precinct chairs in the field do the math correctly,'' he added.
''The problem was caused by a bug in the code that transmits results data into the state party's data warehouse,'' Niemira told Bloomberg. The glitch, he added, ''had catastrophic impact.''
Niemira had previously boasted about creating digital tools for Hillary Clinton's botched 2016 presidential bid before being contracted by Iowa's Democratic Party in 2019.
Iowa Democratic officials have blamed the delay in the release of Monday night's results on the app, with party chair Troy Price saying it was only reporting partial data due to a ''coding issue.''
Precinct chairs across the state experienced problems downloading or logging into the app, one of the ways they were supposed to be able to send the results from their smaller, individual caucuses to the Iowa Democratic Party (IDP).
List of Presidential Medal of Freedom recipients - Wikipedia
Tue, 04 Feb 2020 23:34
This is a partial list of recipients of the Presidential Medal of Freedom, listed chronologically within the aspect of life in which each recipient is or was renowned.
The Presidential Medal of Freedom is awarded by the president of the United States "for especially meritorious contribution to (1) the security or national interests of the United States, or (2) world peace, or (3) cultural or other significant public or private endeavors". Honorees are selected by the president or recommended to them by the Distinguished Civilian Service Awards Board.[1]
Typically the medal is bestowed upon the recipient by the sitting president who has chosen them. However, the first recipients selected by President John F. Kennedy before his assassination were formally awarded by his successor in office, Lyndon B. Johnson.[2]President Barack Obama awarded 123 medals, the most ever, followed by President Ronald Reagan with 102 medal recipients.[3][4][5]Two people, Ellsworth Bunker and Colin Powell, are two-time recipients of the Presidential Medal of Freedom. Colin Powell received his second award with Distinction,[6] while Ellsworth Bunker was given both of his awards with distinction.This list does not include those awarded the similarly named but very distinct Medal of Freedom, an antecedent award issued prior to 1963.
Arts Architecture Art Dance Movies & Theater Literature Music Photography Business and economics Computing Vinton Cerf and Bob Kahn, 2005
Education History Humanitarian Law Attorneys and judges Supreme Court justices Media Journalism Radio Television Medicine Military Philanthropy Philosophy Politics and government Activism Diplomacy Environmentalism Intelligence Foreign statesmen and stateswomen U.S. Cabinet members U.S. first ladies Members of the U.S. Congress U.S. presidents Former President Ronald Reagan, January 13, 1993
U.S. vice presidents President Obama awarding the Presidential Medal of Freedom with Distinction to
Vice President Joe Biden on January 12, 2017.
Other political figures Religion Science Space exploration The Apollo 13 astronauts are awarded the medal by President Richard Nixon in 1970
Sports Bibliography Wetterau, Bruce. The Presidential Medal of Freedom: Winners and Their Achievements . p. 513. ISBN 978-1-56802-128-7. '' contains a list of awardees from 1963 to approximately 1995References ^ Executive Order 11085 The Presidential Medal of Freedom, retrieved July 30, 2009 Archived May 30, 2009, at the Wayback Machine ^ Woolley, John T; Gerhard Peters. "Remarks With Under Secretary of State George W. Ball at the Presentation of the Medal of Freedom Awards, December 6, 1963". The American Presidency Project. University of California, Santa Barbara . Retrieved February 9, 2011 . ^ "Medal of Freedom Ceremony" (August 12, 2009) Archived August 12, 2009, at the Wayback Machine, a news release, August 12, 2009, from the White House Press Secretary at whitehouse.gov, the White House's official website. Retrieved August 22, 2009. ^ a b c d e f g h i j k l m n o p "President Obama Names Presidential Medal of Freedom Recipients". whitehouse.gov. The White House. November 17, 2010 . Retrieved November 18, 2010 . ^ a b c d e f g h i j k l m n o p q r s t u v w Secretary of the Senate, United States Congress. "Presidential Medal of Freedom Recipients". Official Website of the United States Senate. United States Senate (Government of the United States) . Retrieved November 14, 2011 . ^ a b Clinton, W. J. (September 30, 1993). "Remarks on the Retirement of General Colin Powell in Arlington, Virginia". University of California, Santa Barbara: The American Presidency Project . Retrieved September 18, 2016 . In recognition of your legacy and service, of your courage and accomplishment, today, General Powell, I was honored to present you with the Presidential Medal of Freedom, with distinction. I want to tell all those here in attendance that this was the second Medal of Freedom you have received, the first from President Bush in 1991. And today, you became only the second American citizen in the history of the Republic to be the recipient of two Medals of Freedom. ^ Woolley, John T; Gerhard Peters. "Remarks With Under Secretary of State George W. Ball at the Presentation of the Medal of Freedom Awards, December 6, 1963". The American Presidency Project. University of California, Santa Barbara . Retrieved February 9, 2011 . Mr. Ludwig Mien van der Rohe...THE PRESIDENT. Teacher, designer, master builder, he has conceived soaring structures of glass, steel and concrete which at once embody and evoke the distinctive qualities of our age. ^ "Frank Gehry and Maya Lin Awarded Obama's Presidential Medal of Freedom". ArchDaily. November 17, 2016 . Retrieved November 21, 2017 . ^ "Curriculum Vitae of I. M. Pei". Pei Cobb Freed & Partners . Retrieved July 20, 2009 . ^ a b c d e f g h i j k l m n o p q r s t "President Obama Names Recipients of the Presidential Medal of Freedom". whitehouse.gov. The White House. November 16, 2016 . Retrieved November 16, 2016 . ^ "30 Receive Freedom Medal at the White House". www.nytimes.com . Retrieved November 21, 2017 . ^ Wolley, John T.; Gerhard Peters (June 9, 1980). "Gerald Ford, XXXVIII President of the United States: 1974''1977, Remarks Upon Presenting the Presidential Medal of Freedom, January 10, 1977". The American Presidency Project. www.presidency.ucsb.edu . Retrieved May 22, 2011 . NORMAN ROCKWELL...Normal Rockwell, represented by his son, Jarvis Rockwell. "Artist, illustrator and author, Norman Rockwell has portrayed the American scene with unrivaled freshness and clarity. Insight, optimism and good humor are the hallmarks of his artistic style. His vivid and affectionate portraits of our country and ourselves have become a beloved part of the American tradition." ^ The National First Ladies Library (November 16, 2010). Heroes of the Presidential Medal of Freedom (PDF) . Canton Ohio. p. 3 . Retrieved February 11, 2011 . Georgia O'Keeffe (1887''1986)...Presidential Medal of Freedom received January 10, 1977 ^ Wolley, John T.; Gerhard Peters (June 9, 1980). "Gerald Ford, XXXVIII President of the United States: 1974''1977, Remarks Upon Presenting the Presidential Medal of Freedom, January 10, 1977". The American Presidency Project. www.presidency.ucsb.edu . Retrieved May 22, 2011 . But let me again congratulate each and every one of you. I regret that Irving Berlin, Alexander Calder, the late Alexander Calder, and Georgia O'Keeffe were unable to be represented here today. We will of course present their medals to them or to their families at a later date. ^ "Capt. Walker Kirtland Hancock ( 1901-1998 )". Monuments Men Foundation for the Preservation of Art . Retrieved June 24, 2018 . ^ Woolley, John T; Gerhard Peters. "Gerald R. Ford, XXXVIII President of the United States: 1974''1977, Remarks Upon Presenting the Presidential Medal of Freedom to Martha Graham, October 14, 1976". The American Presidency Project. University of California, Santa Barbara . Retrieved February 9, 2011 . [At this point, the President read the citation, the text of which follows:] The President of the United States of America Awards this Presidential Medal of Freedom With Distinction to Martha Graham. Dancer, teacher, and choreographer, Martha Graham has captivated the world with her magic and has left a legacy of imagination with all who have witnessed her talent. Her energy, creativity and daring have opened new doors of expression in dance. Her followers and friends adore her, and her country, the United States of America, is proud to proclaim her a brilliant star and a National treasure. ^ "Jimmy Carter: Presidential Medal of Freedom Remarks at the Presentation Ceremony". www.presidency.ucsb.edu . Retrieved November 21, 2017 . ^ "Ronald Reagan: Remarks at the Presentation Ceremony for the Presidential Medal of Freedom". www.presidency.ucsb.edu . Retrieved November 21, 2017 . ^ Woolley, John T; Gerhard Peters. "Ronald Reagan, XL President of the United States: 1981''1989, Remarks at the Presentation Ceremony for the Presidential Medal of Freedom, March 26, 1984". The American Presidency Project. University of California, Santa Barbara . Retrieved February 11, 2011 . Lincoln Kirstein: Lincoln Kirstein is an author and entrepreneur who has honored and delighted Americans through his enormous contribution to ballet in our country. Through his commitment, two major institutions of American dance, the New York City Ballet and the School of American Ballet, were created and flourished. Developing and fostering appreciation for the arts have always depended on the energy, creativity, and commitment of individual citizens. Lincoln Kirstein stands tall as one of a select and treasured few in the world of American art. ^ a b c d e f g h i j k l "President Obama Names Medal of Freedom Recipients; 16 Agents of Change to Receive Top Civilian Honor". White House. July 30, 2009. Archived from the original on December 15, 2009 . Retrieved August 12, 2009 . ^ a b c d e f g h i j k l m "President Obama Announces the Presidential Medal of Freedom Recipients". The White House. November 10, 2014 . Retrieved November 11, 2014 . ^ Woolley, John T; Gerhard Peters. "Lyndon B. Johnson, XXXVI President of the United States: 1963''1969, Remarks at the Presentation of the 1964 Presidential Medal of Freedom Awards, March 26, 1984". The American Presidency Project. University of California, Santa Barbara . Retrieved May 22, 2011 . Mr. Walter Disney. THE PRESIDENT. Artist and impresario, in the course of entertaining an age, he has created an American folklore. ^ a b Woolley, John T; Gerhard Peters. "Lyndon B. Johnson, XXXVI President of the United States: 1963''1969, Remarks at the Presentation of the 1964 Presidential Medal of Freedom Awards, March 26, 1964". The American Presidency Project. University of California, Santa Barbara . Retrieved May 22, 2011 . Mr. Alfred Lunt and Miss Lynn Fontainne. THE PRESIDENT. A luminous partnership of artistic talents and personal devotion they have brilliantly enlivened and enriched the American stage. ^ "Public Service - Bob Hope and American Variety | Exhibitions (Library of Congress)". www.loc.gov. May 10, 2000 . Retrieved November 21, 2017 . ^ Wolley, John T.; Gerhard Peters (June 9, 1980). "Jimmy Carter, XXXIX President of the United States: 1977''1981, Presidential Medal of Freedom Remarks at the Presentation Ceremony, June 9, 1980". The American Presidency Project. www.presidency.ucsb.edu . Retrieved May 22, 2011 . All of these are famous people, they're well-known throughout the world. But even including Vice Presidents and Presidents, noted singers and dancers and writers and ornithologists, I think the next would be the most famous of us all, including the one who reads this citation. I would like to ask Mrs. John Wayne to come forward. [At this point, the President read the citation, the text of which follows: THE PRESIDENT OF THE UNITED STATES OF AMERICA AWARDS THIS PRESIDENTIAL MEDAL OF FREEDOM TO JOHN WAYNE. John Wayne was both an example and a symbol of true American grit and determination. Through his countless film roles, "The Duke" still leads millions on heroic adventures on behalf of fairness and justice. He embodies the enduring American values of individualism, relentless bravery and perseverance in pursuit of what is right. He was the quintessential patriot, and will especially be remembered whenever our Nation faces a challenge calling for steadfast courage.] ^ Woolley, John T; Gerhard Peters. "Ronald Reagan, XL President of the United States: 1981''1989, Remarks at the Presentation Ceremony for the Presidential Medal of Freedom, March 26, 1984". The American Presidency Project. University of California, Santa Barbara . Retrieved February 11, 2011 . As a giant in the world of entertainment, James Cagney has left his mark not only on the film industry but on the hearts of all his fellow Americans. In some 60 years in entertainment, performing on stage and screen, he mastered drama and action adventure, as well as music and dance. One of his most remembered performances, as George M. Cohan in "Yankee Doodle Dandy," was a whirlwind singing and dancing film that inspired a Nation at war when it sorely needed a lift in spirit. James Cagney's professional and personal life has brought great credit to him and left unforgettable memories with millions who have followed his career. ^ a b c d e f g h i j k l m n o "President Obama Names Recipients of the Presidential Medal of Freedom". The White House. November 16, 2015 . Retrieved November 16, 2015 . ^ Wolley, John T.; Gerhard Peters (June 9, 1980). "Gerald Ford, XXXVIII President of the United States: 1974''1977, Remarks Upon Presenting the Presidential Medal of Freedom, January 10, 1977". The American Presidency Project. www.presidency.ucsb.edu . Retrieved May 22, 2011 . Archibald MacLeish, represented by his nephew, Roderick MacLeish. "Poet and playwright, teacher and statesman, Archibald MacLeish has combined the vocation of man of letters with that of public spokesman. A poet of realities as well as dreams, his eloquent words are matched by his sensitive social conscience. He seeks truth inspired by love of his fellow men and of his country. We are proud to recognize his stature as a humanist, an artist, and an American." ^ Wolley, John T.; Gerhard Peters (June 9, 1980). "Gerald Ford, XXXVIII President of the United States: 1974''1977, Remarks Upon Presenting the Presidential Medal of Freedom, January 10, 1977". The American Presidency Project. www.presidency.ucsb.edu . Retrieved May 22, 2011 . JAMES ALBERT MICHENER, "Author, teacher and popular historian, James Michener has entranced a generation with his compelling essays and novels. From 'Tales of the South Pacific,' to 'Centennial,' the prolific writings of this master storyteller have expanded the knowledge and enriched the lives of million." ^ Woolley, John T; Gerhard Peters. "Ronald Reagan, XL President of the United States: 1981''1989, Remarks at the Presentation Ceremony for the Presidential Medal of Freedom, March 26, 1984". The American Presidency Project. University of California, Santa Barbara . Retrieved February 11, 2011 . Louis L'Amour: Through his western novels, Louis L'Amour has played a leading role in shaping our national identity. His writings portrayed the rugged individual and the deep-seated values of those who conquered the American frontier. Starting out from humble beginnings, he has lived a fulfilling and adventurous life. An eminently successful writer, more than 100 million copies of his novels are in print, L'Amour's descriptions of America and Americans have added to our understanding of our past and reaffirmed our potential as an exploring, pioneering, and free people. ^ a b c d e f g h i j k l m "Albright, World War II hero among 13 to receive Presidential Medal of Freedom". CNN . Retrieved May 29, 2012 . ^ The National First Ladies Library (November 16, 2010). Heroes of the Presidential Medal of Freedom (PDF) . Canton Ohio. p. 3 . Retrieved February 11, 2011 . Marian Anderson (1897''1993)...Presidential Medal of Freedom received December 6, 1963 ^ a b c d e f g h i j Nordlinger, Jay (December 17, 2007). "Medals of Freedom". National Review . Retrieved October 14, 2019 . ^ Woolley, John T; Gerhard Peters. "Ronald Reagan, XL President of the United States: 1981''1989, Remarks at the Presentation Ceremony for the Presidential Medal of Freedom, March 26, 1984". The American Presidency Project. University of California, Santa Barbara . Retrieved February 11, 2011 . Ernest Jennings "Tennessee Ernie" Ford: Through his musical talents, warm personality, and quick "down-home" wit Tennessee Ernie Ford won the hearts of the American people. Ford's music, which revealed his character and soul to all who listened, inspired as well as entertained his audiences. His respect for traditional values, his strong faith in God, and his unlimited capacity for human kindness have greatly endeared him to his fellow countrymen. America is a Nation richer in spirit because of Tennessee Ernie Ford. ^ a b c d e f g h i j k l m n "President Obama Names Presidential Medal of Freedom Recipients". Office of the Press Secretary, The White House. August 8, 2013 . Retrieved August 8, 2013 . ^ "The Presidential Medal of Freedom". The White House . Retrieved November 25, 2016 . ^ a b c d e f g "Trump names Medal of Freedom recipients | 11/10/2018". kinja.com . Retrieved November 10, 2018 . ^ "Clarence B. Randall, 76, Dies". Chicago Tribune. August 6, 1967 . Retrieved January 13, 2017 . ^ Schulman, Kori (November 10, 2014). "President Obama Announces the Presidential Medal of Freedom Recipients". whitehouse.gov . Retrieved June 8, 2017 . ^ "Trump awards Presidential Medal of Freedom to economist Arthur Laffer". Washington Post. June 19, 2019. ^ McFeatters, Ann (July 10, 2002). "Fred Rogers gets Presidential Medal of Freedom". Pittsburgh Post-Gazette. www.post-gazette.com . Retrieved February 9, 2011 . Intel Corp. co-founder Gordon Moore. Through the Gordon and Betty Moore Foundation, Moore is a philanthropic leader in higher education, scientific research, the environment and San Francisco Bay Area projects. ^ Vargas, Jose Antonio (November 10, 2005). "At the White House, Prizes for 14 Champs,Medal of Freedom Ceremony Shows Ali as Fast as Ever". The Washington Post. washingtonpost.com . Retrieved February 9, 2011 . Also honored yesterday...Vinton Cerf and Robert Kahn, the men who in figuring out how to routinely and quickly transmit data over computer networks helped start a digital revolution ^ "Net pioneers receive top honour". BBC News. www.bbc.com. November 10, 2005 . Retrieved February 9, 2011 . "Dr Cerf and Dr Kahn have been at the forefront of a digital revolution that has transformed global commerce, communication, and entertainment," read the citation for the medal. ^ The National First Ladies Library (November 16, 2010). Heroes of the Presidential Medal of Freedom (PDF) . Canton Ohio. p. 3 . Retrieved February 11, 2011 . Annie Wauneka (1910''1997)...Presidential Medal of Freedom received December 6, 1963 ^ Woolley, John T; Gerhard Peters. "Ronald Reagan, XL President of the United States: 1981''1989, Remarks at the Presentation Ceremony for the Presidential Medal of Freedom, March 26, 1984". The American Presidency Project. University of California, Santa Barbara . Retrieved February 11, 2011 . Eunice Kennedy Shriver: With enormous conviction and unrelenting effort, Eunice Kennedy Shriver has labored on behalf of America's least powerful people, the mentally retarded. Over the last two decades, she has been on the forefront of numerous initiatives on the behalf of the mentally retarded, from creating day camps, to establishing research centers, to the founding of the Special Olympics. Her decency and goodness have touched the lives of many, and Eunice Kennedy Shriver deserves America's praise, gratitude, and love. ^ "Jimmy Carter: Presidential Medal of Freedom Remarks at the Presentation Ceremony". ^ Woolley, John T; Gerhard Peters. "Remarks With Under Secretary of State George W. Ball at the Presentation of the Medal of Freedom Awards, December 6, 1963". The American Presidency Project. University of California, Santa Barbara . Retrieved February 9, 2011 . Mr. Ball: And now, Mr. President, let me present those who are to receive the Presidential Medal of Freedom with Special Distinction....Mr. Justice Felix Frankfurter. THE PRESIDENT. Jurist, scholar, counselor, conversationalist, he has brought to all his roles a zest and wisdom which has made him teacher to his time. ^ "President Honors 2003 Presidential Medal of Freedom Recipients". ^ The National First Ladies Library (November 16, 2010). Heroes of the Presidential Medal of Freedom (PDF) . Canton Ohio. p. 3 . Retrieved February 11, 2011 . Justice Sandra Day O'Connor (1930 '' )...Presidential Medal of Freedom received August 12, 2009 ^ a b c d e f g Nixon, Richard (April 22, 1970). "Remarks on Presenting the Presidential Medal of Freedom to Eight Journalists". Online by Gerhard Peters and John T. Woolley, The American Presidency Project. Archived from the original on December 25, 2011 . Retrieved December 25, 2011 . ^ a b Wolley, John T.; Gerhard Peters (January 10, 1977). "Gerald Ford, XXXVIII President of the United States: 1974''1977, Remarks Upon Presenting the Presidential Medal of Freedom, January 10, 1977". The American Presidency Project. www.presidency.ucsb.edu . Retrieved May 22, 2011 . ^ Collins, Kaitlan (February 4, 2020). "Trump says he will award Rush Limbaugh with Medal of Freedom". CNN. Archived from the original on February 5, 2020 . Retrieved February 4, 2020 . ^ "NATION : Lucille Ball Gets Medal of Freedom". Los Angeles Times. July 6, 1989 . Retrieved May 22, 2011 . ^ M, Nixon, Richard (January 1, 1975). Public Papers of the Presidents of the United States: Richard M. Nixon, 1974. Best Books on. ISBN 9781623769239. ^ Woolley, John T; Gerhard Peters. "Ronald Reagan, XL President of the United States: 1981''1989, Remarks at the Presentation Ceremony for the Presidential Medal of Freedom, March 26, 1984". The American Presidency Project. University of California, Santa Barbara . Retrieved February 11, 2011 . Dr. Denton Cooley: In an outstanding professional career, Dr. Denton Cooley has distinguished himself time and again in the field of medicine. As one of this country's leading heart surgeons, he has charted new territory in his search for ways to prolong and enrich human life. His efforts have saved the lives not only of his own patients, but of those of many other doctors who have studied and mastered techniques developed by him. As a heart surgeon and as a creative, independent thinker, Dr. Denton Cooley is a force for innovation in American medicine. ^ "The Presidential Medal of Freedom". The White House. Archived from the original on May 4, 2017 . Retrieved August 20, 2017 . ^ Wolley, John T.; Gerhard Peters (January 10, 1977). "Gerald Ford, XXXVIII President of the United States: 1974''1977, Remarks Upon Presenting the Presidential Medal of Freedom, January 10, 1977". The American Presidency Project. www.presidency.ucsb.edu . Retrieved May 22, 2011 . WILL DURANT "Writer, historian and philosopher, Will Durant has provided an open window into the lives and thoughts of past ages. With the collaboration of his wife, Ariel, he has helped lead us through the past to the meaning of the present. An eloquent apostle of social order and individual freedom, he is an enemy of chaos, a friend and an invaluable guide to the millions of grateful readers." ^ Woolley, John T; Gerhard Peters. "Ronald Reagan, XL President of the United States: 1981''1989, Remarks at the Presentation Ceremony for the Presidential Medal of Freedom, March 26, 1984". The American Presidency Project. University of California, Santa Barbara . Retrieved February 11, 2011 . Dr. Hector Garcia: Dr. Hector Garcia's patriotism and community concern exemplify the meaning of good citizenship. His many community-building endeavors included his work as a founder and first National Chairman of the American G.I. Forum, a veterans' organization which has done much to improve the lot of Americans of Mexican descent. Over the years, he has faithfully represented our government on numerous occasions, overseas and domestically. Dr. Hector Garcia is a credit to his family and community, and to all Americans. Through his efforts, based on a deep belief in traditional American ideals, he has made this a better country. ^ The National First Ladies Library (November 16, 2010). Heroes of the Presidential Medal of Freedom (PDF) . Canton Ohio. p. 3 . Retrieved February 11, 2011 . Marian Wright Edelman (1939 '' )...Presidential Medal of Freedom received August 9, 2000 ^ Woolley, John T; Gerhard Peters. "Remarks With Under Secretary of State George W. Ball at the Presentation of the Medal of Freedom Awards, December 6, 1963". The American Presidency Project. University of California, Santa Barbara . Retrieved February 9, 2011 . Mr. Ball: And now, Mr. President, let me present those who are to receive the Presidential Medal of Freedom with Special Distinction....Dr. Ralph J. Bunche. THE PRESIDENT. Scholar and diplomat, servant of the emerging world order, he has opened up new vistas in the demanding quest for international justice and peace. ^ a b Woolley, John T; Gerhard Peters. "Remarks With Under Secretary of State George W. Ball at the Presentation of the Medal of Freedom Awards, December 6, 1963". The American Presidency Project. University of California, Santa Barbara . Retrieved February 9, 2011 . Mr. Ball: And now, Mr. President, let me present those who are to receive the Presidential Medal of Freedom with Special Distinction....First, Mr. Ellsworth Bunker. THE PRESIDENT. Citizen and diplomat, he has brought integrity, patience and a compassionate understanding of other men and nations to the service of the Republic under three Presidents. ^ [1] [dead link ] ^ "President Bush Commemorates Foreign Policy Achievements and Presents Medal of Freedom to Ambassador Ryan Crocker". White House. January 15, 2009 . Retrieved January 16, 2009 . ^ "White House Freedom Medal Set for Whittaker Chambers". New York Times. February 22, 1984. Archived from the original on April 10, 2009 . Retrieved January 16, 2011 . ^ Sterling, Dorothy (March 9, 1984). "Whittaker Chambers: Odd Choice for the Medal of Freedom". New York Times . Retrieved January 16, 2011 . ^ Woolley, John T; Gerhard Peters. "Ronald Reagan, XL President of the United States: 1981''1989, Remarks at the Presentation Ceremony for the Presidential Medal of Freedom, March 26, 1984". The American Presidency Project. University of California, Santa Barbara . Retrieved February 11, 2011 . Mr. Gamal el-Sadat will accept for his father, the late President Anwar el-Sadat. President Anwar el-Sadat, as a soldier, led his country in war, but his greatest acts of courage came in pursuit of peace. He captured the imagination of people everywhere by taking the first great step toward achieving a lasting peace between Egypt and Israel. His humanity and sense of responsibility, even now that he is gone, remain a giant force for peace and stability in the world. Anwar el-Sadat was a peacemaker of monumental wisdom and tenderness who will remain forever a hero in the hearts of the American people. ^ The National First Ladies Library (November 16, 2010). Heroes of the Presidential Medal of Freedom (PDF) . Canton Ohio. p. 3 . Retrieved February 11, 2011 . Chief,Wilma Mankiller (1945''2010)...Presidential Medal of Freedom received January 15, 1998 ^ Mayer, Catherine (January 13, 2009). "A Presidential Medal for Tony Blair". Time. www.time.com . Retrieved February 9, 2011 . Later today in a ceremony in the East Room of the White House, Bush is set to dole out a Presidential Medal of Freedom to Blair. ^ Woolley, John T; Gerhard Peters. "George Bush, XLI President of the United States: 1989''1993, Remarks at the Presentation Ceremony for the Presidential Medals of Freedom and Presidential Citizen's Medals, July 3, 1991". The American Presidency Project. University of California, Santa Barbara . Retrieved February 11, 2011 . this ceremony would not be complete without honoring three more American leaders, exceptional public servants who each contributed singularly to our success in the Gulf...Secretary of Defense Dick Cheney....As to Dick Cheney, Secretary Cheney not only oversaw one of the largest deployments of forces in American history but also worked hard at the beginning of the crisis to ensure that America would respond decisively to aggression. His effective testimony before the United States Congress helped all our fellow countrymen understand what was at stake in the Gulf. Working swiftly, yet skillfully, when time was truly of the essence, he traveled to Saudi Arabia and arranged for the first deployment of U.S. and coalition troops to that nation. And when war came America was ready, and Secretary Cheney's leadership contributed enormously to the victory. ^ "Lady Bird Johnson Biography". Lbjlib.utexas.edu. Archived from the original on December 5, 2010 . Retrieved January 5, 2011 . , for date of award see The National First Ladies Library (November 16, 2010). Heroes of the Presidential Medal of Freedom (PDF) . Canton Ohio. p. 3 . Retrieved February 11, 2011 . Lady Bird Johnson (1912''2007)...Presidential Medal of Freedom received January 10, 1977 ^ The National First Ladies Library (November 16, 2010). Heroes of the Presidential Medal of Freedom (PDF) . Canton Ohio. p. 3 . Retrieved February 11, 2011 . Betty Ford (1918 '' )...Presidential Medal of Freedom received November 18, 1991 ^ Woolley, John T; Gerhard Peters. "Remarks With Under Secretary of State George W. Ball at the Presentation of the Medal of Freedom Awards, December 6, 1963". The American Presidency Project. University of California, Santa Barbara . Retrieved February 9, 2011 . Mr. Ball: Governor Herbert H. Lehman. I know that we were all deeply saddened to hear yesterday of the death of this great citizen. Mr. President, you may wish to read his citation in absentia. THE PRESIDENT. Citizen and statesman, he has used wisdom and compassion as the tools of government and has made politics the highest form of public service. Later, on January 28, 1964, the medal for Herbert H. Lehman was presented to Mrs. Lehman at a special ceremony at the White House. ^ Woolley, John T; Gerhard Peters. "Ronald Reagan, XL President of the United States: 1981''1989, Remarks at the Presentation Ceremony for the Presidential Medal of Freedom, March 26, 1984". The American Presidency Project. University of California, Santa Barbara . Retrieved February 11, 2011 . Senator Howard H. Baker, Jr. The citation: As a Member of the United States Senate, one of the country's most powerful and influential citizens, and an individual whose character shines brightly as an example to others, Howard Baker has been a force for responsibility and civility on a generation of Americans. In his almost 20 years of service, he has earned the respect and admiration of his fellow citizens regardless of their political persuasion. As Majority Leader of the Senate, his quiet, cooperative style and keen legislative skills have honored America's finest traditions of enlightened political leadership and statesmanship. ^ "Presidential Medal of Freedom '' John F. Kennedy Presidential Library & Museum". Jfklibrary.org. December 6, 1963 . Retrieved January 5, 2011 . ^ Wolley, John T.; Gerhard Peters (June 9, 1980). "Jimmy Carter, XXXIX President of the United States: 1977''1981, Presidential Medal of Freedom Remarks at the Presentation Ceremony, June 9, 1980". The American Presidency Project. www.presidency.ucsb.edu . Retrieved February 11, 2011 . The President of the United States of America Awards This Presidential Medal of Freedom to Lyndon Baines Johnson, Lyndon B. Johnson cared deeply about our country, its citizens, and the condition of their lives. He knew well how to translate concern into action, and action into a national agenda. He did more than any American of his time to break the chains of injustice, illiteracy, poverty and sickness. We are a greater society because President Johnson lived among us and worked for us. ^ "Remarks on presenting the Presidential Medal of Freedom to President Ronald Reagan-President George Bush-Transcript". The White House: Weekly Compilation of Presidential Documents. January 18, 1993. Archived from the original on November 16, 2010 . Retrieved December 31, 2007 . ^ Wolley, John T.; Gerhard Peters (June 9, 1980). "Gerald Ford, XXXVIII President of the United States: 1974''1977, Remarks Upon Presenting the Presidential Medal of Freedom, January 10, 1977". The American Presidency Project. www.presidency.ucsb.edu . Retrieved February 11, 2011 . Vice President Nelson A. Rockefeller...Patriot, philanthropist, patron of the arts, diplomat, Governor of New York, Vice President of the United States, his long years of service to his country have yielded governmental, economic, social and cultural contributions beyond measures." ^ Wolley, John T.; Gerhard Peters (June 9, 1980). "Jimmy Carter, XXXIX President of the United States: 1977''1981, Presidential Medal of Freedom Remarks at the Presentation Ceremony, June 9, 1980". The American Presidency Project. www.presidency.ucsb.edu . Retrieved February 11, 2011 . On occasion in our lives, a certain person touches the heartstrings of our existence and inspires us all in a special, deeply human way. I'd now like to ask the wife of Hubert Humphrey to come forward. [Applause] If you'll permit me an aside, I think the applause is not only for the honoree but for Muriel Humphrey as well, who shared so much. At this point, the President read the citation, the text of which follows: The President of the United States of America Awards this Presidential Medal of Freedom to Hubert H. Humphrey. Hubert H. Humphrey awed us with the scope of his knowledge; he inspired us with the depth of his sympathy; he moved us with his passion for social justice; he delighted us with his joyous love of his fellow human beings. He brought honor and enthusiasm to everything he did. He ennobled the political process. ^ "Biden surprised with Presidential Medal of Freedom". The Miami Herald. January 12, 2017 . Retrieved January 12, 2017 . ^ "Obama jokes about 'bromance' with Biden as he surprises VP with Presidential Medal of Freedom". ^ Woolley, John T; Gerhard Peters. "Remarks With Under Secretary of State George W. Ball at the Presentation of the Medal of Freedom Awards, December 6, 1963". The American Presidency Project. University of California, Santa Barbara . Retrieved February 9, 2011 . Mr. Ball: Mr. George Meany. THE PRESIDENT. Citizen and national leader, in serving the cause of labor, he has greatly served the cause of his Nation and of freedom throughout the world. ^ Woolley, John T; Gerhard Peters. "Remarks With Under Secretary of State George W. Ball at the Presentation of the Medal of Freedom Awards, December 6, 1963". The American Presidency Project. University of California, Santa Barbara . Retrieved February 9, 2011 . [President Johnson then resumed speaking.] I have also determined to confer the Presidential Medal of Freedom posthumously on another noble man whose death we mourned 6 months ago: His Holiness, Pope John XXIII. ^ Woolley, John T; Gerhard Peters. "Ronald Reagan, XL President of the United States: 1981''1989, Remarks at the Presentation Ceremony for the Presidential Medal of Freedom, March 26, 1984". The American Presidency Project. University of California, Santa Barbara . Retrieved February 11, 2011 . Dr. Norman Vincent Peale: With a deep understanding of human behavior and an appreciation for God's role in our lives, Dr. Norman Vincent Peale helped originate a philosophy of happiness. Through the American Foundation of Religion and Psychiatry and his many books, Dr. Peale became an advocate of the joy of life, helping millions find new meaning in their lives. Few Americans have contributed so much to the personal happiness of their fellow citizens as Dr. Norman Vincent Peale. ^ The National First Ladies Library (November 16, 2010). Heroes of the Presidential Medal of Freedom (PDF) . Canton Ohio. p. 3 . Retrieved February 11, 2011 . Dr. Margaret Mead (1901''1978)...Presidential Medal of Freedom received January 19, 1979 ^ "Presidential Medal of Freedom, 1968, James Webb". March 14, 2016. ^ a b c "Richard Nixon: Remarks at a Dinner in Los Angeles Honoring the Apollo 11 Astronauts". The American Presidency Project. August 13, 1969 . Retrieved November 20, 2018 . ^ a b c "3 Astronauts get Heroes' Welcome to Hawaii". The Philadelphia Enquirer. Associated Press. April 19, 1970. p. 14 '' via Newspapers.com. ^ Nixon, Richard (April 18, 1970). Remarks on Presenting the Presidential Medal of Freedom to Apollo 13 Mission Operations Team in Houston (Speech). Manned Spacecraft Center, Houston, Texas: The American Presidency Project. ^ "President Obama Announces Sally Ride as a Recipient of the Presidential Medal of Freedom '' April 18, 1970". Office of the Press Secretary. May 20, 2013 . Retrieved July 2, 2013 . [permanent dead link ] ^ Koren, Marina (September 29, 2016). "White House Finally Honors the African-American Athletes of the 1936 Olympics". ^ Woolley, John T; Gerhard Peters. "Ronald Reagan, XL President of the United States: 1981''1989, Remarks at the Presentation Ceremony for the Presidential Medal of Freedom, March 26, 1984". The American Presidency Project. University of California, Santa Barbara . Retrieved February 11, 2011 . Mrs. Jackie Robinson will accept for her late husband, Mr. Jackie Robinson. As an individual of courage and conviction, and as a skilled and dedicated athlete, Jackie Robinson stood tall among his peers. His courage opened the door of professional sports to all Americans when, in 1947, he became the first black baseball player in the major leagues. He bravely demonstrated to all that skill and sportsmanship, not race or ethnic background, are the qualities by which athletes should be judged. In doing so, he struck a mighty blow for equality, freedom, and the American way of life. Jackie Robinson was a good citizen, a great man, and a true American champion. ^ "William J. Clinton: White House Statement on the Posthumous Award of the Presidential Medal of Freedom to Arthur Ashe". www.presidency.ucsb.edu. ^ "Banks receives Medal of Freedom | 11/20/2013". MLB.com . Retrieved July 12, 2018 . ^ Samuel Chamberlain (May 6, 2019). "Trump presents 'true legend' Tiger Woods with Presidential Medal of Freedom". Fox News . Retrieved May 6, 2019 . ^ Krantz, Laura (August 22, 2019). "Celtics legend Bob Cousy receives Presidential Medal of Freedom". Boston Globe . Retrieved November 12, 2019 . ^ Tillett, Emily (September 16, 2019). "Trump honors Yankees great Mariano Rivera with Medal of Freedom". CBS News . Retrieved September 16, 2019 . ^ Rambaran, Vandana (October 24, 2019). "Trump gives Presidential Medal of Freedom to racing icon Roger Penske". Fox News . Retrieved October 25, 2019 . External links Medal of Freedom, Official site for the Medal of Freedom for the current administrationPresidential Medal of Freedom Recipients, 1963''2002 (alphabetical pp. 51''61, chronological pp. 62''69), The White HousePresidential Medal of Freedom Recipients, 1993''2016, United States SenatePoliticians Who Received the Medal of Freedom, The Political Graveyard
Transcript: Full Text of 2020 State of the Union Address
Tue, 04 Feb 2020 23:04
Remarks as prepared for delivery
TO THE CONGRESS OF THE UNITED STATES:
Madam Speaker, Mr. Vice President, Members of Congress, the First Lady of the United States, and my fellow citizens:
Three years ago, we launched the great American comeback. Tonight, I stand before you to share the incredible results. Jobs are booming, incomes are soaring, poverty is plummeting, crime is falling, confidence is surging, and our country is thriving and highly respected again! America's enemies are on the run, America's fortunes are on the rise, and America's future is blazing bright.
The years of economic decay are over. The days of our country being used, taken advantage of, and even scorned by other nations are long behind us. Gone too are the broken promises, jobless recoveries, tired platitudes, and constant excuses for the depletion of American wealth, power, and prestige.
In just 3 short years, we have shattered the mentality of American decline, and we have rejected the downsizing of America's destiny. We are moving forward at a pace that was unimaginable just a short time ago, and we are never going back!
I am thrilled to report to you tonight that our economy is the best it has ever been. Our military is completely rebuilt, with its power being unmatched anywhere in the world -- and it is not even close. Our borders are secure. Our families are flourishing. Our values are renewed. Our pride is restored. And for all these reasons, I say to the people of our great country, and to the Members of Congress before me: The State of our Union is stronger than ever before!
The vision I will lay out this evening demonstrates how we are building the world's most prosperous and inclusive society -- one where every citizen can join in America's unparalleled success, and where every community can take part in America's extraordinary rise.
From the instant I took office, I moved rapidly to revive the United States economy -- slashing a record number of job-killing regulations, enacting historic and record-setting tax cuts, and fighting for fair and reciprocal trade agreements. Our agenda is relentlessly pro-worker, pro-family, pro-growth, and, most of all, pro-American. We are advancing with unbridled optimism and lifting high our citizens of every race, color, religion, and creed.
Since my election, we have created 7 million new jobs -- 5 million more than Government experts projected during the previous administration.
The unemployment rate is the lowest in over half a century.
Incredibly, the average unemployment rate under my Administration is lower than any administration in the history of our country. If we had not reversed the failed economic policies of the previous administration, the world would not now be witness to America's great economic success.
The unemployment rates for African-Americans, Hispanic-Americans, and Asian-Americans have reached the lowest levels in history. African-American youth unemployment has reached an all-time low.
African-American poverty has declined to the lowest rate ever recorded.
The unemployment rate for women reached the lowest level in almost 70 years -- and last year, women filled 72 percent of all new jobs added.
The veterans' unemployment rate dropped to a record low.
The unemployment rate for disabled Americans has reached an all-time low.
Workers without a high school diploma have achieved the lowest unemployment rate recorded in United States history.
A record number of young Americans are now employed.
Under the last administration, more than 10 million people were added to the food stamp rolls. Under my Administration, 7 million Americans have come off of food stamps, and 10 million people have been lifted off of welfare.
In 8 years under the last administration, over 300,000 working-age people dropped out of the workforce. In just 3 years of my Administration, 3.5 million working-age people have joined the workforce.
Since my election, the net worth of the bottom half of wage-earners has increased by 47 percent -- 3 times faster than the increase for the top 1 percent. After decades of flat and falling incomes, wages are rising fast -- and, wonderfully, they are rising fastest for low-income workers, who have seen a 16 percent pay-increase since my election. This is a blue collar boom.
Real median household income is now at the highest level ever recorded!
Since my election, United States stock markets have soared 70 percent, adding more than $12 trillion to our Nation's wealth, transcending anything anyone believed was possible -- this, as other countries are not doing well. Consumer confidence has reached amazing new heights.
All of those millions of people with 401(k)s and pensions are doing far better than they have ever done before with increases of 60, 70, 80, 90, and even 100 percent.
Jobs and investment are pouring into 9,000 previously-neglected neighborhoods thanks to Opportunity Zones, a plan spearheaded by Senator Tim Scott as part of our great Republican tax cuts. In other words, wealthy people and companies are pouring money into poor neighborhoods or areas that have not seen investment in many decades, creating jobs, energy, and excitement. This is the first time that these deserving communities have seen anything like this. It is all working!
Opportunity Zones are helping Americans like Army Veteran Tony Rankins from Cincinnati, Ohio. After struggling with drug addiction, Tony lost his job, his house, and his family -- he was homeless. But then Tony found a construction company that invests in Opportunity Zones. He is now a top tradesman, drug-free, reunited with his family, and he is here tonight. Tony: Keep up the great work.
Our roaring economy has, for the first time ever, given many former prisoners the ability to get a great job and a fresh start. This second chance at life is made possible because we passed landmark Criminal Justice Reform into law. Everybody said that Criminal Justice Reform could not be done, but I got it done, and the people in this room got it done.
Thanks to our bold regulatory reduction campaign, the United States has become the number one producer of oil and natural gas in the world, by far. With the tremendous progress we have made over the past 3 years, America is now energy independent, and energy jobs, like so many elements of our country, are at a record high. We are doing numbers that no one would have thought possible just 3 years ago.
Likewise, we are restoring our Nation's manufacturing might, even though predictions were that this could never be done. After losing 60,000 factories under the previous two administrations, America has now gained 12,000 new factories under my Administration with thousands upon thousands of plants and factories being planned or built. We have created over half a million new manufacturing jobs. Companies are not leaving; they are coming back. Everybody wants to be where the action is, and the United States of America is, indeed, where the action is.
One of the single biggest promises I made to the American people was to replace the disastrous NAFTA trade deal. In fact, unfair trade is perhaps the single biggest reason that I decided to run for President. Following NAFTA's adoption, our Nation lost one in four manufacturing jobs. Many politicians came and went, pledging to change or replace NAFTA -- only to do absolutely nothing. But unlike so many who came before me, I keep my promises. Six days ago, I replaced NAFTA and signed the brand new United States-Mexico-Canada Agreement (USMCA) into law.
The USMCA will create nearly 100,000 new high-paying American auto jobs, and massively boost exports for our farmers, ranchers, and factory workers. It will also bring trade with Mexico and Canada to a much higher degree, but also to a much greater level of fairness and reciprocity. This is the first major trade deal in many years to earn the strong backing of America's labor unions.
I also promised our citizens that I would impose tariffs to confront China's massive theft of American jobs. Our strategy worked. Days ago, we signed the groundbreaking new agreement with China that will defend our workers, protect our intellectual property, bring billions of dollars into our treasury, and open vast new markets for products made and grown right here in the United States of America. For decades, China has taken advantage of the United States, now we have changed that but, at the same time, we have perhaps the best relationship we have ever had with China, including with President Xi. They respect what we have done because, quite frankly, they could never believe what they were able to get away with year after year, decade after decade, without someone in our country stepping up and saying: Enough. Now, we want to rebuild our country, and that is what we are doing.
As we restore American leadership throughout the world, we are once again standing up for freedom in our hemisphere. That is why my Administration reversed the failing policies of the previous administration on Cuba. We are supporting the hopes of Cubans, Nicaraguans, and Venezuelans to restore democracy. The United States is leading a 59-nation diplomatic coalition against the socialist dictator of Venezuela, Nicols Maduro. Maduro is an illegitimate ruler, a tyrant who brutalizes his people. But Maduro's grip of tyranny will be smashed and broken. Here this evening is a man who carries with him the hopes, dreams, and aspirations of all Venezuelans. Joining us in the gallery is the true and legitimate President of Venezuela, Juan Guaid". Mr. President, please take this message back to your homeland. All Americans are united with the Venezuelan people in their righteous struggle for freedom! Socialism destroys nations. But always remember, freedom unifies the soul.
To safeguard American Liberty, we have invested a record-breaking $2.2 trillion in the United States Military. We have purchased the finest planes, missiles, rockets, ships, and every other form of military equipment -- all made in the United States of America. We are also finally getting our allies to help pay their fair share. I have raised contributions from the other NATO members by more than $400 billion, and the number of allies meeting their minimum obligations has more than doubled.
And just weeks ago, for the first time since President Truman established the Air Force more than 70 years earlier, we created a new branch of the United States Armed Forces, the Space Force.
In the gallery tonight, we have one of the Space Force's youngest potential recruits: 13-year-old Iain Lanphier, an eighth grader from Arizona. Iain has always dreamed of going to space. He was first in his class and among the youngest at an aviation academy. He aspires to go to the Air Force Academy, and then, he has his eye on the Space Force. As Iain says, "most people look up at space, I want to look down on the world."
Sitting beside Iain tonight is his great hero. Charles McGee was born in Cleveland, Ohio, one century ago. Charles is one of the last surviving Tuskegee Airmen -- the first black fighter pilots -- and he also happens to be Iain's great-grandfather. After more than 130 combat missions in World War II, he came back to a country still struggling for Civil Rights and went on to serve America in Korea and Vietnam. On December 7th, Charles celebrated his 100th birthday. A few weeks ago, I signed a bill promoting Charles McGee to Brigadier General. And earlier today, I pinned the stars on his shoulders in the Oval Office. General McGee: Our Nation salutes you.
From the pilgrims to our Founders, from the soldiers at Valley Forge to the marchers at Selma, and from President Lincoln to the Reverend Dr. Martin Luther King, Jr., Americans have always rejected limits on our children's future.
Members of Congress, we must never forget that the only victories that matter in Washington are victories that deliver for the American people. The people are the heart of our country, their dreams are the soul of our country, and their love is what powers and sustains our country. We must always remember that our job is to put America first!
The next step forward in building an inclusive society is making sure that every young American gets a great education and the opportunity to achieve the American Dream. Yet, for too long, countless American children have been trapped in failing government schools. To rescue these students, 18 States have created school choice in the form of Opportunity Scholarships. The programs are so popular, that tens of thousands of students remain on waiting lists. One of those students is Janiyah Davis, a fourth grader from Philadelphia. Janiyah's mom Stephanie is a single parent. She would do anything to give her daughter a better future. But last year, that future was put further out of reach when Pennsylvania's Governor vetoed legislation to expand school choice for 50,000 children.
Janiyah and Stephanie are in the gallery this evening. But there is more to their story. Janiyah, I am pleased to inform you that your long wait is over. I can proudly announce tonight that an Opportunity Scholarship has become available, it is going to you, and you will soon be heading to the school of your choice!
Now, I call on the Congress to give 1 million American children the same opportunity Janiyah has just received. Pass the Education Freedom Scholarships and Opportunity Act -- because no parent should be forced to send their child to a failing government school.
Every young person should have a safe and secure environment in which to learn and grow. For this reason, our magnificent First Lady has launched the "Be Best" initiative -- to advance a safe, healthy, supportive, and drug-free life for the next generation, online, in school, and in our communities. Thank you, Melania, for your extraordinary love and profound care for America's children.
My Administration is determined to give our citizens the opportunities they need regardless of age or background. Through our Pledge to American Workers, over 400 companies will also provide new jobs and education opportunities to almost 15 million Americans.
My Budget also contains an exciting vision for our Nation's high schools. Tonight, I ask the Congress to support our students and back my plan to offer vocational and technical education in every single high school in America.
To expand equal opportunity, I am also proud that we achieved record and permanent funding for our Nation's Historically Black Colleges and Universities.
A good life for American families also requires the most affordable, innovative, and high-quality healthcare system on Earth. Before I took office, health insurance premiums had more than doubled in just 5 years. I moved quickly to provide affordable alternatives. Our new plans are up to 60 percent less expensive. I have also made an ironclad pledge to American families: We will always protect patients with pre-existing conditions -- that is a guarantee. And we will always protect your Medicare and your Social Security.
The American patient should never be blindsided by medical bills. That is why I signed an Executive Order requiring price transparency. Many experts believe that transparency, which will go into full effect at the beginning of next year, will be even bigger than healthcare reform. It will save families massive amounts of money for substantially better care.
But as we work to improve Americans' healthcare, there are those who want to take away your healthcare, take away your doctor, and abolish private insurance entirely. One hundred thirty-two lawmakers in this room have endorsed legislation to impose a socialist takeover of our healthcare system, wiping out the private health insurance plans of 180 million Americans. To those watching at home tonight, I want you to know: We will never let socialism destroy American healthcare!
Over 130 legislators in this chamber have endorsed legislation that would bankrupt our Nation by providing free taxpayer-funded healthcare to millions of illegal aliens, forcing taxpayers to subsidize free care for anyone in the world who unlawfully crosses our borders. These proposals would raid the Medicare benefits our seniors depend on, while acting as a powerful lure for illegal immigration. This is what is happening in California and other States -- their systems are totally out of control, costing taxpayers vast and unaffordable amounts of money. If forcing American taxpayers to provide unlimited free healthcare to illegal aliens sounds fair to you, then stand with the radical left. But if you believe that we should defend American patients and American seniors, then stand with me and pass legislation to prohibit free Government healthcare for illegal aliens!
This will be a tremendous boon to our already very-strongly guarded southern border where, as we speak, a long, tall, and very powerful wall is being built. We have now completed over 100 miles and will have over 500 miles fully completed by early next year.
My Administration is also taking on the big pharmaceutical companies. We have approved a record number of affordable generic drugs, and medicines are being approved by the FDA at a faster clip than ever before. I was pleased to announce last year that, for the first time in 51 years, the cost of prescription drugs actually went down.
And working together, the Congress can reduce drug prices substantially from current levels. I have been speaking to Senator Chuck Grassley of Iowa and others in the Congress in order to get something on drug pricing done, and done properly. I am calling for bipartisan legislation that achieves the goal of dramatically lowering prescription drug prices. Get a bill to my desk, and I will sign it into law without delay.
With unyielding commitment, we are curbing the opioid epidemic -- drug overdose deaths declined for the first time in nearly 30 years. Among the States hardest hit, Ohio is down 22 percent, Pennsylvania is down 18 percent, Wisconsin is down 10 percent -- and we will not quit until we have beaten the opioid epidemic once and for all.
Protecting Americans' health also means fighting infectious diseases. We are coordinating with the Chinese government and working closely together on the Coronavirus outbreak in China. My Administration will take all necessary steps to safeguard our citizens from this threat.
We have launched ambitious new initiatives to substantially improve care for Americans with kidney disease, Alzheimer's, and those struggling with mental health challenges. And because the Congress funded my request, we are pursuing new cures for childhood cancer, and we will eradicate the AIDS epidemic in America by the end of the decade.
Almost every American family knows the pain when a loved one is diagnosed with a serious illness. Here tonight is a special man, someone beloved by millions of Americans who just received a Stage 4 advanced cancer diagnosis. This is not good news, but what is good news is that he is the greatest fighter and winner that you will ever meet. Rush Limbaugh: Thank you for your decades of tireless devotion to our country. Rush, in recognition of all that you have done for our Nation, the millions of people a day that you speak to and inspire, and all of the incredible work that you have done for charity, I am proud to announce tonight that you will be receiving our country's highest civilian honor, the Presidential Medal of Freedom. I will now ask the First Lady of the United States to please stand and present you with the honor. Rush, Kathryn, congratulations!
As we pray for all who are sick, we know that America is constantly achieving new medical breakthroughs. In 2017, doctors at St. Luke's hospital in Kansas City delivered one of the earliest premature babies ever to survive. Born at just 21 weeks and 6 days, and weighing less than a pound, Ellie Schneider was born a fighter. Through the skill of her doctors -- and the prayers of her parents -- little Ellie kept on winning the battle for life. oday, Ellie is a strong, healthy 2-year-old girl sitting with her amazing mother Robin in the gallery. Ellie and Robin: We are so glad you are here.
Ellie reminds us that every child is a miracle of life. Thanks to modern medical wonders, 50 percent of very premature babies delivered at the hospital where Ellie was born now survive. Our goal should be to ensure that every baby has the best chance to thrive and grow just like Ellie. That is why I am asking the Congress to provide an additional $50 million to fund neo-natal research for America's youngest patients. That is also why I am calling upon the Members of Congress here tonight to pass legislation finally banning the late-term abortion of babies.
Whether we are Republican, Democrat, or Independent, surely we must all agree that every human life is a sacred gift from God!
As we support America's moms and dads, I was recently proud to sign the law providing new parents in the Federal workforce paid family leave, serving as a model for the rest of the country. Now, I call on the Congress to pass the bipartisan Advancing Support for Working Families Act, extending family leave to mothers and fathers all across the Nation.
Forty million American families have an average $2,200 extra thanks to our child tax credit. I have also overseen historic funding increases for high-quality child care, enabling 17 States to serve more children, many of which have reduced or eliminated their waitlists altogether. And I sent the Congress a plan with a vision to further expand access to high-quality childcare and urge you to act immediately.
To protect the environment, days ago, I announced that the United States will join the One Trillion Trees Initiative, an ambitious effort to bring together government and the private sector to plant new trees in America and around the world.
We must also rebuild America's infrastructure. I ask you to pass Senator Barrasso's highway bill -- to invest in new roads, bridges, and tunnels across our land.
I am also committed to ensuring that every citizen can have access to high-speed internet, including rural America.
A better tomorrow for all Americans also requires us to keep America safe. That means supporting the men and women of law enforcement at every level, including our Nation's heroic ICE officers.
Last year, our brave ICE officers arrested more than 120,000 criminal aliens charged with nearly 10,000 burglaries, 5,000 sexual assaults, 45,000 violent assaults, and 2,000 murders.
Tragically, there are many cities in America where radical politicians have chosen to provide sanctuary for these criminal illegal aliens. In Sanctuary Cities, local officials order police to release dangerous criminal aliens to prey upon the public, instead of handing them over to ICE to be safely removed.
Just 29 days ago, a criminal alien freed by the Sanctuary City of New York was charged with the brutal rape and murder of a 92-year-old woman. The killer had been previously arrested for assault, but under New York's sanctuary policies, he was set free. If the city had honored ICE's detainer request, his victim would be alive today.
The State of California passed an outrageous law declaring their whole State to be a sanctuary for criminal illegal immigrants -- with catastrophic results.
Here is just one tragic example. In December 2018, California police detained an illegal alien with five prior arrests, including convictions for robbery and assault. But as required by California's Sanctuary Law, local authorities released him.
Days later, the criminal alien went on a gruesome spree of deadly violence. He viciously shot one man going about his daily work; he approached a woman sitting in her car and shot her in the arm and the chest. He walked into a convenience store and wildly fired his weapon. He hijacked a truck and smashed into vehicles, critically injuring innocent victims. One of the victims of his bloody rampage was a 51-year-old American named Rocky Jones. Rocky was at a gas station when this vile criminal fired eight bullets at him from close range, murdering him in cold blood. Rocky left behind a devoted family, including his brothers who loved him more than anything. One of his grieving brothers is here with us tonight. Jody, would you please stand? Jody, our hearts weep for your loss -- and we will not rest until you have justice.
Senator Thom Tillis has introduced legislation to allow Americans like Jody to sue Sanctuary Cities and States when a loved one is hurt or killed as a result of these deadly policies. I ask the Congress to pass the Justice for Victims of Sanctuary Cities Act immediately. The United States of America should be a sanctuary for law-abiding Americans -- not criminal aliens!
In the last 3 years, ICE has arrested over 5,000 wicked human traffickers -- and I have signed 9 pieces of legislation to stamp out the menace of human trafficking, domestically and around the globe.
My Administration has undertaken an unprecedented effort to secure the southern border of the United States.
Before I came into office, if you showed up illegally on our southern border and were arrested, you were simply released and allowed into our country, never to be seen again. My Administration has ended Catch-and-Release. If you come illegally, you will now be promptly removed. We entered into historic cooperation agreements with the governments of Mexico, Honduras, El Salvador, and Guatemala. As a result of our unprecedented efforts, illegal crossings are down 75 percent since May -- dropping 8 straight months in a row. And as the wall goes up, drug seizures rise, and border crossings go down.
Last year, I traveled to the border in Texas and met Chief Patrol Agent Raul Ortiz. Over the last 24 months, Agent Ortiz and his team have seized more than 200,000 pounds of poisonous narcotics, arrested more than 3,000 human smugglers, and rescued more than 2,000 migrants. Days ago, Agent Ortiz was promoted to Deputy Chief of Border Patrol -- and he joins us tonight. Chief Ortiz: Please stand -- a grateful Nation thanks you and all the heroes of Border Patrol.
To build on these historic gains, we are working on legislation to replace our outdated and randomized immigration system with one based on merit, welcoming those who follow the rules, contribute to our economy, support themselves financially, and uphold our values.
With every action, my Administration is restoring the rule of law and re-asserting the culture of American freedom. Working with Senate Majority Leader McConnell and his colleagues in the Senate, we have confirmed a record number of 187 new Federal judges to uphold our Constitution as written. This includes two brilliant new Supreme Court Justices, Neil Gorsuch, and Brett Kavanaugh.
My Administration is also defending religious liberty, and that includes the Constitutional right to pray in public schools. In America, we do not punish prayer. We do not tear down crosses. We do not ban symbols of faith. We do not muzzle preachers and pastors. In America, we celebrate faith. We cherish religion. We lift our voices in prayer, and we raise our sights to the glory of God!
Just as we believe in the First Amendment, we also believe in another Constitutional right that is under siege all across our country. So long as I am President I will always protect your Second Amendment right to keep and bear arms.
In reaffirming our heritage as a free Nation, we must remember that America has always been a frontier nation. Now we must embrace the next frontier, America's manifest destiny in the stars. I am asking the Congress to fully fund the Artemis program to ensure that the next man and the first woman on the moon will be American astronauts -- using this as a launching pad to ensure that America is the first nation to plant its flag on Mars.
My Administration is also strongly defending our national security and combating radical Islamic terrorism. Last week, I announced a groundbreaking plan for peace between Israel and the Palestinians. Recognizing that all past attempts have failed, we must be determined and creative in order to stabilize the region and give millions of young people the change to realize a better future.
Three years ago, the barbarians of ISIS held over 20,000 square miles of territory in Iraq and Syria. Today, the ISIS territorial caliphate has been 100 percent destroyed, and the founder and leader of ISIS -- the bloodthirsty killer Al Baghdadi -- is dead!
We are joined this evening by Carl and Marsha Mueller. After graduating from college, their beautiful daughter Kayla became a humanitarian aid worker. Kayla once wrote, "Some people find God in church. Some people find God in nature. Some people find God in love; I find God in suffering. I've known for some time what my life's work is, using my hands as tools to relieve suffering." In 2013, while caring for suffering civilians in Syria, Kayla was kidnapped, tortured, and enslaved by ISIS, and kept as a prisoner of Al-Baghdadi himself. After more than 500 horrifying days of captivity, Al-Baghdadi murdered young Kayla. She was just 26 years old.
On the night that United States Special Forces Operators ended Al Baghdadi's miserable life, the Chairman of the Joint Chiefs of Staff, General Mark Milley, received a call in the Situation Room. He was told that the brave men of the elite Special Forces team, that so perfectly carried out the operation, had given their mission a name -- "Task Force 8-14." It was a reference to a special day: August 14th -- Kayla's birthday. Carl and Marsha, America's warriors never forgot Kayla -- and neither will we.
Every day, America's men and women in uniform demonstrate the infinite depths of love that dwells in the human heart.
One of these American heroes was Army Staff Sergeant Christopher Hake. On his second deployment to Iraq in 2008, Sergeant Hake wrote a letter to his 1-year-old son, Gage: "I will be with you again," he wrote to Gage. "I will teach you to ride your first bike, build your first sand box, watch you play sports and see you have kids also. I love you son, take care of your mother. I am always with you. Dad." On Easter Sunday of 2008, Chris was out on patrol in Baghdad when his Bradley Fighting Vehicle was hit by a roadside bomb. That night, he made the ultimate sacrifice for our country. Sergeant Hake now rests in eternal glory in Arlington, and his wife Kelli is in the gallery tonight, joined by their son, who is now 13 years old. To Kelli and Gage: Chris will live in our hearts forever.
The terrorist responsible for killing Sergeant Hake was Qasem Soleimani, who provided the deadly roadside bomb that took Chris's life. Soleimani was the Iranian Regime's most ruthless butcher, a monster who murdered or wounded thousands of American service members in Iraq. As the world's top terrorist, Soleimani orchestrated the deaths of countless men, women, and children. He directed the December assault on United States Forces in Iraq, and was actively planning new attacks. That is why, last month, at my direction, the United States Military executed a flawless precision strike that killed Soleimani and terminated his evil reign of terror forever.
Our message to the terrorists is clear: You will never escape American justice. If you attack our citizens, you forfeit your life!
In recent months, we have seen proud Iranians raise their voices against their oppressive rulers. The Iranian regime must abandon its pursuit of nuclear weapons, stop spreading terror, death, and destruction, and start working for the good of its own people. Because of our powerful sanctions, the Iranian economy is doing very poorly. We can help them make it very good in a short period of time, but perhaps they are too proud or too foolish to ask for that help. We are here. Let's see which road they choose. It is totally up to them.
As we defend American lives, we are working to end America's wars in the Middle East.
In Afghanistan, the determination and valor of our warfighters has allowed us to make tremendous progress, and peace talks are underway. I am not looking to kill hundreds of thousands of people in Afghanistan, many of them innocent. It is also not our function to serve other nations as a law enforcement agency. These are warfighters, the best in the world, and they either want to fight to win or not fight at all. We are working to finally end America's longest war and bring our troops back home!
War places a heavy burden on our Nation's extraordinary military families, especially spouses like Amy Williams from Fort Bragg, North Carolina, and her 2 children -- 6-year-old Elliana and 3-year-old Rowan. Amy works full time, and volunteers countless hours helping other military families. For the past 7 months, she has done it all while her husband, Sergeant First Class Townsend Williams, is in Afghanistan on his fourth deployment to the Middle East. Amy's kids have not seen their father's face in many months. Amy, your family's sacrifice makes it possible for all of our families to live in safety and peace -- we thank you.
As the world bears witness tonight, America is a land of heroes. This is the place where greatness is born, where destinies are forged, and where legends come to life. This is the home of Thomas Edison and Teddy Roosevelt, of many great Generals, including Washington, Pershing, Patton, and MacArthur. This is the home of Abraham Lincoln, Frederick Douglass, Amelia Earhart, Harriet Tubman, the Wright Brothers, Neil Armstrong, and so many more. This is the country where children learn names like Wyatt Earp, Davy Crockett, and Annie Oakley. This is the place where the pilgrims landed at Plymouth and where Texas patriots made their last stand at the Alamo.
The American Nation was carved out of the vast frontier by the toughest, strongest, fiercest, and most determined men and women ever to walk the face of the Earth. Our ancestors braved the unknown; tamed the wilderness; settled the Wild West; lifted millions from poverty, disease, and hunger; vanquished tyranny and fascism; ushered the world to new heights of science and medicine; laid down the railroads, dug out canals, raised up the skyscrapers -- and, ladies and gentlemen, our ancestors built the most exceptional Republic ever to exist in all of human history. And we are making it greater than ever before!
This is our glorious and magnificent inheritance.
We are Americans. We are the pioneers. We are the pathfinders. We settled the new world, we built the modern world, and we changed history forever by embracing the eternal truth that everyone is made equal by the hand of Almighty God.
America is the place where anything can happen! America is the place where anyone can rise. And here, on this land, on this soil, on this continent, the most incredible dreams come true!
This Nation is our canvas, and this country is our masterpiece. We look at tomorrow and see unlimited frontiers just waiting to be explored. Our brightest discoveries are not yet known. Our most thrilling stories are not yet told. Our grandest journeys are not yet made. The American Age, the American Epic, the American Adventure, has only just begun!
Our spirit is still young; the sun is still rising; God's grace is still shining; and my fellow Americans, the best is yet to come!
Thank you. God Bless You. God Bless America.
Transcript: President Trump's State of the Union address 2019 (full text) - Vox
Tue, 04 Feb 2020 23:02
President Donald Trump's second formal State of the Union address on Tuesday night takes place as the president and Congress try to find a solution to avert another government shutdown on February 15. The speech was delayed two weeks amid the longest government shutdown in history, and Trump and House Speaker Nancy Pelosi are still at an impasse.
The theme of the speech is ''choosing greatness,'' according to a briefing Friday with administration officials. The prepared text includes this statement: ''Together we can break decades of political stalemate. We can bridge old divisions, heal old wounds, build new coalitions, forge new solutions, and unlock the extraordinary promise of America's future. The decision is ours to make.''
It's something of an irony Trump is choosing to highlight togetherness after the longest government shutdown in American history, in which he amped up divisions over immigration and his campaign promise to build a border wall. Democrats have said they don't want to negotiate over border security with federal workers' paychecks in the balance. Trump finally reopened the government, but has been continuing to keep up pressure on building the wall.
After the speech, Stacey Abrams, whose run for Georgia governor galvanized Democrats although it was ultimately unsuccessful, will respond for Democrats. Sen. Bernie Sanders (I-VT) will also issue a response of his own.
You can watch the full live stream of the State of the Union above or on the White House YouTube channel. A rush transcript of Trump's speech follows below.
Trump: Thank you very much Madam Speaker, vice president, members of Congress, the first lady of the United States. [applause]
And my fellow Americans. We meet tonight at a moment of unlimited potential, as we begin a new Congress, I stand here ready to work with you to achieve historic breakthroughs for all Americans. Millions of our fellow citizens are watching us, gathered in this great chamber, hoping we will govern not as two parties, but as one nation. [applause]
The agenda I will lay out this evening is not a Republican agenda or Democrat agenda, it is the agenda of the American people. Many of us have campaigned on the same core promises, to defend American jobs and demand fair trade for American workers, to rebuild and revitalize our nation's infrastructure, to reduce the price of health care and prescription drugs, to create an immigration system that is safe, lawful, modern and secure, and to pursue a foreign policy that puts America's interests first.
There is a new opportunity in American politics, if only we have the courage together to seize it. [applause] victory is not winning for our party, victory is winning for our country. [applause] this year, America will recognize two important anniversaries that show us the majesty of America's vision and the power of American pride.
In June we marked 75 years since the start of what Gen. Dwight Eisenhower called ''the great crusade,'' the Allied liberation of Europe in World War II. [applause] on D-Day, June 6, 1944, 15,000 young American men jumped from the skies, and 60,000 more stormed in from the sea to save our civilization from tyranny. Here with us tonight are three of those incredible heroes. Private first class Joseph Riley, staff sergeant Erving Walker '-- and sergeant Herman Zeitchik. [applause]
Gentlemen, we salute you. In 2019 we also celebrate 50 years since brave young pilots flew one-quarter of 1 million miles through space the plants of American flag on the face of the moon. Half a century later, we are joined by one of the Apollo 11 astronauts who planted that flag, Buzz Aldrin. [applause] thank you, Buzz. This year, American astronauts will go back to space in American rockets. [applause]
In the 20th century, America saved freedom, transformed science, redefined the middle class, and when you get down to it, there is nothing anywhere in the world that can compete with America. [applause] now we must step boldly and bravely into the next chapter of this great American adventure. We must create a new standard of living for the 21st century.
An amazing quality of life for all of our citizens is within reach. We can make our communities safer, our families stronger, our culture richer, our faith deeper, and our middle class and more prosperous than ever before. [applause] but we must reject the politics of revenge, resistance and retribution, and embrace the boundless potential of cooperation, compromise, and the common good. [applause]
Together we can break decades of political stalemate. We can bridge all divisions, heal old wounds, build new coalitions, forge new solutions, and unlock the extraordinary promise of America's future. The decision is ours to make. We must choose between greatness or gridlock, results or resistance, vision or vengeance, incredible progress or pointless destruction. Tonight, I ask you to choose greatness. [applause]
Over the last two years, my administration has moved with a urgency and historic speed to confront problems neglected by leaders of both parties over many decades. In just over two years since the election, we have launched an unprecedented economic boom, a boom that has rarely been seen before. There has been nothing like it. We have created 5.3 million new jobs, and importantly, added 600,000 new manufacturing jobs, something which almost everyone said was impossible to do, but the fact is, we are just getting started. [applause]
Wages are rising at the fastest pace in decades, and growing for blue-collar workers, who I promise to fight for. They are growing faster than anyone else. Nearly 5 million Americans have been lifted off food stamps. [applause] The US economy is growing almost twice as fast today as when I took office, and we are considered far and away the hottest economy anywhere in the world. Not even close. Unemployment has reached the lowest rate in over half a century. African-American, Hispanic-American, and Asian-American unemployment have all reached their lowest levels ever recorded.
Unemployment for Americans with disabilities has also reached an all-time low. [applause] more people are working now than at any time in the history of our country. 157 million people at work. We passed a massive tax cut for working families and double the child tax credit. We have virtually ended the estate tax, or death tax that is '-- as it is called, for small businesses, ranches and family farms. We eliminated the very unpopular Obamacare individual mandate penalty and to give critically-ill patients access to life-saving cures, we passed very importantly, right to try.
My administration has cut more regulations in a short period of time than any other administration during its entire tenure. companies are coming back to our country in large numbers, thanks to our historic reductions in taxes and regulations, and we have unleashed a revolution in American energy. The United States is now the number-one producer of oil and natural gas anywhere in the world '-- and now, for the first time in 65 years, we are a net exporter of energy. After 24 months of rapid progress, our economy is the envy of the world. Our military is the most powerful on Earth, by far, and America '-- America is again winning each and every day. members of Congress, the state of our union is strong.
Our country is vibrant and our economy is thriving like never before. Friday it was announced we added another 304,000 jobs last month alone, almost double the number expected. An economic miracle is taking place in the United States, and the only thing that can stop it are foolish wars, politics, or ridiculous, partisan investigations. If there is going to be peace in legislation, there cannot be war and investigation. It just does not work that way.
We must be united at home to defeat our adversaries abroad. This new era of cooperation can start with finally confirming the more than 300 highly qualified nominees who are still stuck in the Senate, in some cases years and years waiting '-- not right.
The Senate has failed to act on these nominations, which is unfair to the nominees, and very unfair to our country. Now is the time for bipartisan action. Believe it or not, we have already proven that is possible. In the last Congress, both parties came together to pass unprecedented legislation to confront the opioid crisis, a sweeping new farm bill, historic V.A. reforms, and after four decades of rejection, we passed a V.A. Accountability, so we can finally terminate those who mistreat our wonderful veterans, and just weeks ago, all parties united for groundbreaking criminal justice reform. They said it couldn't be done.
Last year, I heard through friends, the story of Alice Johnson. I was deeply moved. In 1997, Alice was sentenced to life in prison as a first time, nonviolent drug offender. Over the next 22 years, she became a prison minister, inspiring others to choose a better path. She had a big impact on that prison population and far beyond. Alice's story underscores the disparities and unfairness that can exist in criminal sentencing, and the need to remedy this total injustice. She served almost that 22 years, and had expected to be in prison for the remainder of her life. In June, I commuted Alice's sentence. When I saw Alice's beautiful family greet her at the prison gates, hugging and kissing and crying and laughing, I knew I did something right. Alice is with us tonight, and she is a terrific woman. Terrific. Alice, please.
Alice, thank you for reminding us that we always have the power to shape '-- the power to shape our own destiny. Thank you very much.
Inspired by stories like Alice's, my administration worked closely with members of both parties to sign the First Step Act into law. Big deal. That is a big deal. This legislation reformed sentencing laws that have wrongly and disproportionately harmed the African-American community.
The First Step Act gives nonviolent offenders the chance to reenter society as productive, law-abiding citizens. Now, states across the country are following our lead. America is a nation that believes in redemption. We are also joined tonight by Matthew Charles from Tennessee. In 1996, at the age of 30, Matthew was sentenced to 35 years for selling drugs and related offenses. Over the next two decades, he completed more than 30 Bible studies, became a law clerk, and mentored many of his fellow inmates. Now, Matthew was the very first person to be released from prison under the First Step Act.
Matthew, please. Thank you, Matthew. Welcome home.
Now, Republicans and Democrats must join forces again to confront an urgent national crisis. Congress has 10 days left to pass a bill that will fund our government, protect our homeland, and secure are very dangerous southern border. Now is the time for Congress to show the world that America is committed to ending illegal immigration and putting the ruthless coyotes, cartels, drug dealers, and human traffickers out of business.
As we speak, large, organized caravans are on the march to the United States. We have just heard that Mexican cities, in order to remove the illegal immigrants from their communities, are getting trucks and buses to bring them up to our country in areas where there is little border protection. I have ordered another 3,750 troops to our southern border to prepare for this tremendous onslaught. This is a moral issue.
The lawless state of our southern border is a threat to the safety, security, and financial well-being of all Americans. We have a moral duty to create an immigration system that protects the lives and jobs of our citizens. This includes our obligation to the millions of immigrants living here today who follow the rules and respected our laws. Legal immigrants enrich our nation and strengthen our society in countless ways.
I want people to come into our country in the largest numbers ever, but they have to come in legally. Tonight, I'm asking you to defend our very dangerous southern border out of love and devotion to our fellow citizens and our country. No issue better illustrates the divide between America's working-class and America's political class than illegal immigration. Wealthy politicians and donors push for open borders, while living their lives behind walls and gates and guards.
Meanwhile, working-class Americans are left to pay the price for mass illegal immigration, reduced to jobs, lower wages, overburdened schools, hospitals that are so crowded you can't get in, increased crime, and a depleted social safety net. Tolerance for illegal immigration is not compassionate, it is actually very cruel.
One in three women is sexually assaulted on the long journey north. Smugglers use migrant children as human pawns to exploit our laws and gain access to our country. Human traffickers and sex traffickers take advantage of the wide-open areas between our ports of entry to smuggle thousands of young girls and women into the United States and to sell them into prostitution and modern-day slavery.
Tens of thousands of innocent Americans are killed by lethal drugs that cross our border and flood into our cities, including meth, heroin, cocaine, and fentanyl. The savage gang MS-13 now operates in at least 20 different American states, and they almost all come through our southern border.
Just yesterday, an MS-13 gang member was taken into custody for a fatal shooting on a subway platform in New York city. We are removing these gang members by the thousands, but until we secure our border, they are going to keep streaming right back in.
Year after year, countless Americans are murdered by criminal illegal aliens. I've gotten to know many wonderful angel moms and dads and families. No one should ever have to suffer the horrible heartache that they have had to endure.
Here tonight is Deborah Bissell, just three weeks ago her parents were burglarized and shot to death in their Reno, Nevada, home by an illegal alien. They were in their 80s and are survived by four children, 11 grandchildren, and 20 great-grandchildren. Also here tonight are Gerald and Sharon's granddaughter Heather and great-granddaughter Madison. To Debroah, Heather, Madison, please stand. Few can understand your pain. Thank you and thank you for being here. Very much.
I will never forget and I will fight for the memory of Gerald and Sharon, that it should never happen again. Not one more American life should be lost because our nation failed to control its very dangerous border. In the last two years, our brave ICE officers made 266,000 arrests of criminal aliens, including those charged or convicted of nearly 100,000 assaults. 30,000 sex crimes, and 4000 killings or murders. We are joined tonight by one of those law enforcement heroes, ICE special agent Elvin Hernandez.
Thank you. Well, Elvin was a boy, the end his family legally immigrated to the United States from the Dominican Republic. At the age of 8, he told his dad he wanted to become a special agent. Today, he leads investigations into the scores of international sex trafficking. He says that if I can make sure these young girls get their justice, I've really done my job. Thanks to his work and that of his incredible colleagues, more than 300 women and girls have been rescued from the horror of this terrible situation and more than 1500 sadistic traffickers have been put behind bars. We will always support the brave men and women of law enforcement, and I pledge to you tonight that I will never abolish our heroes from ICE. Thank you.
My administration has sent to the Congress a commonsense proposal to end the crisis on our southern border. It includes humanitarian assistance, more law enforcement, drug detection at our ports, closing loopholes that enable child smuggling, and plans for a new physical barrier, or wall, to secure the vast areas between our ports of entry. In the past, most of the people in this room voted for a wall '-- but the proper wall never got built. I'll get it built.
This is a smart, strategic, see-through steel barrier '-- not just a simple concrete wall. It will be deployed in the areas identified by border agents as having the greatest need, and as these agents will tell you, where walls go up, illegal crossings go way down.
San Diego used to have the most illegal border crossings in the country. In response, a strong security wall was put in place. This powerful barrier almost completely ended illegal crossings. The border city of El Paso, Texas, used to have extremely high rates of violent crime '-- one of the highest in the country, and considered one of our nation's most dangerous cities. Now, immediately upon its building, with a powerful barrier in place, El Paso is one of our safest cities. Simply put, walls work and walls save lives.
So let's work together, compromise, and reach a deal that will truly make America safe. As we work to defend our people's safety, we must also ensure our economic resurgence continues at a rapid pace. No one has benefitted more from our thriving economy than women, who have filled 58 percent of the new jobs created in the last year.
You were not supposed to do that. Thank you very much. Thank you very much. All Americans can be proud that we have more women in the workforce than ever before. Don't sit yet. You are going to like this.
And exactly one century after the Congress passed the constitutional amendment giving women the right to vote, we also have more women serving in the Congress than ever before.
That's great. Very great. And congratulations. That's great. As part of our commitment to improving opportunity for women everywhere, this Thursday we are launching the first ever government-wide initiative focused on economic empowerment for women in developing countries.
To build on our incredible economic success, one priority is paramount '-- reversing decades of calamitous trade policies. So bad. We are now making it clear to China that after years of targeting our industries, and stealing our intellectual property, the theft of American jobs and wealth has come to an end.
Therefore, we recently imposed tariffs on $250 billion of Chinese goods '-- and now our treasury is receiving billions of dollars a month from '-- but I don't blame China for taking advantage of us. I blame our leaders and representatives for allowing this travesty to happen. I have great respect for President Xi, and we are now working on a new trade deal with China. But it must include real, structural change to end unfair trade practices, reduce our chronic trade deficit, and protect American jobs.
Another historic trade blunder was the catastrophe known as NAFTA. I have met the men and women of Michigan, Ohio, Pennsylvania, Indiana, New Hampshire, and many other states whose dreams were shattered by NAFTA. For years, politicians promised them they would negotiate for a better deal. But no one ever tried '-- until now.
Our new US-Mexico-Canada agreement '-- or USMCA'-- will replace NAFTA and deliver for American workers like they have not had delivered to for a long time. I hope you can pass the USMCA into law so we can bring back our manufacturing jobs in greater numbers, expand American agriculture, protect intellectual property, and ensure that more cars are proudly stamped with four beautiful words '-- made in the USA.
Tonight, I am also asking you to pass the United States reciprocal trade act, so that if another country places an unfair tariff on an American product, we can charge them the exact same tariff on the same product that they sell to us.
Both parties should be able to unite for a great rebuilding of America's crumbling infrastructure. I know that the Congress is eager to pass an infrastructure bill '-- and I am eager to work with you on legislation to deliver new and important infrastructure investment, including investments in the cutting edge industries of the future. This is not an option. This is a necessity. The next major priority for me, and for all of us, should be to lower the cost of healthcare and prescription drugs '-- and to protect patients with pre-existing conditions.
Already, as a result of my administration's efforts, in 2018 drug prices experienced their single largest decline in 46 years. But we must do more. It is unacceptable that Americans pay vastly more than people in other countries for the exact same drugs, often made in the exact same place. This is wrong, unfair, and together we can stop it. And we will stop it fast.
I am asking the Congress to pass legislation that finally takes on the problem of global freeloading and delivers fairness and price transparency for American patients. Finally.
We should also require drug companies, insurance companies, and hospitals to disclose real prices to foster competition and bring costs down. No force in history has done more to advance the human condition than American freedom.
In recent years we have made remarkable progress in the fight against HIV and AIDS. Scientific breakthroughs have brought a once-distant dream within reach. My budget will ask Democrats and Republicans to make the needed commitment to eliminate the HIV epidemic in the United States within 10 years. We have made incredible strides. Incredible.
Together, we will defeat aids in America. And beyond.
Tonight, I am also asking you to join me in another fight that all Americans can get behind '-- the fight against childhood cancer. Joining Melania in the gallery this evening is a very brave 10-year-old girl, Grace Eline.
Hi, Grace.
Every birthday since she was 4, Grace asked her friends to donate to St. Jude Children's Research Hospital. She did not know that one day she might be a patient herself. That is what happened. Last year, grace was diagnosed with brain cancer. Immediately, she began radiation treatment. At the same time, she rallied her community and raised more than $40,000 for the fight against cancer.
When Grace completed treatment last fall, her doctors and nurses cheered '-- they love to her, they still love her. With tears in their eyes as she hung up a poster that read, ''last day of chemo.''
Thank you, Grace. You are a great inspiration to everyone in this room. Thank you very much.
Many childhood cancers have not seen new therapies in decades. My budget will ask the Congress for $500 million over the next 10 years to fund this critical life-saving research. To help support working parents, the time has come to pass school choice for America's children.
I am also proud to be the first president to include in my budget a plan for nationwide paid family leave '-- so that every new parent has the chance to bond with their newborn child.
There could be no greater contrast to the beautiful image of a mother holding her infant child than the chilling displays our nation saw in recent days. Lawmakers in New York cheered with delight upon the passage of legislation that would allow a baby to be ripped from the mother's womb moments before birth.
These are living, feeling, beautiful babies who will never get the chance to share their love and dreams with the world. And then, we had the case of the governor of Virginia where he stated he would execute a baby after birth. To defend the dignity of every person, I am asking the Congress to pass legislation to prohibit the late-term abortion of children who can feel pain in the mother's womb. Let us work together to build a culture that cherishes innocent life.
And let us reaffirm a fundamental truth '-- all children '-- born and unborn '-- are made in the holy image of God.
The final part of my agenda is to protect America's national security. Over the last 2 years, we have begun to fully rebuild the United States military '-- with $700 billion last year and $716 billion this year. We are also getting other nations to pay their fair share. Finally.
For years, the United States was being treated very unfairly by friends of ours, by members of NATO, but now we have secured a $100 billion increase in defense spending from NATO allies. They said it could not be done. As part of our military build-up, the United States is developing a state-of-the-art missile defense system.
Under my administration, we will never apologize for advancing America's interests. For example, decades ago the United States entered into a treaty with Russia in which we agreed to limit and reduce our missile capabilities. While we followed the agreement and the rules to the letter, Russia repeatedly violated its terms. It has been going on for many years. That is why I announced that the United States is officially withdrawing from the Intermediate-Range Nuclear Forces treaty, or INF treaty.
We really have no choice. Perhaps we can negotiate a different agreement, adding China and others, or perhaps we can't - in which case, we will outspend and out-innovate all others by far. As part of a bold new diplomacy, we continue our historic push for peace on the Korean peninsula. Our hostages have come home, nuclear testing has stopped, and there has not been a missile launch in 15 months. If I had not been elected president of the United States, we would right now, in my opinion, be in a major war with North Korea.
Much work remains to be done, but my relationship with Kim Jong-un is a good one. Chairman Kim and I will meet again on February 27 and 28 in Vietnam.
Two weeks ago, the United States officially recognized the legitimate government of Venezuela, and its new interim president, Juan Guaid". We stand with the Venezuelan people in their noble quest for freedom '-- and we condemn the brutality of the Maduro regime, whose socialist policies have turned that nation from being the wealthiest in South America into a state of abject poverty and despair.
Here, in the United States, we are alarmed by new calls to adopt socialism in our country. America was founded on liberty and independence '-- not government coercion, domination, and control. We are born free, and we will stay free.
Tonight, we renew our resolve that America will never be a socialist country. One of the most complex set of challenges we face and have for many years is in the Middle East. Our approach is based on principled realism '-- not discredited theories that have failed for decades to yield progress. For this reason, my administration recognized the true capital of Israel '-- and proudly opened the American embassy in Jerusalem.
Our brave troops have now been fighting in the middle east for almost 19 years. In Afghanistan and Iraq, nearly 7,000 American heroes have given their lives. More than 52,000 Americans have been badly wounded. We have spent more than $7 trillion in the Middle East.
As a candidate for president, I loudly pledged a new approach. Great nations do not fight endless wars. When I took office, ISIS controlled more than 20,000 square miles in Iraq and Syria. Just two years ago. Today, we have liberated virtually all of that territory from the grip of these bloodthirsty killers.
Now, as we work with our allies to destroy the remnants of ISIS, it is time to give our brave warriors in Syria a warm welcome home. I have also accelerated our negotiations to reach a political settlement in Afghanistan. The opposing side is also very happy to be negotiating. Our troops have fought with unmatched valor '-- and thanks to their bravery, we are now able to pursue a political solution to this long and bloody conflict.
In Afghanistan, my administration is holding constructive talks with a number of Afghan groups, including the Taliban. As we make progress in these negotiations, we will be able to reduce our troop presence and focus on counter-terrorism. And we will indeed focus on counterterrorism. We do not know whether we will achieve an agreement '-- but we do know that after two decades of war, the hour has come to at least try for peace. And the other side would like to do the same thing. It is time.
Above all, friend and foe alike must never doubt this nation's power and will to defend our people. Eighteen years ago, violent terrorists attacked the USS Cole '-- and last month American forces killed one of the leaders of the attack. We are honored to be joined tonight by Tom Wibberley, whose son, navy seaman Craig Wibberley, was one of the 17 sailors we tragically lost. Tom, we vow to always remember the heroes of the USS Cole.
My administration has acted decisively to confront the world's leading state sponsor of terror '-- the radical regime in Iran. It is a radical regime. They do bad, bad things. To ensure this corrupt dictatorship never acquires nuclear weapons, I withdrew the United States from the disastrous Iran nuclear deal.
And last fall, we put in place the toughest sanctions ever imposed on a country. We will not avert our eyes from a regime that chants death to America and threatens genocide against the Jewish people. We must never ignore the vile poison of anti-Semitism, or those who spread its venomous creed. With one voice, we must confront this hatred anywhere and everywhere it occurs.
Just months ago, 11 Jewish-Americans were viciously murdered in an anti-Semitic attack on the Tree of Life synagogue in Pittsburgh. SWAT officer Timothy Matson raced into the gunfire and was shot seven times chasing down the killer. And he was very successful. Timothy has just had his 12th surgery and he is going in for many more, but he made the trip to be here with us tonight. Officer Matson, please.
Thank you. We are forever grateful. Thank you very much. Tonight, we are also joined by Pittsburgh survivor Judah Samet. He arrived at the synagogue as the massacre began. But not only did Judah narrowly escape death last fall '-- more than seven decades ago, he narrowly survived the Nazi concentration camps. Today is Judah's 81st birthday.
They would not do that for me, Judah.
Judah says he can still remember the exact moment, nearly 75 years ago, after 10 months in a concentration camp, when he and his family were put on a train, and told they were going to another camp. Suddenly the train screeched to a halt. A soldier appeared. Judah's family braced for the worst. Then, his father cried out with joy, ''it's the Americans.''
Thank you. A second Holocaust survivor who is here tonight, Joshua Kaufman, was a prisoner at Dachau. He remembers watching through a hole in the wall of a cattle car as American soldiers rolled in with tanks.
''To me,'' Joshua recalls, ''the American soldiers were proof that God exists, and they came down from the sky.'' they came down from heaven. I began this evening by honoring three soldiers who fought on d-day in the second world war. One of them was Herman Zeitchik. But there is more to Herman's story. A year after he stormed the beaches of Normandy, Herman was one of those American soldiers who helped liberate Dachau.
He was one of the Americans who helped rescue Joshua from that hell on Earth. Almost 75 years later, Herman and Joshua are both together in the gallery tonight '-- seated side-by-side, here in the home of American freedom. Herman and Joshua, your presence this evening is very much appreciated. Thank you very much.
Thank you. When American soldiers set out beneath the dark skies over the English Channel in the early hours of D-Day, 1944, they were just young men of 18 and 19, hurtling on fragile landing craft toward the most momentous battle in the history of war.
They did not know if they would survive the hour. They did not know if they would grow old. But they knew that America had to prevail. Their cause was this nation, and generations yet unborn. Why did they do it? They did it for America '-- they did it for us. Everything that has come since '-- our triumph over communism, our giant leaps of science and discovery, our unrivaled progress toward equality and justice '-- all of it is possible thanks to the blood and tears and courage and vision of the Americans who came before.
Think of this Capitol '-- think of this very chamber, where lawmakers before you voted to end slavery, to build the railroads and the highways, to defeat fascism, to secure civil rights, to face down an evil empire. Here tonight, we have legislators from across this magnificent republic. You have come from the rocky shores of Maine and the volcanic peaks of Hawaii, from the snowy woods of Wisconsin and the red deserts of Arizona, from the green farms of Kentucky and the golden beaches of California. Together, we represent the most extraordinary nation in all of history.
What will we do with this moment? How will we be remembered? I ask the men and women of this Congress, look at the opportunities before us. Our most thrilling achievements are still ahead.
Our most exciting journeys still await. Our biggest victories are still to come. We have not yet begun to dream. We must choose whether we are defined by our differences '-- or whether we dare to transcend them. We must choose whether we will squander our inheritance '-- or whether we will proudly declare that we are Americans. We do the incredible. We defy the impossible. We conquer the unknown. This is the time to reignite the American imagination. This is the time to search for the tallest summit, and set our sights on the brightest star.
This is the time to rekindle the bonds of love and loyalty and memory that link us together as citizens, as neighbors, as patriots. This is our future '-- our fate '-- and our choice to make. I am asking you to choose greatness. No matter the trials we face, no matter the challenges to come, we must go forward together. We must keep America first in our hearts. We must keep freedom alive in our souls. And we must always keep faith in America's destiny '-- that one nation, under God, must be the hope and the promise and the light and the glory among all the nations of the world! Thank you. God bless you, God bless America. Thank you very much.
The White House on Twitter: "Speaker Pelosi just ripped up: One of our last surviving Tuskegee Airmen. The survival of a child born at 21 weeks. The mourning families of Rocky Jones and Kayla Mueller. A service member's reunion with his family. That's her
Tue, 04 Feb 2020 22:57
@ WhiteHouse Speaker Pelosi just ripped up:One of our last surviving Tuskegee Airmen.The survival of a child born at 21 weeks.The mourning families of Rocky Jones and Kayla Mueller.A service member's reunion with his family.That's her legacy.
EarthquakePrediction on Twitter: "WARNING: Strong earthquake will hit within 80 miles of Mammoth Lakes, CA during the next 30 hours - Major earthquake will hit California - during the next 144 hours - most likely on February 10th in Mammoth Lakes - new ma
Tue, 04 Feb 2020 22:54
WARNING: Strong earthquake will hit within 80 miles of Mammoth Lakes, CA during the next 30 hours - Major earthquake will hit California - during the next 144 hours - most likely on February 10th in Mammoth Lakes - new map online in about 1 hour. -
quakeprediction.com/Los%20Angeles%'... pic.twitter.com/bAujiFzzc8
EU Takes A Dim View Of Trump's Controversial Mideast Peace Plan : NPR
Tue, 04 Feb 2020 18:04
European Union foreign policy chief Josep Borrell, shown here during a news conference earlier this month, has expressed concerns about the Trump administration's proposal about how to end the Israeli-Palestinian conflict. Francisco Seco/AP hide caption
toggle caption Francisco Seco/AP European Union foreign policy chief Josep Borrell, shown here during a news conference earlier this month, has expressed concerns about the Trump administration's proposal about how to end the Israeli-Palestinian conflict.
Francisco Seco/AP The European Union expressed major reservations about President Trump's newly unveiled plan to end the Israeli-Palestinian conflict, saying it doesn't meet "internationally agreed parameters" on issues such as where Israel's borders should be drawn.
The plan, which has been roundly rejected by Palestinians, sides with Israel on major sticking points such as Jerusalem, settlements in the West Bank and the right of return for Palestinian refugees.
It provides a pathway to what the Trump administration calls a Palestinian state '-- envisioned on fragmented areas of land over which Palestinians would not have their own security control.
In a statement, European Union foreign policy chief Josep Borrell stressed that the EU is committed to a "negotiated two-State solution, based on 1967 lines, with equivalent land swaps, as may be agreed between the parties, with the State of Israel and an independent, democratic, contiguous, sovereign and viable State of Palestine, living side by side in peace, security and mutual recognition."
Borrell said that the Trump administration's plan, which was spearheaded by the president's son-in-law Jared Kushner, "departs from these internationally agreed parameters."
The EU, and previous U.S. administrations, have called for using Israel's 1967 borders as a starting point to negotiations. Trump's plan would allow Israel to annex large portions of the West Bank, including the the Jordan Valley and many areas with existing Israeli settlements.
Israel's embattled prime minister, Benjamin Netanyahu, has said that Israel will pursue plans to annex areas outlined in the Trump proposal.
The EU spoke out against that idea. "In line with international law and relevant UN Security Council resolutions, the EU does not recognise Israel's sovereignty over the territories occupied since 1967," Borrell said. "Steps towards annexation, if implemented, could not pass unchallenged."
Lior Haiat, spokesperson for Israel's Ministry of Foreign Affairs, said in a tweet that "the fact that the High Rep of the EU, Josep Borrel, chose to use threatening language towards Israel, so shortly after he assumed office & only hours after his meetings in Iran, is regrettable &, to say the least, odd."
"Pursuing such policies & conduct is the best way to ensure that the EU's role in any process will be minimized," he added.
Borrell started in this role in December 2019. Prior to Tuesday's statement, the EU had not yet taken a position on the Trump administration's proposal, which was issued in coordination with Israel and without consulting the Palestinians.
Palestinian Authority President Mahmoud Abbas has described the plan as the "smack of the century."
Riyad al-Malki, the Palestinian foreign minister, is quoted in local media as saying that "despite the pressures exerted by the American administration and Israel, the [EU] statement represents a victory for international legitimacy and the diplomacy of justice which the US is trying to replace with the diplomacy of intimidation and threats."
International criticism of Trump's plan is mounting. On Monday, the African Union came out against the deal. In a statement, AU Commission Chairperson Moussa Faki Mahamat said the organization "notes with great concern that this plan ignores the legitimate rights of the Palestinian people and constitutes a serious violation of their fundamental rights."
Text of the U.S.-China Phase One Trade Deal
Tue, 04 Feb 2020 17:57
Jan 16, 2020 02:26 PM
ECONOMYBy
Yang Ge Photo: Xinhua
The following links contain full text of the English and Chinese versions of the phase one economic and trade agreement that China and the United States signed on Wednesday. The agreement includes chapters on intellectual property protection, technology transfer, agriculture trade, financial services, exchange rates, expanding trade and dispute resolution.
RELATEDU.S. and China Sign Phase One Trade Deal
Share this article
Open WeChat and scan the QR code
China deal phase one
Tue, 04 Feb 2020 17:55
ECONOMIC AND TRADE AGREEMENT BETWEEN THE GOVERNMENT OF THE PEOPLE'S REPUBLIC OF CHINA AND THE GOVERNMENT OF THE UNITED STATES OF AMERICA PREAMBLE The Government of the People's Republic of China and the Government of the United States of America (collectively the ''Parties''), RECOGNIZING the importance of their bilateral economic and trade relationship; REALIZING that it is in the interests of both countries that trade grow and that there is adherence to international norms so as to promote market-based outcomes; CONVINCED of the benefits of contributing to the harmonious development and expansion of world trade and providing a catalyst to broader international cooperation; ACKNOWLEDGING the existing trade and investment concerns that have been identified by the Parties; and RECOGNIZING the desirability of resolving existing and any future trade and investment concerns as constructively and expeditiously as possible, HAVE AGREED as follows:
1-1 CHAPTER 1 INTELLECTUAL PROPERTY Section A: General Obligations The United States recognizes the importance of intellectual property protection. China recognizes the importance of establishing and implementing a comprehensive legal system of intellectual property protection and enforcement as it transforms from a major intellectual property consumer to a major intellectual property producer. China believes that enhancing intellectual property protection and enforcement is in the interest of building an innovative country, growing innovation-driven enterprises, and promoting high quality economic growth. Article 1.1: China and the United States hereby affirm that they undertake provisions with respect to intellectual property, as set forth in Sections A through K. Article 1.2: The Parties shall ensure fair, adequate, and effective protection and enforcement of intellectual property rights. Each Party shall ensure fair and equitable market access to persons of the other Party that rely upon intellectual property protection. Section B: Trade Secrets and Confidential Business Information The United States emphasizes trade secret protection. China regards trade secret protection as a core element of optimizing the business environment. The Parties agree to ensure effective protection for trade secrets and confidential business information and effective enforcement against the misappropriation of such information.1 Article 1.3: Scope of Actors Liable for Trade Secret Misappropriation 1. The Parties shall ensure that all natural or legal persons can be subject to liability for trade secret misappropriation. 1 The Parties agree that the term ''confidential business information'' concerns or relates to the trade secrets, processes, operations, style of works, or apparatus, or to the production, business transactions, or logistics, customer information, inventories, or amount or source of any income, profits, losses, or expenditures of any person, natural or legal, or other information of commercial value, the disclosure of which is likely to have the effect of causing substantial harm to the competitive position of such person from which the information was obtained.
1-2 2. China shall define ''operators'' in trade secret misappropriation to include all natural persons, groups of persons, and legal persons. 3. The United States affirms that existing U.S. measures afford treatment equivalent to that provided for in this Article. Article 1.4: Scope of Prohibited Acts Constituting Trade Secret Misappropriation 1. The Parties shall ensure that the scope of prohibited acts subject to liability for trade secret misappropriation provides full coverage for methods of trade secret theft. 2. China shall enumerate additional acts constituting trade secret misappropriation, especially: (a) electronic intrusions; (b) breach or inducement of a breach of duty not to disclose information that is secret or intended to be kept secret; and (c) unauthorized disclosure or use that occurs after the acquisition of a trade secret under circumstances giving rise to a duty to protect the trade secret from disclosure or to limit the use of the trade secret. 3. China and the United States agree to strengthen cooperation on trade secret protection. 4. The United States affirms that existing U.S. measures afford treatment equivalent to that provided for in this Article. Article 1.5: Burden-Shifting in a Civil Proceeding 1. The Parties shall provide that the burden of production of evidence or burden of proof, as appropriate, shifts to the accused party in a civil judicial proceeding for trade secret misappropriation where the holder of a trade secret has produced prima facie evidence, including circumstantial evidence, of a reasonable indication of trade secret misappropriation by the accused party. 2. China shall provide that: (a) the burden of proof or burden of production of evidence, as appropriate, shifts to the accused party to show that it did not misappropriate a trade secret once a holder of a trade secret produces: (i) evidence that the accused party had access or opportunity to obtain a trade secret and the information used by the accused party is materially the same as that trade secret;
1-3 (ii) evidence that a trade secret has been or risks being disclosed or used by the accused party; or (iii) other evidence that its trade secret(s) were misappropriated by the accused party; and (b) under the circumstance that the right holder provides preliminary evidence that measures were taken to keep the claimed trade secret confidential, the burden of proof or burden of production of evidence, as appropriate, shifts to the accused party to show that a trade secret identified by a holder is generally known among persons within the circles that normally deal with the kind of information in question or is readily accessible, and therefore is not a trade secret. 3. The United States affirms that existing U.S. measures afford treatment equivalent to that provided for in this Article. Article 1.6: Provisional Measures to Prevent the Use of Trade Secrets 1. The Parties shall provide for prompt and effective provisional measures to prevent the use of misappropriated trade secrets. 2. China shall identify the use or attempted use of claimed trade secret information as an ''urgent situation'' that provides its judicial authorities the authority to order the grant of a preliminary injunction based on the specific facts and circumstances of a case. 3. The United States affirms that existing U.S. measures afford treatment equivalent to that provided for in this Article. Article 1.7: Threshold for Initiating Criminal Enforcement 1. The Parties shall eliminate any requirement that the holder of a trade secret establish actual losses as a prerequisite to initiation of a criminal investigation for misappropriation of a trade secret. 2. China shall: (a) as an interim step, clarify that ''great loss'' as a threshold for criminal enforcement under the trade secret provision in the relevant law can be fully shown by remedial costs, such as those incurred to mitigate damage to business operations or planning or to re-secure computer or other systems, and substantially lower all the thresholds for initiating criminal enforcement; and (b) as a subsequent step, eliminate in all applicable measures any requirement that the holder of a trade secret establish actual losses as a prerequisite to initiation of a criminal investigation for misappropriation of a trade secret.
1-4 Article 1.8: Criminal Procedures and Penalties 1. The Parties shall provide for the application of criminal procedures and penalties to address willful trade secret misappropriation. 2. China's criminal procedures and penalties shall at least encompass cases of trade secret misappropriation through theft, fraud, physical or electronic intrusion for an unlawful purpose, and the unauthorized or improper use of a computer system in the scope of prohibited acts. 3. The United States affirms that existing U.S. measures afford treatment equivalent to that provided for in this Article. Article 1.9: Protecting Trade Secrets and Confidential Business Information from Unauthorized Disclosure by Government Authorities 1. To further strengthen the protection of trade secrets, as well as better encourage various enterprises to innovate, China shall prohibit the unauthorized disclosure of undisclosed information, trade secrets, or confidential business information by government personnel or third party experts or advisors in any criminal, civil, administrative, or regulatory proceedings conducted at either the central or sub-central levels of government in which such information is submitted. 2. China shall require administrative agencies and other authorities at all levels to: (a) limit requests for information to no more than necessary for the legitimate exercise of investigative or regulatory authority; (b) limit access to submitted information to only government personnel necessary for the exercise of legitimate investigative or regulatory functions; (c) ensure the security and protection of submitted information; (d) ensure that no third party experts or advisors who compete with the submitter of the information or have any actual or likely financial interest in the result of the investigative or regulatory process have access to such information; (e) establish a process for persons seeking an exemption from disclosure and a mechanism for challenging disclosures to third parties; and (f) provide criminal, civil, and administrative penalties, including monetary fines, the suspension or termination of employment, and, as part of the final measures amending the relevant laws, imprisonment, for the unauthorized disclosure of a trade secret or confidential business information that shall deter such unauthorized disclosure.
1-5 3. The United States affirms that existing U.S. measures afford treatment equivalent to that provided for in this Article. Section C: Pharmaceutical-Related Intellectual Property Pharmaceuticals are a matter concerning people's life and health, and there continues to be a need for finding new treatments and cures, such as for cancer, diabetes, hypertension, and stroke, among others. To promote innovation and cooperation in the pharmaceutical sector and to better meet the needs of patients, the Parties shall provide for effective protection and enforcement of pharmaceutical-related intellectual property rights, including patents and undisclosed test or other data submitted as a condition of marketing approval. Article 1.10: Consideration of Supplemental Data 1. China shall permit pharmaceutical patent applicants to rely on supplemental data to satisfy relevant requirements for patentability, including sufficiency of disclosure and inventive step, during patent examination proceedings, patent review proceedings, and judicial proceedings. 2. The United States affirms that existing U.S. measures afford treatment equivalent to that provided for in this Article. Article 1.11: Effective Mechanism for Early Resolution of Patent Disputes 1. If China permits, as a condition of approving the marketing of a pharmaceutical product, including a biologic, persons, other than the person originally submitting the safety and efficacy information, to rely on evidence or information concerning the safety and efficacy of a product that was previously approved, such as evidence of prior marketing approval by China or in another territory, China shall provide: (a) a system to provide notice to a patent holder, licensee, or holder of marketing approval, that such other person is seeking to market that product during the term of an applicable patent claiming the approved product or its approved method of use; (b) adequate time and opportunity for such a patent holder to seek, prior to the marketing of an allegedly infringing product, available remedies in subparagraph (c); and (c) procedures for judicial or administrative proceedings and expeditious remedies, such as preliminary injunctions or equivalent effective provisional measures, for the timely resolution of disputes concerning the validity or infringement of an applicable patent claiming an approved pharmaceutical product or its approved method of use.
1-6 2. China shall establish a nationwide system for pharmaceutical products consistent with paragraph 1, including by providing a cause of action to allow the patent holder, licensee, or holder of marketing approval to seek, prior to the marketing approval of an allegedly infringing product, civil judicial proceedings and expeditious remedies for the resolution of disputes concerning the validity or infringement of an applicable patent. China may also provide for administrative proceedings for the resolution of such disputes. 3. The United States affirms that existing U.S. measures afford treatment equivalent to that provided for in this Article. Section D: Patents Article 1.12: Effective Patent Term Extension 1. The Parties shall provide patent term extensions to compensate for unreasonable delays that occur in granting the patent or during pharmaceutical product marketing approvals. 2. China shall provide that: (a) China, at the request of the patent owner, shall extend the term of a patent to compensate for unreasonable delays, not attributable to the applicant, that occur in granting the patent. For purposes of this provision, an unreasonable delay shall at least include a delay in the issuance of the patent of more than four years from the date of filing of the application in China, or three years after a request for examination of the application, whichever is later. (b) With respect to patents covering a new pharmaceutical product that is approved for marketing in China and methods of making or using a new pharmaceutical product that is approved for marketing in China, China, at the request of the patent owner, shall make available an adjustment of the patent term or the term of the patent rights of a patent covering a new product, its approved method of use, or a method of making the product to compensate the patent owner for unreasonable curtailment of the effective patent term as a result of the marketing approval process related to the first commercial use of that product in China. Any such adjustment shall confer all of the exclusive rights, subject to the same limitations and exceptions, of the patent claims of the product, its method of use, or its method of manufacture in the originally issued patent as applicable to the approved product and the approved method of use of the product. China may limit such adjustments to no more than five years and may limit the resulting effective patent term to no more than 14 years from the date of marketing approval in China. 3. The United States affirms that existing U.S. measures afford treatment equivalent to that provided for in this Article.
1-7 Section E: Piracy and Counterfeiting on E-Commerce Platforms In order to promote the development of e-commerce, China and the United States shall strengthen cooperation and jointly and individually combat infringement and counterfeiting in the e-commerce market. The Parties shall reduce piracy and counterfeiting, including by reducing barriers, if any, to making legitimate content available in a timely manner to consumers and eligible for copyright protection, and providing effective enforcement against e-commerce platforms. Article 1.13: Combating Online Infringement 1. China shall provide enforcement procedures that permit effective and expeditious action by right holders against infringement that occurs in the online environment, including an effective notice and takedown system to address infringement. 2. China shall: (a) require expeditious takedowns; (b) eliminate liability for erroneous takedown notices submitted in good faith; (c) extend to 20 working days the deadline for right holders to file a judicial or administrative complaint after receipt of a counter-notification; and (d) ensure validity of takedown notices and counter-notifications, by requiring relevant information for notices and counter-notifications and penalizing notices and counter-notifications submitted in bad faith. 3. The United States affirms that existing U.S. enforcement procedures permit action by right holders for infringement that occurs in the online environment. 4. The Parties agree to further cooperate, as appropriate, to combat infringement. Article 1.14: Infringement on Major E-Commerce Platforms 1. The Parties shall combat the prevalence of counterfeit or pirated goods on e-commerce platforms by taking effective action with respect to major e-commerce platforms that fail to take necessary measures against the infringement of intellectual property rights. 2. China shall provide that e-commerce platforms may have their operating licenses revoked for repeated failures to curb the sale of counterfeit or pirated goods. 3. The United States affirms that it is studying additional means to combat the sale of counterfeit or pirated goods.
1-8 Section F: Geographical Indications The Parties shall ensure full transparency and procedural fairness with respect to the protection of geographical indications, including safeguards for generic2 terms (also known as common names), respect for prior trademark rights, and clear procedures to allow for opposition and cancellation, as well as fair market access for exports of a Party relying on trademarks or the use of generic terms. Article 1.15: Geographical Indications and International Agreements 1. China shall ensure that any measures taken in connection with pending or future requests from any other trading partner for recognition or protection of a geographical indication pursuant to an international agreement do not undermine market access for U.S. exports to China of goods and services using trademarks and generic terms. 2. China shall give its trading partners, including the United States, necessary opportunities to raise disagreement about enumerated geographical indications in lists, annexes, appendices, or side letters, in any such agreement with another trading partner. 3. The United States affirms that existing U.S. measures afford treatment equivalent to that provided for in this Article. Article 1.16: General Market Access-related GI Concerns 1. China shall ensure that: (a) competent authorities, when determining whether a term is generic in China, take into account how consumers understand the term in China, including as indicated by the following: (i) competent sources such as dictionaries, newspapers, and relevant websites; (ii) how the good referenced by the term is marketed and used in trade in China; (iii) whether the term is used, as appropriate, in relevant standards to refer to a type or class of goods in China, such as pursuant to a standard promulgated by the Codex Alimentarius; and (iv) whether the good in question is imported into China, in significant quantities, from a place other than the territory identified in the application or petition, and in a way that will not mislead the public about its place of origin, and whether those imported goods are named by the term, and 2 The term ''generic'' may be deemed by a Party to be synonymous with ''a term customary in the common language as the common name for the associated good.''
1-9 (b) any geographical indication, whether granted or recognized pursuant to an international agreement or otherwise, may become generic over time, and may be subject to cancellation on that basis. 2. The United States affirms that existing U.S. measures afford treatment equivalent to that provided for in this Article. Article 1.17: Multi-Component Terms 1. Each Party shall ensure that an individual component of a multi-component term that is protected as a geographical indication in the territory of a Party shall not be protected in that Party if that individual component is generic. 2. When China provides geographical indication protection to a multi-component term, it shall publicly identify which individual components, if any, are not protected. 3. The United States affirms that existing U.S. measures afford treatment equivalent to that provided for in this Article. Section G: Manufacture and Export of Pirated and Counterfeit Goods Pirated and counterfeit goods severely undermine the interests of the general public and harm right holders in both China and the United States. The Parties shall take sustained and effective action to stop the manufacture and to block the distribution of pirated and counterfeit products, including those with a significant impact on public health or personal safety. Article 1.18: Counterfeit Medicines 1. The Parties shall take effective and expeditious enforcement action against counterfeit pharmaceutical and related products containing active pharmaceutical ingredients, bulk chemicals, or biological substances. 2. Measures China shall take include: (a) taking effective and expeditious enforcement action against the related products of counterfeit medicines and biologics, including active pharmaceutical ingredients, bulk chemicals, and biological substances; (b) sharing with the United States the registration information of pharmaceutical raw material sites that have been inspected by Chinese regulatory authorities and that comply with the requirements of Chinese laws and regulations, as well as any necessary information of relevant enforcement inspections; and (c) publishing online annually, beginning within six months after the date of entry into force of this Agreement, the data on enforcement measures, including seizures,
1-10 revocations of business licenses, fines, and other actions taken by the National Medical Products Administration, Ministry of Industry and Information Technology, or any successor entity. 3. The United States affirms that existing U.S. measures afford effective and expeditious action against counterfeit pharmaceutical and related products. Article 1.19: Counterfeit Goods with Health and Safety Risks 1. The Parties shall ensure sustained and effective action to stop the manufacture and distribution of counterfeit products with a significant impact on public health or personal safety. 2. Measures China shall take include significantly increasing the number of enforcement actions within three months after the date of entry into force of this Agreement, and publishing data online on the measurable impact of these actions each quarter, beginning within four months after the date of entry into force of this Agreement. 3. The Parties shall endeavor, as appropriate, to strengthen cooperation to combat counterfeit goods that pose health and safety risks. Article 1.20: Destruction of Counterfeit Goods 1. With respect to border measures, the Parties shall provide that: (a) goods that have been suspended from release by its customs authorities on grounds that they are counterfeit or pirated, and that have been seized and forfeited as pirated or counterfeit, shall be destroyed, except in exceptional circumstances; (b) the simple removal of a counterfeit trademark unlawfully affixed shall not be sufficient to permit the release of the goods into the channels of commerce; and (c) in no event shall the competent authorities have discretion, except in exceptional circumstances, to permit the exportation of counterfeit or pirated goods or to subject such goods to other customs procedures. 2. With respect to civil judicial procedures, the Parties shall provide that: (a) at the right holder's request, goods that have been found to be pirated or counterfeit shall be destroyed, except in exceptional circumstances; (b) at the right holder's request, its judicial authorities shall order that materials and implements that have been predominantly used in the manufacture or creation of such pirated or counterfeit goods be, without compensation of any sort, promptly destroyed or, in exceptional circumstances and without compensation of any sort, disposed of outside the channels of commerce in such a manner as to minimize the risks of further infringements;
1-11 (c) the simple removal of a counterfeit trademark unlawfully affixed shall not be sufficient to permit the release of goods into the channels of commerce; and (d) at the right holder's request, its judicial authorities shall order a counterfeiter to pay right holders the profits from infringement or damages adequate to compensate for the injury from the infringement. 3. With respect to criminal procedures, the Parties shall provide that: (a) its judicial authorities, except in exceptional cases, shall order the forfeiture and destruction of all counterfeit or pirated goods and any articles consisting of a counterfeit mark to be affixed to goods; (b) its judicial authorities, except in exceptional cases, shall order the forfeiture and destruction of materials and implements that have been predominantly used in the creation of pirated or counterfeit goods; (c) forfeiture and destruction shall occur without compensation of any kind to the defendant; and (d) its judicial or other competent authorities shall keep an inventory of goods and other material proposed to be destroyed, and these authorities shall have the discretion to temporarily exempt these materials from the destruction order to facilitate the preservation of evidence on notice by the right holder that it wishes to bring a civil or administrative case against the defendant or any third-party infringer. 4. The United States affirms that existing U.S. measures afford treatment equivalent to that provided for in this Article. Article 1.21: Border Enforcement Actions 1. The Parties shall endeavor to strengthen enforcement cooperation with a view to reducing the amount of counterfeit and pirated goods, including those that are exported or in transit. 2. China shall provide a sustained increase in the number of trained personnel to inspect, detain, seize, effect administrative forfeiture, and otherwise execute customs' enforcement authority against counterfeit and pirated goods, with an emphasis on counterfeit and pirated goods that are exported or in transit. Measures China shall take include significantly increasing training of relevant customs enforcement personnel within nine months after the date of entry into force of this Agreement. China also shall significantly increase the number of enforcement actions beginning within three months after the date of entry into force of this Agreement, and publishing online quarterly updates of enforcement actions. 3. The Parties agree to carry out cooperation with respect to border enforcement as
1-12 appropriate. Article 1.22: Enforcement at Physical Markets 1. The Parties shall take sustained and effective action against copyright and trademark infringement at physical markets. 2. Measures China shall take include significantly increasing the number of enforcement actions beginning within four months after the date of entry into force of this Agreement, and publishing online quarterly updates of enforcement actions at physical markets. 3. The United States affirms that existing U.S. measures afford effective enforcement against copyright and trademark infringement at physical markets. Article 1.23: Unlicensed Software 1. The Parties shall ensure that all government agencies and all entities that the government owns or controls install and use only licensed software. 2. Measures China shall take include requiring annual audits by qualified third parties of China with no government ownership or affiliation and the publication online of the audit results, beginning within seven months after the date of entry into force of this Agreement. 3. The United States affirms that existing U.S. measures require government agencies and contractors to install and use only licensed software. Section H: Bad-Faith Trademarks Article 1.24: With a view to strengthening trademark protection, the Parties shall ensure adequate and effective protection and enforcement of trademark rights, particularly against bad faith trademark registrations. Article 1.25: The United States affirms that existing U.S. measures afford treatment equivalent to that provided for in this Section. Section I: Judicial Enforcement and Procedure in Intellectual Property Cases Article 1.26: Transfer from Administrative Enforcement to Criminal Enforcement 1. China shall require the administrative authorities to transfer a case for criminal
1-13 enforcement, if, under an objective standard, there is ''reasonable suspicion'' based on articulable facts that a criminal violation of an intellectual property right has occurred. 2. The United States affirms that U.S. authorities have the authority to refer appropriate cases for criminal enforcement. Article 1.27: Deterrent-Level Penalties 1. The Parties shall provide civil remedies and criminal penalties sufficient to deter future intellectual property theft or infringements. 2. China shall: (a) as an interim step, deter future intellectual property theft or infringements and strengthen the application of existing remedies and penalties by imposing a heavier punishment at or near the statutory maximum permitted under its laws related to intellectual property to deter intellectual property theft or infringements; and (b) as a subsequent step, increase the range of minimum and maximum pre-established damages, sentences of imprisonment, and monetary fines to deter future intellectual property theft or infringements. 3. The United States shall endeavor, as appropriate, to strengthen communication and cooperation with China under the bilateral Intellectual Property Criminal Enforcement Working Group and to consider opportunities for more experience-sharing and pragmatic cooperation regarding criminal enforcement of intellectual property rights. Article 1.28: Enforcement of Judgments 1. The Parties shall ensure expeditious enforcement of any fine, penalty, payment of monetary damages, injunction, or other remedy for a violation of an intellectual property right ordered in a final judgment by its own court. 2. Measures China shall take include executing work guidelines and implementation plans to ensure expeditious enforcement of judgments, publishing its work guidelines and implementation plans within one month after the date of entry into force of this Agreement, as well as publishing online quarterly reports of implementation results. 3. The United States affirms that existing U.S. measures afford expeditious enforcement of judgments, including those pertaining to violations of intellectual property rights. Article 1.29: Enforcement of Copyright and Related Rights 1. In civil, administrative, and criminal proceedings involving copyright or related rights, the Parties shall:
1-14 (a) provide for a legal presumption that, in the absence of proof to the contrary, the person whose name is indicated as the author, producer, performer, or publisher of the work, performance, or phonogram in the usual manner is the designated right holder in such work, performance, or phonogram and that the copyright or related right subsists in such subject matter; (b) when the presumption in subparagraph (a) holds, waive requirements to present copyright or related rights transfer agreements or other documentation in order to establish ownership, licensing, or infringement of copyright or related rights, in the absence of rebuttal evidence presented by the accused infringer; and (c) provide that the accused infringer has the burden of production of evidence or burden of proof, as appropriate, to demonstrate that its use of a work protected by copyright or related rights is authorized, including in a case where the accused infringer claims to have obtained permission to use the work, such as through a license, from the right holder. 2. The United States affirms that existing U.S. measures afford treatment equivalent to that provided for in this Article. Article 1.30: Document Authentication (''Consularization'') 1. In civil judicial procedures, the Parties shall not require formalities to authenticate evidence, including requiring a consular official's seal or chop, that can be introduced or authenticated through stipulation, or witness testimony under penalty of perjury. 2. For evidence that cannot be introduced or authenticated through stipulation, or witness testimony under penalty of perjury, China shall streamline notarization and authentication procedures. 3. The United States affirms that existing U.S. measures afford treatment equivalent to that provided for in this Article. Article 1.31: Witness Testimony 1. In civil judicial proceedings, China shall afford a party a reasonable opportunity to present witnesses or experts in its case and cross-examine any witness testifying in the proceeding. 2. The United States affirms that existing U.S. measures afford treatment equivalent to that provided for in this Article. Section J: Bilateral Cooperation on Intellectual Property Protection Article 1.32:
1-15 Cooperation activities and initiatives undertaken in connection with the intellectual property chapter of this Agreement shall be subject to the availability of resources, and on request, and on terms and conditions mutually agreed upon between the Parties. Article 1.33: The Parties agree to strengthen bilateral cooperation on the protection of intellectual property rights and promote pragmatic cooperation in this area. China National Intellectual Property Administration and the United States Patent and Trademark Office will discuss biennial cooperation work plans in the area of intellectual property, including joint programs, industry outreach, information and expert exchanges, regular interaction through meetings and other communications, and public awareness. Section K: Implementation Article 1.34: Each Party shall determine the appropriate method of implementing the provisions of this Agreement within its own system and practice. If necessary, each Party shall provide suggestions for the amendment of laws to its legislative body according to its domestic legislation procedure. Consistent with the Bilateral Evaluation and Dispute Resolution Chapter, each Party shall ensure that its obligations under this Agreement are fully implemented. Article 1.35: Within 30 working days after the date of entry into force of this Agreement, China will promulgate an Action Plan to strengthen intellectual property protection aimed at promoting its high-quality growth. This Action Plan shall include, but not be limited to, measures that China will take to implement its obligations under this Chapter and the date by which each measure will go into effect. Article 1.36: The United States affirms that its existing measures are consistent with its obligations in this Chapter.
2-1 CHAPTER 2 TECHNOLOGY TRANSFER The Parties affirm the importance of ensuring that the transfer of technology occurs on voluntary, market-based terms and recognize that forced technology transfer is a significant concern. The Parties further recognize the importance of undertaking steps to address these issues, in light of the profound impact of technology and technological change on the world economy. To enhance mutual trust and cooperation between the Parties with respect to technology issues, protect intellectual property, promote trade and investment, and establish a foundation for addressing long-standing structural concerns, the Parties have agreed as follows: Article 2.1: General Obligations 1. Natural or legal persons (''persons'') of a Party shall have effective access to and be able to operate openly and freely in the jurisdiction of the other Party without any force or pressure from the other Party to transfer their technology to persons of the other Party. 2. Any transfer or licensing of technology between persons of a Party and those of the other Party must be based on market terms that are voluntary and reflect mutual agreement. 3. A Party shall not support or direct the outbound foreign direct investment activities of its persons aimed at acquiring foreign technology with respect to sectors and industries targeted by its industrial plans that create distortion. Article 2.2: Market Access Neither Party shall require or pressure persons of the other Party to transfer technology to its persons in relation to acquisitions, joint ventures, or other investment transactions. Article 2.3: Administrative and Licensing Requirements and Processes 1. Neither Party shall adopt or maintain administrative and licensing requirements and processes that require or pressure technology transfer from persons of the other Party to its persons.
2-2 2. Neither Party shall require or pressure, formally or informally, persons of the other Party to transfer technology to its persons as a condition for, inter alia: (a) approving any administrative or licensing requirements; (b) operating in the jurisdiction of the Party or otherwise having access to the Party's market; or (c) receiving or continuing to receive any advantages conferred by the Party. 3. Neither Party shall require or pressure, formally or informally, persons of the other Party to use or favor technology that is owned by or licensed to its persons as a condition for, inter alia: (a) approving any administrative or licensing requirements; (b) operating in the jurisdiction of the Party, or otherwise having access to the Party's market; or (c) receiving or continuing to receive any advantages conferred by the Party. 4. The Parties shall make their administrative and licensing requirements and processes transparent. 5. The Parties shall not require or pressure foreign persons to disclose sensitive technical information not necessary to show conformity with the relevant administrative or regulatory requirements. 6. The Parties shall protect the confidentiality of any sensitive technical information disclosed by foreign persons during any administrative, regulatory, or other review processes. Article 2.4: Due Process and Transparency 1. The Parties shall ensure that any enforcement of laws and regulations with respect to persons of the other Party is impartial, fair, transparent, and non-discriminatory. 2. The Parties shall ensure that rules of procedure for administrative proceedings related to the subject matter of this Agreement are published and provide meaningful notice regarding, at a minimum, the subject matter of the proceeding, applicable laws and regulations, rules of evidence, and relevant remedies and sanctions. 3. The Parties shall provide that persons of the other Party have the right to: (a) review evidence and have a meaningful opportunity to respond in any administrative proceedings against them; and
2-3 (b) be represented by legal counsel in administrative proceedings. Article 2.5: Scientific and Technological Cooperation The Parties agree to carry out scientific and technological cooperation where appropriate.
3-1 CHAPTER 3 TRADE IN FOOD AND AGRICULTURAL PRODUCTS1 Article 3.1: General 1. To enhance mutual trust and friendly cooperation between China and the United States on issues affecting agricultural trade, to establish a foundation for addressing long-standing concerns, and to make agriculture a strong pillar of the bilateral relationship, the Parties: (a) recognizing the importance of their agriculture sectors, of ensuring safe and reliable supplies of food and agricultural products, and of helping to meet the demand of the two countries' peoples for food and agricultural products, intend to intensify cooperation in agriculture, to expand each Party's market for food and agricultural products, and to promote the growth of trade in food and agricultural products between the Parties; (b) considering that science- and risk- based sanitary and phytosanitary (SPS) measures play a crucial role in the protection of human, animal, and plant life and health, while the use of SPS measures for purposes of protectionism negatively impacts the welfare of consumers and producers, and recognizing the importance of ensuring that SPS measures are science-based, non-discriminatory, and account for regional differences in sanitary and phytosanitary characteristics, agree that neither Party shall apply sanitary or phytosanitary measures in a manner which would constitute a disguised restriction on international trade; (c) considering that the benefits of an agricultural trading system are reduced when importers and exporters are unfairly impeded from taking full advantage of agricultural market access opportunities, recognize that tariff-rate quota (TRQ) administration should not be employed as a means of preventing the full utilization of agricultural TRQs; (d) noting the ability of agricultural biotechnology to improve lives by helping to feed growing populations, by reducing the environmental impact of agriculture, and by promoting more sustainable production, intend to maintain, for products of agricultural biotechnology, science- and risk-based regulatory frameworks and efficient authorization processes, in order to facilitate increased trade in such products; and 1 Article 8.5 (Final Provisions) shall not apply with respect to any proposed or final measure, including an amendment to an existing measure, intended to implement this Chapter, including its Annexes and Appendices.
3-2 (e) acknowledge the importance of each Party adhering to its World Trade Organization (WTO) commitments with respect to the provision of domestic support. 2. Annexes 1-17 set out further commitments. Annex 1. Agricultural Cooperation 1. The Parties intend to strengthen and promote cooperative activities, to be mutually agreed upon by the Parties, in agricultural science and agricultural technology. Such activities may include mutually agreed information exchanges and cooperation. The Parties intend their cooperative activities to be based on, among other things, the principles of integrity, reciprocity, openness, transparency, science, and rule of law. 2. The Parties intend to conduct technical consultations with each other on areas of potential cooperation related to pesticides for agricultural use. These consultations may include discussions of the Parties' pesticide registration data and pesticide trial data, and discussions on the setting of maximum residue levels. 3. The Parties intend to continue implementing and improving the China-United States Scientific Cooperation and Exchange Program to promote further exchanges on agriculture-related issues between U.S. and Chinese scientific and technical experts. Each Party intends to ensure the participation, as appropriate, of relevant agencies or ministries of its government in activities of the program. 4. The Parties intend to encourage exchanges and dialogues on agricultural topics between, as appropriate, U.S. and Chinese national and sub-national government authorities, farmers, academics, businesses in the agriculture sector, and others. The Parties intend to continue implementation and improvement of existing mechanisms for bilateral communication on agricultural policy, such as the Joint Committee on Cooperation in Agriculture, and to facilitate communication on agricultural policy through participation of officials from both the U.S. and Chinese governments in relevant conferences on this topic, including the China Food Security and Food Safety Strategy Summit and the United States' and China's respective Agricultural Outlook conferences. 5. The Parties intend to promote communication between U.S. and Chinese technical experts on agricultural subjects of mutual interest, including, as appropriate, on production agriculture, crop insurance, trade in agricultural products, sanitary and phytosanitary matters, and rural development. 6. The Parties intend to cooperate in technical discussions, as appropriate, related to sustainable agricultural development. 7. The Parties intend to enhance, as appropriate, their information sharing on animal and plant pests and diseases, including through technical exchange visits. The Parties intend to
3-3 communicate, as appropriate, their experiences with enhancing capacity to control animal and plant pests and diseases, and through such communication to promote disease detection and the research and development of technologies for the detection and control of such diseases and pests. 8. The Parties intend to engage each other cooperatively on agriculture-related technical, and sanitary and phytosanitary, measures, including on the subject of risk communication. The Parties intend to engage each other cooperatively on these subjects including by increasing cooperation on them in international organizations, such as the WTO, Asia-Pacific Economic Cooperation, the United Nations Food and Agriculture Organization (FAO), and the Codex Alimentarius Commission (Codex). 9. The Parties intend to establish cooperation mechanisms, under the framework of the 2019 Osaka Declaration on Digital Economy, for the discussion of ways in which digital technologies can benefit the agriculture sector. 10. The Parties intend to include all relevant agencies of their governments in the governmental activities discussed in this Annex. 11. For greater certainty, nothing in this Annex shall obligate either Party to expend, obligate, or transfer any funds, or to dedicate personnel or other resources to any cooperative activity. Annex 2. Dairy and Infant Formula 1. As soon as practicable following the date of entry into force of this Agreement, the General Administration of Customs of the People's Republic of China (GACC) and the U.S. Food and Drug Administration (FDA) shall initiate bilateral technical discussions to review Import Alert 99-30 '•Detention Without Physical Examination of All Milk Products, Milk Derived Ingredients and Finished Food Products Containing Milk from China due to the Presence of Melamine and/or Melamine Analogs'– in order to clarify the steps necessary for the removal of Import Alert 99-30. Dairy Products 2. Aiming to better meet Chinese consumers' ever-growing needs for dairy products, China shall: (a) upon entry into force of this Agreement, allow imports of U.S. dairy products that are: (i) manufactured at a facility on a list compiled by the FDA; and (ii) accompanied by an Agricultural Marketing Service (AMS) dairy sanitary certificate;
3-4 (b) within 10 days of the date of entry into force of this Agreement, recognize the U.S. dairy-safety system as providing at least the same level of protection as China's dairy-safety system; (c) each time the United States provides China with an updated and complete list of dairy facilities and products under the jurisdiction of the FDA, within 20 working days of receipt of the list: (i) register the facilities and publish the list of facilities and products on the GACC website; and (ii) allow U.S. dairy imports into China from those facilities; (d) allow imports of U.S. dairy products of bovine, ovine, and caprine origins when accompanied by an AMS dairy sanitary certificate; (e) with respect to extended shelf life (ESL) milk: (i) allow ESL milk produced in the United States to be imported and sold as pasteurized milk in China; (ii) notify the draft standard to the WTO should China undertake development of a new standard for ESL milk; (iii) ensure that the new standard and all implementing actions are consistent with China's WTO obligations; and (iv) allow imports of U.S. ESL milk consistent with Paragraph 2(a), (c), and (d); (f) with respect to fortified milk: (i) allow fortified milk produced in the United States to be imported into China subject to China's National Food Safety Standard - Modified Milk (GB25191), consistent with Paragraph 2(a), (c), and (d); (ii) allow such product to be labeled and sold to consumers as '•pasteurized-modified milk'– provided the product is pasteurized; (iii) notify the draft standard to the WTO should China undertake development of a new standard for fortified milk; and (iv) ensure that the new standard and all implementing actions are consistent with China's WTO obligations; (g) with respect to U.S. ultrafiltered fluid milk:
3-5 (i) allow U.S. ultrafiltered fluid milk to be imported into China referring to China's National Food Safety Standard - Modified Milk (GB25191), consistent with Paragraph 2(a), (c), and (d) and such products should be labeled with '•ultrafiltration technology'–; (ii) allow such products to be labeled as '•pasteurized-modified milk'– provided the product is pasteurized; (iii) notify the draft standard to the WTO once China develops a draft of a new standard for ultrafiltered milk; and (iv) ensure that the new standard and all implementing actions are consistent with China's WTO obligations; and (h) with respect to U.S. dairy permeate powder: (i) within 60 working days of the date of entry into force of this Agreement: a. complete the approval process for U.S. dairy permeate powder for human consumption consistent with the requirements of the Notice of the General Office of the National Health and Family Planning Commission for Regulating the Review of Imported Foods for Which There Is No Chinese National Food Safety Standards (GuoWeiBanShiPinFa [2017] No.14); and b. allow the importation of U.S. dairy permeate powder; (ii) notify the draft standard to the WTO should China undertake development of a new standard for dairy permeate powder; and (iii) ensure that the new standard and all implementing actions are consistent with China's WTO obligations. Infant Formula 3. Aiming to better meet Chinese consumers' ever-growing needs for infant formula products, China shall: (a) take into full consideration section 412 of the U.S. Federal Food, Drug, and Cosmetic Act (21 U.S.C. § 350a) and its implementing regulations when China reviews applications for, and decides on, the registration of U.S. infant formula products;
3-6 (b) accept, complete review of, and issue a decision on product registration applications regardless of whether the submitting entity is associated with an already-registered facility; (c) complete technical reviews of infant formula product registration applications and do so ordinarily within 45 working days from receipt of the application; (d) normally complete within 40 working days of completing the technical review, provided the U.S. manufacturer provides timely access if needed, any audit, inspection, sampling, or testing that is required in order to register an infant formula product; (e) taking into consideration the FDA's previous product reviews, inspections, and determinations of the regulatory standing of the facility or facilities where the product is manufactured, complete the product registration within 20 working days following completion of the technical review or of any required audit, inspection, sampling, or testing; (f) ensure non-disclosure of all trade secrets provided in the infant formula product registration process; (g) each time the United States provides China with an updated and complete list of infant formula facilities under the jurisdiction of the FDA, within 20 working days of receipt of the list, register the facilities, publish the list on the GACC website, and allow U.S. infant formula imports into China from those facilities, provided the infant formula product is registered with the State Administration of Market Regulation; (h) not require renewal of registration of: (i) infant formula facilities more frequently than once every four years; and (ii) infant formula products more frequently than once every five years; (i) take into account previous Chinese audit reports, U.S. regulatory information, and any other relevant information, including information provided by the manufacturer, when determining whether a facility inspection is required for product registration or re-registration; and (j) within one week of the date of entry into force of this Agreement, register those U.S. infant formula facilities whose products have been approved in China and that have facility registration applications pending review by the GACC by publishing the complete list of facilities on the GACC website. Audits and Inspections for Dairy Products and Infant Formula
3-7 4. China shall: (a) at least 20 working days in advance of any inspection or audit at a U.S. dairy or infant formula facility, notify the FDA, the U.S. Department of Agriculture (USDA), and the facility; (b) to streamline procedures, improve efficiency, and advance trade facilitation, not require an on-site audit or inspection as a pre-requisite to registering a dairy or infant formula facility; and (c) ensure that any audit or inspection it conducts for an infant formula product registration or for the registration of a dairy or infant formula facility is for verification of either the U.S. system of oversight or of the ability of the facility to meet the applicable requirements. 5. China continues to have the right to audit the U.S. dairy and infant formula food safety regulatory system, including a representative sample of U.S. dairy and infant formula facilities, in coordination with the FDA. Such auditing shall be risk-based. China also continues to have the right to conduct inspections of a risk-based selection of shipments of U.S. dairy and infant formula products at the port of entry. If China determines, based on scientific inspection, that a particular shipment of U.S dairy or infant formula products is in violation of applicable food safety import requirements, China may refuse importation of that shipment. If China determines that there is a significant, sustained or recurring pattern of non-conformity with an applicable food safety measure by a particular facility, China may refuse to accept shipments from that facility until the problem is resolved. China shall notify the FDA of such non-conformity. The Parties shall exchange information on their dairy and infant formula food safety regulatory systems and other public-health matters. Annex 3. Poultry 1. The Parties shall sign and implement the Protocol on Cooperation on Notification and Control Procedures for Certain Significant Poultry Diseases within 30 days of the date of entry into force of this Agreement. 2. For those U.S. poultry and poultry products imported into China prior to January 1, 2015, China shall, within 30 days of the date of entry into force of this Agreement, issue, based on its previously-conducted assessment of the U.S. regulatory system, a final decision on whether to permit the importation of the product. China shall permit their importation consistently with existing bilaterally-agreed import protocols. 3. China shall maintain measures consistent with the 2018 World Organization for Animal Health (OIE) Terrestrial Animal Health Code Chapter 10.4, or any successor provisions. 4. Within 30 days following receipt from China of a formal request for an evaluation of a region of China for avian disease free recognition and a completed information package to
3-8 support such a request that addresses the eight factors outlined in 9 CFR Part 92, or any successor provisions, the USDA's Animal and Plant Health Inspection Service (APHIS) shall initiate such an evaluation. Annex 4. Beef 1. The Parties shall continue implementing the 2017 Protocol for the importation of U.S. beef and beef products into China; however, this Agreement shall prevail over any requirements in the Protocol that are inconsistent with this Agreement. The two Parties may revise the Protocol according to this Agreement if appropriate. 2. China acknowledges that the United States has submitted all relevant and necessary information as requested by China to enable completion of a risk assessment related to the importation of all U.S. beef, beef products, and pet food containing ruminant ingredients. China shall, within one month of the date of entry into force of this Agreement, eliminate the cattle age requirements for the importation of U.S. beef and beef products. 3. China recognizes the U.S. beef and beef products traceability system. The U.S. Government, in accordance with U.S. regulations, continuously maintains measures, including for traceability, that meet or exceed OIE guidelines for maintaining negligible risk status for the bovine disease addressed in Chapter 11.4 of the 2018 OIE Terrestrial Animal Health Code. Provided the United States maintains its OIE negligible risk classification for that disease, China shall not impose new import restrictions or requirements related to that disease on imports of U.S. beef. Should the United States' negligible risk status change, China shall administer the regulations for imports of U.S. beef in accordance with the 2018 OIE Terrestrial Animal Health Code, Chapter 11.4, Article 11.4.11 or any successor provisions. 4. Aiming to better meet Chinese consumers' ever-growing needs for meat, within one month of the date of entry into force of this Agreement, China shall permit the importation into China of those beef and beef products, except for those listed in Appendix I (Beef, Pork, and Poultry Products Considered Not Eligible for Import into China), inspected by the USDA's Food Safety and Inspection Service (FSIS) in an FSIS-approved facility. 5. Within one month of the date of entry into force of this Agreement, China shall adopt maximum residue limits (MRLs) for zeranol, trenbolone acetate, and melangesterol acetate for imported beef. For beef tissues for which Codex has established MRLs for these hormones, China shall adopt the Codex MRLs. For beef tissues for which Codex has not established MRLs for these hormones, China shall adopt its MRLs by following Codex standards and guidelines and referring to MRLs established by other countries that have performed science-based risk assessments. Annex 5. Live Breeding Cattle
3-9 1. Based on the request and information provided by the United States on February 13, 2019, and on March 6, 2019, the Parties shall, within one month of the date of entry into force of this Agreement, commence technical discussions on the preparation of a U.S. export health certificate and a protocol for the importation into China of U.S. breeding cattle, with a view to realizing trade as soon as possible. Annex 6. Pork 1. The Parties intend to promote cooperative activities within the Global African Swine Fever Research Alliance (GARA) to share publicly-available scientific knowledge and information to contribute to the progressive control and eradication of African swine fever (ASF). 2. Aiming to better meet Chinese consumers' ever growing needs for meat, within 10 working days of the date of entry into force of this Agreement China shall permit the importation into China of those pork and pork products inspected by the FSIS in an FSIS-approved facility. Annex 7. Meat, Poultry and Processed Meat 1. Upon entry into force of this Agreement, China shall recognize FSIS oversight of U.S. meat, poultry meat, and processed meat and poultry meat facilities for purposes of allowing imports of U.S. meat, poultry meat, and processed meat and poultry meat. 2. Upon entry into force of this Agreement, China shall accept meat, poultry meat, and processed meat and poultry meat, except for those products listed in Appendix I (Beef, Pork, and Poultry Products Considered Not Eligible for Import into China), inspected by the FSIS in an FSIS-approved facility and accompanied by a FSIS Export Certificate of Wholesomeness (FSIS 9060-5/FSIS 9295-1). 3. Each time the United States provides China with an updated and complete list of FSIS-approved facilities, China shall, within 20 working days of receipt, publish the list on the GACC website and allow the importation into China of products from all facilities on the list. 4. China continues to have the right to audit the U.S. meat and poultry food safety regulatory system, including a representative sample of U.S. meat and poultry facilities, in coordination with the FSIS. Such auditing shall be risk-based. China also continues to have the right to conduct inspections of a risk-based selection of shipments of U.S. meat and poultry products at the port of entry. If China determines, based on scientific inspection, that a particular shipment of U.S. meat or poultry products is in violation of applicable food safety import requirements, China may refuse importation of that shipment. If China determines that there is a significant, sustained or recurring pattern of non-conformity with an applicable food safety measure by a particular facility, China may refuse to accept shipments from that facility until the problem is resolved. China shall notify the FSIS of such non-conformity. The Parties shall exchange information on their meat and poultry food safety regulatory systems and other public-health matters.
3-10 5. In consultation with U.S. experts, China shall conduct a risk assessment for ractopamine in cattle and swine as soon as possible without undue delay, and in a manner consistent both with Codex and FAO/World Health Organization (WHO) Joint Expert Committee on Food Additives (JECFA) risk assessment guidance and with the risk assessment for ractopamine previously conducted by the FAO/WHO JECFA. The risk assessment shall be based on verifiable data and the approved conditions of ractopamine use in the United States. China and the United States shall establish a joint working group to discuss the steps to be taken based on the results of the risk assessment. Annex 8. Electronic Meat and Poultry Information System 1. Aiming to streamline trade and deepen cooperation between the United States and China with respect to certification, the GACC shall work with the USDA to finalize the technical requirements for, and to implement, an electronic and automated system for China to access FSIS export certificates accompanying U.S. exports to China of meat, poultry, and meat and poultry products. 2. Provided the United States has implemented the system, and demonstrates the reliability and safety of the system, China shall also implement the system by February 2020. China shall accept via the system all information, including FSIS certificates, necessary to allow shipments of U.S. meat, poultry, and meat and poultry products into China and shall provide relevant certificate information in a timely manner to the Chinese port customs officials. 3. The USDA has a directive permitting replacement certificates in certain instances when appropriate. The GACC shall accept replacement certificates, provided that the FSIS ensures that replacement certificates are clearly identifiable. China shall accept replacement certificates issued by the USDA for situations that include the following: (a) the original certificate did not contain required information; (b) the original certificate contained typographical errors; (c) the importer, exporter, consignee, or consignor changed, but is within the same country that appears on the original certificate; (d) the certificate is lost or damaged; or (e) the port of entry changed. Annex 9. Aquatic Products 1. As soon as practicable following the entry into force of this Agreement, the GACC and the FDA shall resume bilateral meetings of the U.S.-China Technical Working Group on
3-11 Seafood. The Technical Working Group shall identify steps China can take to provide evidence for FDA to assess whether China has controls that would ensure that Chinese aquatic products exported to the United States meet U.S. requirements. The United States confirms that if a Chinese aquatic product producer or exporter submits sufficient evidence to the FDA and the FDA determines that the firm and product should be excluded from Import Alert 16-131, the Chinese aquatic product producer or exporter shall be added to the Green List for Import Alert 16-131. 2. Aiming to better meet Chinese consumers' ever-growing needs for aquatic products, as soon as practicable following the entry into force of this Agreement, the GACC and the U.S. National Oceanic and Atmospheric Administration (NOAA) shall meet to discuss the process for approving the importation into China of the aquatic species that are sold in U.S. interstate commerce but that are not authorized for sale in China. If the NOAA submits sufficient evidence to the GACC concerning one of these aquatic species, the GACC shall determine whether the species is safe to consume and will be allowed to be imported into China. 3. Within 20 working days of the date of entry into force of this Agreement, China shall allow imports into China from those: (a) aquatic products facilities considered to be in good regulatory standing by the FDA and also registered by the GACC, when the shipment is accompanied by the bilaterally''agreed certificate issued by the NOAA; and (b) fish meal processing facilities considered to be in good regulatory standing by the NOAA and also registered by the GACC, when the shipment is accompanied by the bilaterally-agreed certificate issued by the NOAA. 4. China shall: (a) each time the United States provides China with an updated and complete list of aquatic products facilities under the jurisdiction of the FDA, within 20 working days of receipt of the list, register the facilities, publish the list of the facilities on the GACC website, and allow U.S. aquatic product imports into China from those facilities; and (b) each time the United States provides China with an updated and complete list of fish meal processing facilities under the jurisdiction of the NOAA, within 20 working days of receipt of the list, register the facilities, publish the list of the facilities on the GACC website, and allow U.S. fish meal imports into China from those facilities. 5. China continues to have the right to audit the U.S. aquatic products food safety regulatory system, including a representative sample of U.S. aquatic product facilities, in coordination with the FDA. Such auditing shall be risk-based. China also continues to have the right to conduct inspections of a risk-based selection of shipments of U.S. aquatic products at the port of entry. If China determines that a particular shipment of U.S. aquatic products is in violation of applicable
3-12 food safety import requirements, China may refuse importation of that shipment. If China determines that there is a significant, sustained or recurring pattern of non-conformity with an applicable food safety measure by a particular facility, China may refuse to accept shipments from that facility until the problem is resolved. China shall notify the FDA of such non-conformity. The Parties shall exchange information on their aquatic products food safety regulatory systems and other public-health matters concerning aquatic products. Annex 10. Rice 1. Each time the United States provides China with a list of rice facilities approved by the APHIS as compliant with the Phytosanitary Protocol on the Import of Rice from the United States to China, within 20 working days of receipt of the list, China shall register the facilities, publish the list of facilities, and allow the importation of U.S. rice from each of the APHIS-approved rice facilities. China continues to have the right to conduct on-site phytosanitary audits of registered rice facilities. Annex 11. Plant Health 1. Within one month of the date of entry into force of this Agreement, the Parties shall start technical consultations in order to sign, as soon as possible, a phytosanitary protocol on Chinese Bonsai in growing mediums for export to the United States excluding orchids, with a view to realizing trade as soon as possible. 2. Within 45 days of the date of entry into force of this Agreement, USDA/APHIS shall complete its regulatory notice process for imports of Chinese fragrant pear. 3. Within two months of the date of entry into force of this Agreement, USDA/APHIS shall complete its regulatory notice process for imports of Chinese citrus. 4. Within one month of the date of entry into force of this Agreement, USDA/APHIS shall complete its regulatory notice process for imports of Chinese Jujube. 5. Within seven working days of the date of entry into force of this Agreement, USDA/APHIS and the GACC shall sign and implement a phytosanitary protocol to allow the importation of U.S. fresh potatoes for processing into China. 6. Within one month of the date of entry into force of this Agreement, USDA/APHIS and the GACC shall sign and implement a phytosanitary protocol to allow the importation of California nectarines into China. 7. Within three months of the date of entry into force of this Agreement, USDA/APHIS and the GACC shall sign and implement a phytosanitary protocol to allow the importation of U.S. blueberries into China.
3-13 8. Within three months of the date of entry into force of this Agreement, USDA/APHIS and the GACC shall sign and implement a phytosanitary protocol to allow the importation of California Hass avocadoes into China. 9. Within three months of the date of entry into force of this Agreement, USDA/APHIS and the GACC shall sign and implement a phytosanitary protocol to allow the importation of U.S. barley into China. The GACC, in coordination with USDA/APHIS, may conduct an on-site visit of U.S. barley production. 10. Within one month of the date of entry into force of this Agreement, the GACC shall meet with USDA/APHIS and conduct an on-site visit of U.S. production of U.S. alfalfa hay pellets and cubes, U.S. almond meal pellets and cubes, and U.S. timothy hay. Within three months of the date of entry into force of this Agreement, USDA/APHIS and the GACC shall sign and implement a phytosanitary protocol to allow importation into China of these products. 11. The Parties confirm they shall not require a phytosanitary certificate for the importation from the other Party of frozen fruits and vegetables. 12. The Parties shall continue technical consultations concerning facilitation of trade in grain and oilseed products. Annex 12. Feed Additives, Premixes, Compound Feed, Distillers' Dried Grains, and Distillers' Dried Grains with Solubles 1. To streamline procedures, improve efficiencies, and advance trade facilitation, and to better meet demand for feed to promote the development of animal husbandry, China shall: (a) not require an on-site audit or inspection as a condition for registering facilities or for approving the importation into China of feed additives, premixes, compound feed products, Distillers' Dried Grains (DDG), and Distillers' Dried Grains with Solubles (DDGS); (b) not require an export protocol as a condition for permitting the importation into China of feed additives, premixes, compound feed products, DDG, and DDGS; and (c) ensure that its requirements for imports of feed additives, premixes, compound feed products, DDG, and DDGS from the United States are consistent with international standards and guidelines. 2. Each time that the United States provides China with an updated and complete list of U.S. feed additive, premix, compound feed product, DDG, and DDGS facilities, China shall, within 20 working days of receiving the information, register the facilities, publish the list on the GACC website, and allow imports of feed additives, premixes, compound feed products, DDG, and DDGS from U.S. facilities appearing on the list on the GACC website.
3-14 3. China shall: (a) (i) within three months of receiving an application from a U.S. DDG or DDGS manufacturer for the approval of the importation into China of one of its products, complete the review of that application; and (ii) within 20 working days of completing the review of that application, issue a license allowing importation of the product into China; and (b) within 20 working days of receiving an application from a U.S. DDG or DDGS manufacturer that holds or has held a license permitting importation into China of one of its products, but whose license: (i) expired on or after January 1, 2017, or (ii) is scheduled to expire after that date, issue a license to that manufacturer allowing imports of the product into China. 4. China shall: (a) within nine months of receiving an application for the approval of the importation into China of a new feed additive, premix, or compound feed product, complete its review of that application and add the product onto China's List of Feed and Feed Additives; (b) within three months of receiving a new application for the approval of the importation into China of a feed additive, premix, or compound feed product, complete its review of that application and issue a license allowing importation of the product; and (c) within 20 working days of receiving an application for renewal for a feed additive, premix, or compound feed product license, issue a renewed license allowing importation of the product. 5. China continues to have the right to audit the U.S. feed additive, premix, compound feed, DDG, and DDGS feed safety regulatory system, including a representative sample of U.S. feed additive, premix, compound feed, DDG, and DDGS feed facilities, in coordination with the relevant U.S. competent authority. Such auditing shall be risk-based. China also continues to have the right to conduct inspections of a risk-based selection of shipments of U.S. feed additive, premix, compound feed, DDG, and DDGS feed products at the port of entry. If China determines, based on scientific inspection, that a particular shipment of U.S. feed additives, premix, compound feed, DDG, and DDGS feed is in violation of applicable feed safety import requirements, China may refuse importation of that shipment. If China determines that there is a significant, sustained or recurring pattern of non-conformity with an applicable feed safety
3-15 measure by a particular facility, China may refuse to accept shipments from that facility until the problem is resolved. China shall notify the relevant U.S. competent authority of such non-conformity. The Parties shall exchange information on their feed additive, premix, compound feed, DDG, and DDGS feed safety regulatory systems. Annex 13. Pet Food and Non-ruminant Derived Animal Feed 1. China shall: (a) within one month of the date of entry into force of this Agreement: (i) lift its ban on U.S. pet food containing ruminant ingredients in accordance with Annex 4.2 (Beef); and (ii) eliminate the use of Polymerase Chain Reaction (PCR) testing on all U.S. pet food products containing ruminant ingredients, and limit PCR testing of U.S. pet food products not containing ruminant ingredients to a risk-based selection of shipments; (b) upon entry into force of this Agreement, allow the importation of U.S. pet foods containing poultry products; (c) not require completion or submission of any facility questionnaire for registration purposes, except that China may request completion of a facility questionnaire with respect to a facility that China is auditing; and (d) allow the importation of pet foods with animal-origin ingredients from a 3rd country as long as the ingredients are legally imported into the United States, meet U.S. domestic requirements for inclusion in pet food, and are traceable to the country of origin. 2. Upon entry into force of this Agreement, the Parties shall engage in technical discussions to discuss the importation of U.S. pet food into China. Within two months of the date of entry into force of this Agreement, the Parties shall sign a protocol on U.S. pet food imports into China. Before a new protocol is signed, China shall continue to allow imports of U.S. pet food as detailed in the Protocol on the Veterinary Health Requirements for Non-Ruminant Derived Animal Feed and Tallow to be Imported from the United States of America to the People's Republic of China, dated November 18, 2004. 3. China has completed its review of 24 new U.S. pet food and animal feed facilities and shall, within five working days of the date of entry into force of this Agreement, include those facilities on the list of facilities allowed to export to China pet food or non-ruminant derived animal feed.
3-16 4. The United States shall, on a monthly basis, provide to China any updates to the list of U.S. pet food and non-ruminant derived animal feed facilities that the United States has determined to be eligible to export pet food or non-ruminant derived animal feed to China. Upon receipt of each update to the list, China shall, within 20 working days, register the facilities, publish the updates to the list of facilities on the GACC website, and allow imports of pet food and non-ruminant derived animal feed from U.S. facilities on the list on the GACC website. 5. China continues to have the right to audit the U.S. pet food and non-ruminant derived animal feed safety regulatory system, including a representative sample of U.S. pet food and non-ruminant derived animal feed facilities, in coordination with the relevant U.S. competent authority. Such auditing shall be risk-based. China also continues to have the right to conduct inspections of a risk-based selection of shipments of U.S. pet food and non-ruminant derived animal feed at the port of entry. If China determines, based on scientific inspection, that a particular shipment of U.S pet food and non-ruminant derived animal feed is in violation of applicable pet food and non-ruminant derived animal feed safety import requirements, China may refuse importation of that shipment. If China determines that there is a significant, sustained or recurring pattern of non-conformity with an applicable feed safety measure by a particular facility, China may refuse to accept shipments from that facility until the problem is resolved. China shall notify the relevant U.S. competent authority of such non-conformity. The Parties shall exchange information on their pet food and non-ruminant derived animal feed safety regulatory systems. Annex 14. Tariff Rate Quotas 1. China shall ensure that, from December 31, 2019, its TRQ measures for wheat, rice, and corn are in conformity with the Panel Report in China-Tariff Rate Quotas for Certain Agricultural Products and the WTO agreements, including China's commitments under the Protocol on the Accession of the People's Republic of China to the WTO and China's Schedule CLII, Part I, Section 1(B). 2. The entirety of China's TRQs for wheat, rice, and corn (WRC TRQs) for each year shall be allocated by January 1 of that year to end-users. China shall ensure that it does not inhibit the filling of its WRC TRQs. 3. China's requirements for WRC TRQ eligibility, allocation, return, reallocation, and penalties shall not discriminate between State Trading Enterprises (STEs) and non-STEs and shall apply equally to the STE share of the WRC TRQ and the non-STE share of the WRC TRQ. For the purposes of China's WRC TRQ administration measures, '•end-users'– and '•enterprises'– include STEs when allocated a WRC TRQ. 4. China shall reallocate all unused and returned WRC TRQ amounts, including all unused and returned amounts allocated to STEs or designated as part of the '•STE share,'– by October 1 of each year. Only new applicants and entities other than those returning unused quotas shall be eligible to receive reallocated WRC TRQ amounts.
3-17 5. China shall make all WRC TRQ allocations in commercially viable shipping amounts. 6. China shall clearly specify and publish all eligibility criteria for its WRC TRQs and all allocation principles for its WRC TRQ administration, and the allocation principles shall be relevant to the importation, processing, or sale of the commodity subject to the WRC TRQ. China shall ensure that a sufficient number of STE and non-STE entities, including new quota applicants, are eligible to receive WRC TRQ allocations, and that the full utilization of its WRC TRQs is not inhibited. 7. Consistent with China's WTO obligations, at the request of the United States, China shall provide the relevant WRC TRQ allocation and reallocation information requested. 8. Each Party shall make available on a public website existing laws, regulations, and announcements on its administration of WRC TRQs, if any, and publish any change to them in a timely manner. Upon request of a Party, the Parties shall hold consultations on TRQ administration pursuant to the Bilateral Evaluation and Dispute Resolution Chapter. Annex 15. Domestic Support 1. China shall respect its WTO obligations to publish in an official journal its laws, regulations, and other measures pertaining to its domestic support programs and policies. 2. For greater certainty, nothing in this Agreement limits the rights of the United States under the WTO Dispute Settlement Understanding against China with respect to China's domestic support measures. Annex 16. Agricultural Biotechnology 1. To help realize the benefits of agricultural biotechnology for sustainable agriculture, the Parties agree to carry out exchanges on agricultural biotechnology, and intend to take steps to enhance engagement with the public concerning agricultural biotechnology and public awareness of scientific information relevant to agricultural biotechnology, with the aim of building public confidence in, and acceptance of, the use of safe biotechnology in agriculture and the food system. 2. China shall implement a transparent, predictable, efficient, science- and risk-based regulatory process for safety evaluation and authorization of products of agricultural biotechnology. For agricultural biotechnology products for feed or further processing, China shall significantly reduce, to no more than 24 months, the average amount of time between: (a) the submission of a formal application for authorization of such a product; and (b) the final decision on approval or disapproval of the product.
3-18 China shall base its safety evaluation procedures on the relevant international standards and recommendations of Codex and the International Plant Protection Convention. China shall base any safety evaluation that it conducts on scientific data and information obtained using appropriate methods and analyzed using appropriate statistical techniques. 3. The Parties shall strengthen communication on biotechnology regulation, in order to increase mutual understanding and to facilitate trade in products of agricultural biotechnology. 4. China shall: (a) within five working days of receipt of the product dossier submitted in support of a formal application for approval of a product of agricultural biotechnology, pre-screen for completeness, by means of comparison against the requirements on the application form, the dossier and inform the applicant of any deficiencies in the sufficiency of information in the dossier; (b) accept complaints from applicants concerning the operation of the approval procedure for agricultural biotechnology products to be used for purposes of food, feed, and processing, and take corrective action upon receipt of a justified complaint; (c) when additional information from an applicant is necessary for the National Biosafety Committee (NBC) to finalize a safety evaluation, within 20 working days of the NBC meeting at which the NBC ascertained its need for the additional information, request all such information in writing and provide a written explanation to the applicant of how the requested information would be relevant to the safety of the product's intended use; (d) when additional information has been submitted to the NBC by an applicant, ensure that the NBC meets as soon as possible and as often as necessary thereafter in order to finalize the NBC's review of the application; and (e) convene at least two NBC meetings per year and increase, depending on the number of applications, the frequency of NBC meetings as much as necessary. 5. China shall establish an authorization period of at least five years for any agricultural biotechnology product. 6. China shall, within 12 months of the date of entry into force of this Agreement, establish and make public a simplified, predictable, science- and risk-based, and efficient safety-assessment procedure for approval of food ingredients derived from genetically modified microorganisms. 7. China shall:
3-19 (a) accept applications for agricultural biotechnology product approvals on an on-going, year-round basis; (b) if prior to receipt by China of a formal application for approval of an agricultural biotechnology product but following the submission of the dossier for the product to U.S. authorities, the dossier for the product is submitted to China, pre-screen the dossier within five working days of receipt for completeness against the Chinese requirements that will apply following the submission of a formal application for approval of the product in China; (c) upon receipt of a formal application, begin review of any application for approval of an agricultural biotechnology product; (d) not request information unnecessary for assessing the safety of a product for its intended use; and (e) for any product that passes China's safety evaluation, make the administrative decision of approval and issue a biosafety certificate within 20 working days of conclusion of the NBC meeting. 8. In the event of an occurrence of low-level presence (LLP) affecting a U.S. shipment exported to China, China shall: (a) without undue delay, inform the importer or the importer's agent of the LLP occurrence and of any additional pertinent information that will be required to be submitted to assist China to make a decision on the management of the LLP occurrence; (b) provide to the United States a summary of any risk or safety assessment that China has conducted in connection with the LLP occurrence; (c) ensure that the LLP occurrence is managed without unnecessary delay; and (d) take into account any relevant risk or safety assessment provided, and authorization granted, by the United States or any foreign country when deciding how to manage the LLP occurrence. 9. China shall evaluate inadvertent or technically unavoidable LLP occurrences on a case-by-case basis to minimize trade disruptions. 10. The Parties agree to organize experts to conduct further studies on the issue of LLP and to collaborate internationally on practical approaches to addressing LLP. Annex 17. Food Safety
3-20 1. The Parties shall not implement food safety regulations, or require actions of the other Party's regulatory authorities, that are not science- or risk-based and shall only apply such regulations and require such actions to the extent necessary to protect human life or health.
3-21 Appendix I: Beef, Pork, and Poultry Products Considered Not Eligible for Import into China U.S. statutes and regulations require the condemnation of meat and poultry carcasses, parts thereof, and products, found to be diseased, adulterated or otherwise unfit at the time of slaughter, or during any subsequent inspection. The FSIS does not allow meat or poultry products that are determined to be unqualified, or that are contaminated'--for example, with feces, foreign material, or cerebral fluid from cattle'--to enter commerce. Animals that display systemic signs of disease or pathologies are condemned. FSIS Public Health Veterinarians certify on the FSIS certificate that the meat or poultry products are from animals that received both antemortem and postmortem inspection and were found sound and healthy. In addition, the product has been inspected and passed as provided by law and regulations of the USDA, and is wholesome, and suitable for human consumption The following is a list of products that are not eligible for importation into China, including when incorporated into further-processed products: (a) beef and pork: thyroid glands, adrenal glands, uropygial glands, tonsils, major lymph nodes exposed during slaughter and cutting, laryngeal muscle tissue, lungs, pancreas, spleen, gallbladder, uterus, hair, hoofs, and lactating mammary glands; (b) horns from cattle; (c) mechanically separated beef and distal ileum from cattle of any age; (d) brain, skull, eyes, trigeminal ganglia, spinal cord, dorsal root ganglia, and vertebral column (excluding the vertebrae of the tail, the transverse processes of the thoracic and lumbar vertebrae, and the wings of the sacrum), from cattle 30 months of age and older; and (e) feathers, heads, intestines, and tails of poultry.
3-22 January 15, 2020 Ambassador Gregg Doud Chief Agricultural Negotiator Office of the U.S. Trade Representative 600 17th Street, N.W. Washington, D.C. 20250 Dear Ambassador Doud, I have the honor to confirm the following agreement reached between representatives of the Government of the People's Republic of China ('•China'–) and representatives of the Government of the United States of America ('•United States'–): China shall not require certification for low risk food products from the United States, including all U.S. products considered by the United States to be highly processed, shelf-stable food products. Additionally, China shall participate in the electronic working group established by the Codex Alimentarius Commission Committee on Food Import and Export Inspection and Certification Systems on food fraud and food integrity. I have the honor to propose that this letter and your letter in reply confirming that your Government shares this agreement shall constitute an agreement between our two governments, which shall be subject to the provisions of the Bilateral Evaluation and Dispute Resolution Chapter of the Economic and Trade Agreement Between the Government of the People's Republic of China and the Government of the United States of America, dated January 15, 2020, and shall enter into force on the date of entry into force of that agreement. Sincerely, Vice Minister Han Jun
3-23 January 15, 2020 Vice Minister Han Jun Ministry of Agriculture and Rural Affairs 11 Nongzhanguan Nanli Beijing 100125 People's Republic of China Dear Vice Minister Han, I am pleased to acknowledge your letter of January 15, 2020, which reads as follows: I have the honor to confirm the following agreement reached between representatives of the Government of the People's Republic of China ('•China'–) and representatives of the Government of the United States of America ('•United States'–): China shall not require certification for low risk food products from the United States, including all U.S. products considered by the United States to be highly processed, shelf-stable food products. Additionally, China shall participate in the electronic working group established by the Codex Alimentarius Commission Committee on Food Import and Export Inspection and Certification Systems on food fraud and food integrity. I have the honor to propose that this letter and your letter in reply confirming that your Government shares this agreement shall constitute an agreement between our two governments which shall be subject to the provisions of the Bilateral Evaluation and Dispute Resolution Chapter of the Economic and Trade Agreement Between the Government of the People's Republic of China and the Government of the United States of America, dated January 15, 2020, and shall enter into force on the date of entry into force of that agreement. I have the further honor to confirm that my Government shares this agreement and that your letter and this letter in reply shall constitute an agreement between our governments, which shall be subject to the provisions of the Bilateral Evaluation and Dispute Resolution Chapter of the Economic and Trade Agreement Between the Government of the United States of America and the Government of the People's Republic of China, dated January 15, 2020, and shall enter into force on the date of entry into force of that agreement. Sincerely, Ambassador Gregg Doud Chief Agricultural Negotiator
3-24 January 15, 2020 Ambassador Gregg Doud Chief Agricultural Negotiator Office of the U.S. Trade Representative 600 17th Street, N.W. Washington, D.C. 20250 Dear Ambassador Doud, I have the honor to confirm the following agreement reached between representatives of the Government of the People's Republic of China ('•China'–) and representatives of the Government of the United States of America ('•United States'–): Based on its previously-concluded assessment of the U.S. aquatic-product regulatory system, China shall, upon entry into force of the Economic and Trade Agreement Between the Government of the People's Republic of China and the Government of the United States of America, dated January 15, 2020 (the '•Trade Agreement'–), approve the importation into China from the United States of the aquatic species listed in Attachment 1 of this letter. China shall, within 5 working days of the date of entry into force of the Trade Agreement, include the 23 U.S. feed additives, premixes, and compound feed products listed in Attachment 2 of this letter on China's list of Traditionally Traded Products and allow imports into China from the United States of those feed additives, premixes, and compound feed products. I have the honor to propose that this letter and your letter in reply confirming that your Government shares this agreement shall constitute an agreement between our two governments, which shall be subject to the provisions of the Bilateral Evaluation and Dispute Resolution Chapter of the Trade Agreement, dated January 15, 2020, and shall enter into force on the date of entry into force of that agreement. Sincerely, Vice Minister Han Jun
3-25 January 15, 2020 Vice Minister Han Jun Ministry of Agriculture and Rural Affairs 11 Nongzhanguan Nanli Beijing 100125 People's Republic of China Dear Vice Minister Han, I am pleased to acknowledge your letter of January 15, 2020, which reads as follows: I have the honor to confirm the following agreement reached between representatives of the Government of the People's Republic of China ('•China'–) and representatives of the Government of the United States of America ('•United States'–): Based on its previously-concluded assessment of the U.S. aquatic-product regulatory system, China shall, upon entry into force of the Economic and Trade Agreement Between the Government of the People's Republic of China and the Government of the United States of America, dated January 15, 2020 (the '•Trade Agreement'–), approve the importation into China from the United States of the aquatic species listed in Attachment 1 of this letter. China shall, within 5 working days of the date of entry into force of the Trade Agreement, include the 23 U.S. feed additives, premixes, and compound feed products listed in Attachment 2 of this letter on China's list of Traditionally Traded Products and allow imports into China from the United States of those feed additives, premixes, and compound feed products. I have the honor to propose that this letter and your letter in reply confirming that your Government shares this agreement shall constitute an agreement between our two governments, which shall be subject to the provisions of the Bilateral Evaluation and Dispute Resolution Chapter of the Trade Agreement, dated January 15, 2020, and shall enter into force on the date of entry into force of that agreement. I have the further honor to confirm that my Government shares this agreement and that your letter and this letter in reply shall constitute an agreement between our governments, which shall be subject to the provisions of the Bilateral Evaluation and Dispute Resolution Chapter of the Economic and Trade Agreement Between the Government of the United States of America and the Government of the People's Republic of China, dated January 15, 2020, and shall enter into force on the date of entry into force of that agreement. Sincerely, Ambassador Gregg Doud Chief Agricultural Negotiator
3-26 Attachment 1: U.S. Aquatic Species List Aquatic Species Scientific Name Product Name Antarctic Krill Euphausia superba Antarctic Krill Oil Chinook/King Salmon Oncorhynchustshawytscha Fish Oil Chum Salmon Oncorhynchus keta Fish Oil Coho Salmon Oncorhynchus kisutch Fish Oil Pink Salmon Oncorhynchusgorbuscha Fish Oil Sockeye Salmon Oncorhynchus nerka Fish Oil Freshwater Drum Aplodinotus grunniens Frozen Freshwater Drum Fish Bowfin Roe White Shrimp Amia calva Litopenaeus setiferus Frozen Bowfin Roe Frozen Shrimp Western White Shrimp Litopenaeus occidentalis Frozen Shrimp Southern White Shrimp Litopenaeus schmitti Frozen Shrimp Alaska Skate, Skate wings Bathyraja pramifera Alaska Skate, Skate wings Conch Meats Busycon canaliculatum Conch Meats Conch Meats Busycoptus canaliculatus Conch Meats Conch Meats Busycon carica Conch Meats Harlequin Rockfish Sebastes variegatus Frozen fillet Yellow Tail Rockfish Sebastes flavidus Frozen fillet Widow Rockfish Sebastes entomelas Frozen fillet Shortraker Rockfish Sebastes borealis Frozen fillet Rougheye Rockfish Sebastes aleutianus Frozen fillet Black Rockfish Sebastes melanops Frozen fillet Redbanded Rockfish Sebastes babcocki Frozen fillet Redstripe Rockfish Sebastes proriger Frozen fillet American Shad Alosa sapidissima Frozen/chilled Pollock (oil) Gadus chalcogrammus Fish Oil Pollock (oil) Theragra chalcogramma Fish Oil Pacific whiting (oil) Merluccius productus Fish Oil
3-27 Attachment 2: Traditionally Traded Products 序号 No. 批准号 Register Number ç--Ÿäº§åŠ 工企业名称Establishment Name 产å'åç§°Product Name 产å'ç--¨é-- Usage of Product åŽŸæ– Raw Material 1 美国ACG产å'æ'‰éå…¬å¸ ACG Products Ltd., USA 饲æ–å®' Feed Bond é¥²æ–æŠ—ç>>'å'—剂 Anti-caking Agent æ‰æ'‰åЍç‰(C) All animal æ°´åç…é''酸é' é' Hydrated Sodium Calcium Aluminosilicate 2 美国奥特奇公司 Alltech Inc., USA 奥è乐 Optimase é¥²æ–æ·>>åŠ å‰‚å°ç´ Feed Additive Urea å°ç´ Urea 3 美国奥特奇公司 Alltech Inc., USA ä¼çŸ¥ä¹ Sow Advantage æ¯çŒªå¾®é‡å…ƒç´ éæ··åé¥²æ– Trace Mineral Premix for Sow çŸç‰(C)è´¨é¥²æ–æ·>>åŠ å‰‚ Natural Minerals 4 美国ç--Ÿç‰(C)ç">>ç>>Ÿæ'‰éå…¬å¸ American Biosystems, Inc., USA 超益 Super Dairy, Combo é¥²æ–æ·>>åŠ å‰‚ Feed Additive 酵母ç' Yeast 5 美国ç½å°--康公司 Balchem Corporation, USA å...žè' NitroShure é¥²æ–æ·>>åŠ å‰‚å°ç´ Feed Additive Urea (Dairy cows) å°ç´ Urea 6 美国Biozyme公司 BioZyme Incorporated 艾美ç... AMAFERM Enzyme Feed grade å…>>殖动ç‰(C) (All species or categories of animals) α'--æ·ç²‰é…¶¼äº§è‡ªç±"曲é'‰¼‰ α-Amylase (by Aspergillus Oryzae) 7 美国Desert King 国酿'‰éå…¬å¸ Desert King International Inc., USA æƒ åº·å®'-30 DK sarsaponin-30 é¥²æ–æ·>>åŠ å‰‚ Feed Additive å®¶ç...½å'ŒçŒª (Poultry and Swine) å¤(C)ç¶ç±>>固醇萨æ´'皂è§'苷¼æºè‡ªä¸'兰¼‰ Yucca (Yucca Schidigera) Extract 8 美国ç...è''èªä>>–ç--Ÿç‰(C)集囿'‰éå…¬å¸ Frondita Biogroup, Inc., USA ç›ŠåŠ Super DFM Plus æ··ååž‹é¥²æ–æ·>>åŠ å‰‚ Mixed Feed Additive å¾®ç--Ÿç‰(C) Feed Additives Mixture Live Microorganisms 9 美国国é…原æ–公司 International Ingredient Corporation 金ä¹" Gold Star Milk 蛋ç½é¥²æ– Protein feed (Piglet and Calf) 奶粉与奶酪 Dried Milk and Dried Cheese 10 美国国é…原æ–公司 International Ingredient Corporation äº--æŸå®' Five Star Booster èƒ½é‡é¥²æ– Energy Feed (Piglets) ç"–ç±>>食å'å‰¯äº§å' Sugar Foods By-Product (Carbohydrates) 11 美国国é…原æ–公司 International Ingredient Corporation 营å…>>金奶粉Nutri-Gold 蛋ç½è´¨é¥²æ– Protein Feed (Livestock, aquaculture and pet) 干奶粉 Dried Milk Powder 12 美国国é…原æ–公司 International Ingredient Corporation 奇饲粉 Cheese Plus Cheese èƒ½é‡é¥²æ– Energy Feed (Swine and calf) 干奶酪产å' Dried Cheese Product
3-28 13 美国国é…原æ–公司 International Ingredient Corporation 巧饲粉 Milk Chocolate Product èƒ½é‡é¥²æ– Energy Feed (Swine and calf) 巧克力ç"–å'Œå·§å…‹åŠ›ç‰›å¥¶å·§é¥²ç²‰ Chocolate Candy & Dried Chocolate Milk 14 美国国é…原æ–公司 International Ingredient Corporation ä¹"清å®' CW-11 蛋ç½è´¨é¥²æ– Protein Feed (Piglet, pet and Aquaculture) 奶酪ä¹"清 Whey and by-product, Lactose and Whey Protein 15 美国国é…原æ–公司 International Ingredient Corporation 奇饲粉 AF-35 奇能ä½" Protein Feed (Piglet, pet and Aquaculture) 奶酪粉å'Œå¤§è±†ç²‰Dried Cheese and Soy Flour 16 美国国é…原æ–公司 International Ingredient Corporation å®'å®'æ´¾ Carbo-Pal é¥²æ–æ·>>åŠ å‰‚ Feed Additive è°·ç‰(C)å'Œç"–ç±>>食å'å‰¯äº§å' cereal food and sugar foods by-products 17 美国国é…原æ–公司 International Ingredient Corporation 营å…>>æ´¾ Nutri-Pal 蛋ç½é¥²æ– Protein feed (Swine) 奶粉与酵母ç' Milk Product and Brewers Dried Yeast 18 美国国é…原æ–公司 International Ingredient Corporation ç¾æ"°A GroBiotic A é¥²æ–æ·>>åŠ å‰‚ Feed Additive 酵母ç' Yeast 19 美国å>>ºæŽå·¥ä¸šæ'‰éå…¬å¸ Kemin Industries, Inc., USA å¾®ç--Ÿåº·é--Œ 27 粉剂 KemTRACE Zinc 27 Dry æ··ååž‹é¥²æ–æ·>>åŠ å‰‚ ä¸é…¸é--Œ Feed Additives Mixture Zinc Propionate (Swine, Ruminent, Poultry) ä¸é…¸é--Œ Zinc Propionate 20 拉曼特种益ç--ŸèŒå…¬å¸ Lallemand Specialties, Inc., USA åç‰¹èµ›Bactocel é¥²æ–æ·>>åŠ å‰‚ Feed Additive (Swine, Poultry, Aquaculture) ä¹"酸片球菌 Pediococcus acidilactici 21 美国乐斯ç...é…µæ¯å…¬å¸ä¹æ–¯ç...é¥²æ–æ·>>åŠ å‰‚ Lesaffre Feed Additives, a division of Lesaffre Yeast Corporation, USA 赛ç...ç'3000 Selyeast 3000 é¥²æ–æ·>>åŠ å‰‚ Feed Additive 酵母ç' Selenium Yeast 22 美盛ä½'ç‰(C)营å…>>æ'‰éå…¬å¸ ç¾Žç››é¥²æ–æ·>>åŠ å‰‚éƒ¨ Mosaic Global Sales, LLC Mosaic Feed Ingredients, a Division of Mosaic Corp Nutrition, LLC 富磷¼ç£·é…¸äºŒæ°é'¼‰ Biofos çŸç‰(C)è´¨é¥²æ–æ·>>åŠ å‰‚ Natural Mineral 磷酸æ°é' Monocalcium Phosphate 23 美国金å®'动ç‰(C)营å…>>国酿'‰éå…¬å¸ Zinpro Animal Nutrition International Inc, USA æ°¨ç>>´ä¹ä¸é--Œ 100 Availa-Zn 100 çŸç‰(C)é¥²æ–æ·>>åŠ å‰‚ Mineral Feed Additive 氨基酸é--Œç>>'åç‰(C) Zinc Amino Acid Complex
4-1 CHAPTER 4 FINANCIAL SERVICES Article 4.1: Objectives The Parties believe that they have a significant opportunity for cooperation and mutual benefit in bilateral services trade. Each Party requests that the other Party ensure fair, effective, and non-discriminatory participation in its market for services and services suppliers of the other Party. The Parties shall work constructively to provide fair, effective, and non-discriminatory market access for each other's services and services suppliers. To that end, the Parties shall take specific actions beginning with the actions set forth in this Chapter with respect to the financial services sector. Article 4.2: Banking Services 1. The Parties acknowledge the importance of mutually beneficial cooperation to enhance market access and strengthen the Parties' respective banking services sectors. 2. China commits that when a qualified subsidiary of a U.S. financial institution provides or seeks to provide securities investment fund custody services, its parent company's overseas assets shall be taken into consideration in order to fulfill applicable asset requirements. Within five months after the date of entry into force of this Agreement, China shall allow branches of U.S. financial institutions to provide securities investment fund custody services, and the parent company's overseas assets shall be taken into consideration in order to fulfill applicable asset requirements. China shall review and approve qualified applications by U.S. financial institutions for securities investment fund custody licenses on an expeditious basis. 3. China affirms that U.S. financial institutions applying to serve as Type-A lead underwriters for all types of non-financial debt instruments shall be evaluated and granted licenses based on the revised formula for granting lead underwriting licenses for non-financial enterprise debt instruments, which takes into account U.S. financial institutions' international qualifications in order to fulfill applicable requirements for the entity seeking the license in China. 4. The United States acknowledges current pending requests by Chinese institutions, including by CITIC Group, and affirms that such requests will be considered expeditiously.
4-2 Article 4.3: Credit Rating Services 1. China affirms that a wholly U.S.-owned credit rating services supplier has been allowed to rate domestic bonds sold to domestic and international investors, including for the interbank market. China commits that it shall continue to allow U.S. service suppliers, including wholly U.S.-owned credit rating services suppliers, to rate all types of domestic bonds sold to domestic and international investors. Within three months after the date of entry into force of this Agreement, China shall review and approve any pending license applications of U.S. service suppliers to provide credit rating services. 2. Each Party shall allow a supplier of credit rating services of the other Party to acquire a majority ownership stake in the supplier's existing joint venture. 3. The United States affirms that it accords non-discriminatory treatment to Chinese credit rating services suppliers. Article 4.4: Electronic Payment Services 1. China shall accept any applications from a U.S. electronic payment services supplier, including an application of a supplier seeking to operate as a wholly foreign-owned entity, to begin preparatory work to become a bank card clearing institution within five working days of submission, and may make a one-time request within those five working days for any corrections or supplementary information. If such a request is made, China shall accept the application within five working days after the applicant has responded to that request. China shall make a determination with respect to the application, including an explanation of any adverse determination, within 90 working days of its acceptance. 2. No later than one month after a U.S. service supplier notifies China that it has completed its preparatory work, China shall accept the license application of such U.S. supplier, including any license application of Mastercard, Visa, or American Express, and shall make a determination with respect to the application, including an explanation of any adverse determination. 3. The United States affirms it accords non-discriminatory treatment to Chinese electronic payment service suppliers, including UnionPay.
4-3 Article 4.5: Financial Asset Management (Distressed Debt) Services 1. The Parties acknowledge the mutual beneficial opportunities in the distressed debt services sector and will work together to promote further opportunities in this sector. 2. China shall allow U.S. financial services suppliers to apply for asset management company licenses that would permit them to acquire non-performing loans directly from Chinese banks, beginning with provincial licenses. When additional national licenses are granted, China shall treat U.S. financial services suppliers on a non-discriminatory basis with Chinese suppliers, including with respect to the granting of such licenses. 3. The United States will continue to allow Chinese financial services suppliers to engage in acquisition and resolution of non-performing loans in the United States. Article 4.6: Insurance Services 1. No later than April 1, 2020, China shall remove the foreign equity cap in the life, pension, and health insurance sectors and allow wholly U.S.-owned insurance companies to participate in these sectors. China affirms that there are no restrictions on the ability of U.S.-owned insurance companies established in China to wholly own insurance asset management companies in China. 2. No later than April 1, 2020, China shall remove any business scope limitations, discriminatory regulatory processes and requirements, and overly burdensome licensing and operating requirements for all insurance sectors (including insurance intermediation), and shall thereafter review and approve expeditiously any application by U.S. financial services suppliers for licenses to supply insurance services. In accordance with this commitment, China affirms that it has eliminated the requirement of thirty-years of insurance business operations for establishment of new foreign insurance companies. 3. The United States acknowledges current pending requests by Chinese institutions, including by China Reinsurance Group, and affirms that such requests will be considered expeditiously. Article 4.7: Securities, Fund Management, Futures Services 1. Each Party shall, on a non-discriminatory basis, review and approve a qualified application of a financial institution of the other Party for a securities, fund management, or futures license. The Parties affirm that licensed financial institutions of the other Party are entitled to supply the same full scope of services in these sectors as licensed financial institutions of the Party.
4-4 2. No later than April 1, 2020, China shall eliminate foreign equity limits and allow wholly U.S.-owned services suppliers to participate in the securities, fund management, and futures sectors. 3. China affirms that it substantially reduced the high net asset value requirement on majority shareholders of securities services suppliers on July 5, 2019. 4. China affirms that existing U.S.-invested securities joint ventures are allowed to retain their existing licenses when they become U.S.-controlled, U.S. majority-owned, or wholly U.S.-owned securities companies. 5. The Parties shall ensure there are no discriminatory restrictions for private fund managers of the other Party. China shall ensure that there is no prohibition on U.S.-owned private fund managers investing in H shares (i.e., shares of mainland Chinese companies listed on the Hong Kong stock exchange) and that qualified U.S.-owned private fund managers may be approved to provide investment advisory services on a case-by-case basis. 6. The Parties affirm that there are no discriminatory restrictions for institutions of the other Party in futures products, including by allowing the institutions of the other Party to invest in the full scope of futures products in which domestic institutions can invest (including financial, interest-rate, and exchange-rate futures). 7. The United States acknowledges current pending requests by Chinese institutions, including by China International Capital Corporation, and affirms that such requests will be considered expeditiously.
5-1 CHAPTER 5 MACROECONOMIC POLICIES AND EXCHANGE RATE MATTERS AND TRANSPARENCY Article 5.1: General Provisions 1. Each Party shall respect the other Party's autonomy in monetary policy, in accordance with its domestic law. 2. The Parties recognize that strong fundamentals, sound policies, and a resilient international monetary system are essential to the stability of exchange rates, contributing to strong and sustainable growth and investment. Flexible exchange rates, where feasible, can serve as a shock absorber. 3. The Parties share the objective of pursuing policies that strengthen underlying economic fundamentals, foster growth and transparency, and avoid unsustainable external imbalances. 4. The Parties shall honor currency-related commitments each has undertaken in G20 communiqu(C)s, including to refrain from competitive devaluations and the targeting of exchange rates for competitive purposes. Article 5.2: Exchange Rate Practices 1. Each Party confirms that it is bound under the International Monetary Fund (IMF) Articles of Agreement to avoid manipulating exchange rates or the international monetary system in order to prevent effective balance of payments adjustment or to gain an unfair competitive advantage. 2. Each Party should: (a) achieve and maintain a market-determined exchange rate regime; and (b) strengthen underlying economic fundamentals, which reinforces the conditions for macroeconomic and exchange rate stability. 3. The Parties shall refrain from competitive devaluations and not target exchange rates for competitive purposes, including through large-scale, persistent, one-sided intervention in exchange markets.
5-2 4. The Parties will communicate regularly and consult on foreign exchange markets, activities, and policies. The Parties will consult with each other regarding the IMF's assessment of the exchange rate of each Party. Article 5.3: Transparency 1. The Parties affirm that they shall continue to disclose publicly within the prescribed timeframes below: (a) monthly foreign exchange reserves data and forward positions according to the IMF's Data Template on International Reserves and Foreign Currency Liquidity, no later than 30 days after the end of each month; (b) quarterly balance of payments for the sub-components of the financial account, including direct investment, portfolio investment, and other investment (loans and receivables), no later than 90 days after the end of each quarter; and (c) quarterly exports and imports of goods and services, no later than 90 days after the end of each quarter. 2. The Parties reaffirm and shall continue to consent to the public disclosure by the IMF of: (a) each IMF Article IV Staff Report on the country of the Party, including the exchange rate assessment, within four weeks of the IMF Executive Board discussion; and (b) confirmation of the Party's participation in the IMF COFER database. 3. If the IMF does not disclose publicly any items listed in paragraph 2 with respect to a Party, that Party shall request that the IMF disclose publicly those items. Article 5.4: Enforcement Mechanism 1. Issues related to exchange rate policy or transparency shall be referred by either the U.S. Secretary of the Treasury or the Governor of the People's Bank of China to the Bilateral Evaluation and Dispute Resolution Arrangement established in Chapter 7 (Bilateral Evaluation and Dispute Resolution). 2. If there is failure to arrive at a mutually satisfactory resolution under the Bilateral Evaluation and Dispute Resolution Arrangement, the U.S. Secretary of the Treasury or the Governor of the People's Bank of China may also request that the IMF, consistent with its mandate:
5-3 (a) undertake rigorous surveillance of the macroeconomic and exchange rate policies and data transparency and reporting policies of the requested Party; or (b) initiate formal consultations and provide input, as appropriate.
6-1 CHAPTER 6 EXPANDING TRADE Article 6.1: Objectives 1. The Parties acknowledge that trade and economic structural changes resulting from this Agreement and from other actions being taken by China to open up its economy and improve its trade regime should lead to improved trade flows, including significant increases in exports of goods and services to China by the United States and other countries. 2. The Parties believe that expanding trade is conducive to the improvement of their bilateral trade relationship, the optimal allocation of resources, economic restructuring, and sustainable economic development, given the high degree of complementarity in trade between them. 3. The Parties recognize that the United States produces and can supply high-quality, competitively priced goods and services, while China needs to increase the importation of quality and affordable goods and services to satisfy the increasing demand from Chinese consumers. 4. The Parties accordingly seek to work constructively and cooperatively toward an improved bilateral trade relationship and to explore appropriate steps to facilitate increased trade. Article 6.2: Trade Opportunities 1. During the two-year period from January 1, 2020 through December 31, 2021, China shall ensure that purchases and imports into China from the United States of the manufactured goods, agricultural goods, energy products, and services identified in Annex 6.1 exceed the corresponding 2017 baseline amount by no less than $200 billion. Specifically, China shall ensure that: (a) For the category of manufactured goods identified in Annex 6.1, no less than $32.9 billion above the corresponding 2017 baseline amount is purchased and imported into China from the United States in calendar year 2020, and no less than $44.8 billion above the corresponding 2017 baseline amount is purchased and imported into China from the United States in calendar year 2021; (b) For the category of agricultural goods identified in Annex 6.1, no less than $12.5 billion above the corresponding 2017 baseline amount is purchased and imported into China from the United States in calendar year 2020, and no less than $19.5 billion above the corresponding 2017 baseline amount is purchased and imported into China from the United States in calendar year 2021;
6-2 (c) For the category of energy products identified in Annex 6.1, no less than $18.5 billion above the corresponding 2017 baseline amount is purchased and imported into China from the United States in calendar year 2020, and no less than $33.9 billion above the corresponding 2017 baseline amount is purchased and imported into China from the United States in calendar year 2021; and (d) For the category of services identified in Annex 6.1, no less than $12.8 billion above the corresponding 2017 baseline amount is purchased and imported into China from the United States in calendar year 2020, and no less than $25.1 billion above the corresponding 2017 baseline amount is purchased and imported into China from the United States in calendar year 2021. 2. The Parties shall specify the increases in purchases and imports for the subcategories listed in Annex 6.1 as appropriate. 3. The Parties project that the trajectory of increases in the amounts of manufactured goods, agricultural goods, energy products, and services purchased and imported into China from the United States will continue in calendar years 2022 through 2025. 4. The United States shall ensure to take appropriate steps to facilitate the availability of U.S. goods and services to be purchased and imported into China. 5. The Parties acknowledge that purchases will be made at market prices based on commercial considerations and that market conditions, particularly in the case of agricultural goods, may dictate the timing of purchases within any given year. 6. Official Chinese trade data and official U.S. trade data shall be used to determine whether this Chapter has been implemented. If an analysis of the respective trade data gives rise to conflicting assessments of whether this Chapter has been implemented, the Parties shall engage in consultations. 7. If China believes that its ability to fulfill its obligations under this Chapter is being affected by an action or inaction by the United States or by other circumstances arising in the United States, China is entitled to request consultations with the United States.
6-3 ANNEX 6.1 INCREASES IN U.S. EXPORTS TO CHINA OVER 2 YEARS Unit: USD Billion Product Category Additional U.S. Exports to China on Top of 2017 Baseline Year 1 Year 2 2-Year Total 1. Manufactured Goods 32.9 44.8 77.7 1 Industrial machinery 2 Electrical equipment and machinery 3 Pharmaceutical products 4 Aircraft (orders and deliveries) 5 Vehicles 6 Optical and medical instruments 7 Iron and steel 8 Other manufactured goodsa 2. Agricultureb 12.5 19.5 32.0 9 Oilseeds 10 Meat 11 Cereals 12 Cotton 13 Other agricultural commoditiesc 14 Seafoodd 3. Energy 18.5 33.9 52.4 15 Liquefied natural gas 16 Crude oil 17 Refined products 18 Coale 4. Servicesf 12.8 25.1 37.9 19 Charges for use of IP 20 Business travel and tourism 21 Financial services and insurance 22 Other services 23 Cloud and related services TOTAL 76.7 123.3 200.0 a Includes solar-grade polysilicon and other organic and inorganic chemicals, hardwood lumber, integrated circuits (manufactured in U.S.), and chemical products. b At the request of the United States, China will strive to purchase and import $5 billion per year of the U.S. agricultural products covered by this Chapter, in addition to the minimum amounts set forth herein. c Includes all other agricultural products, including alfalfa, citrus, dairy, dietary supplements, distilled spirits, dried distiller grains, essential oils, ethanol, fresh baby carrots, fruits and vegetables, ginseng, pet food, processed foods, tree nuts, and wine. d Includes lobster. e Includes metallurgical coal. f All services numbers represent the cross-border supply of services (Mode 1), with the exception of the numbers for financial services and insurance and cloud services, which include both the cross-border supply of services and the supply of services through commercial presence (Mode 3).
6-4 ATTACHMENT TO ANNEX 6.1 INCREASES IN U.S. EXPORTS TO CHINA OVER 2 YEARS (This attachment is only authentic in English; when the Parties conclude and verify an agreed Chinese translation of this attachment, both the English and Chinese versions shall be equally authentic) 1. Manufactured Goods 1 Industrial machinery HS Code Product Description 8401 Nuclear reactors; fuel elements (cartridges), non-irradiated, for nuclear reactors; machinery and apparatus for isotopic separation; parts thereof 8402 Steam or other vapor generating boilers (other than central heating hot water boilers capable also of producing low pressure steam); super-heated water boilers; 8403 Central heating boilers (other than those of heading 8402) and parts thereof 8404 Auxiliary plant for use with boilers of heading 8402 or 8403 (for example, economizers, super-heaters, soot removers, gas recoverers); condensers for steam or other vapor power units; parts thereof 8405 Producer gas or water gas generators, with or without their purifiers; acetylene gas generators and similar water process gas generators, with or without their purifiers; parts thereof 8406 Steam turbines and other vapor turbines, and parts thereof 8407 Spark-ignition reciprocating or rotary internal combustion piston engines 8408 Compression-ignition internal combustion piston engines (diesel or semi-diesel engines) 8409 Parts suitable for use solely or principally with the engines of heading 8407 or 8408 8410 Hydraulic turbines, water wheels and regulators therefor; parts thereof 8411 Turbojets, turbopropellers and other gas turbines, and parts thereof 8412 Other engines and motors, and parts thereof 8413 Pumps for liquids, whether or not fitted with a measuring device; liquid elevators; part thereof 8414 Air or vacuum pumps, air or other gas compressors and fans; ventilating or recycling hoods incorporating a fan, whether or not fitted with filters; parts thereof 8415 Air conditioning machines, comprising a motor-driven fan and elements for changing the temperature and humidity, including those machines in which the humidity cannot be separately regulated; parts thereof 8416 Furnace burners for liquid fuel, for pulverized solid fuel or for gas; mechanical stokers, including their mechanical grates, mechanical ash dischargers and similar appliances; parts thereof 8417 Industrial or laboratory furnaces and ovens, including incinerators, nonelectric, and parts thereof 8418 Refrigerators, freezers and other refrigerating or freezing equipment, electric or other; heat pumps, other than the air conditioning machines of heading 8415; parts thereof 8419 Machinery, plant or laboratory equipment, whether or not electrically heated (excluding furnaces, ovens and other equipment of heading 8514), for the treatment of materials by a process involving a change of temperature such as heating, cooking, roasting, distilling, rectifying, sterilizing, pasteurizing, steaming, drying, evaporating, vaporizing, condensing or cooling, other than machinery or plant of a kind used for domestic purposes; instantaneous or storage water heaters, nonelectric; parts thereof 8420 Calendering or other rolling machines, other than for metals or glass, and cylinders therefor; parts thereof 8421 Centrifuges, including centrifugal dryers; filtering or purifying machinery and apparatus, for liquids or gases; parts thereof 8422 Dishwashing machines; machinery for cleaning or drying bottles or other containers; machinery for filling, closing, sealing or labeling bottles, cans, boxes, bags or other containers; machinery for capsuling bottles, jars, tubes and similar containers; other packing or wrapping machinery (including heat-shrink wrapping machinery); machinery for aerating beverages; parts thereof 8423 Weighing machinery (excluding balances of a sensitivity of 5 cg or better), including weight-operated counting or checking machines; weighing machine weights of all kinds; parts of weighing machinery 8424 Mechanical appliances (whether or not hand operated) for projecting, dispersing or spraying liquids or powders; fire extinguishers, whether or not charged; spray guns and similar appliances; steam or sand blasting machines and similar jet projecting machines; parts thereof 8425 Pulley tackle and hoists other than skip hoists; winches and capstans; jacks 8426 Ships' derricks; cranes, including cable cranes; mobile lifting frames, straddle carriers and works trucks fitted with a crane
6-5 8427 Fork-lift trucks; other works trucks fitted with lifting or handling equipment 8428 Other lifting, handling, loading or unloading machinery (for example, elevators, escalators, conveyors, teleferics) 8429 Self-propelled bulldozers, angledozers, graders, levelers, scrapers, mechanical shovels, excavators, shovel loaders, tamping machines and road rollers 8430 Other moving, grading, leveling, scraping, excavating, tamping, compacting, extracting or boring machinery, for earth, minerals or ores; pile-drivers and pile-extractors; snowplows and snowblowers 8431 Parts suitable for use solely or principally with the machinery of headings 8425 to 8430 8432 Agricultural, horticultural or forestry machinery for soil preparation or cultivation; lawn or sports ground rollers; parts thereof 8433 Harvesting or threshing machinery, including straw or fodder balers; grass or hay mowers; machines for cleaning, sorting or grading eggs, fruit or other agricultural produce, other than machinery of heading 8437; parts thereof 8434 Milking machines and dairy machinery, and parts thereof 8435 Presses, crushers and similar machinery, used in the manufacture of wine, cider, fruit juices or similar beverages; parts thereof 8436 Other agricultural, horticultural, forestry, poultry-keeping or bee-keeping machinery, including germination plant fitted with mechanical or thermal equipment; poultry incubators and brooders; parts thereof 8437 Machines for cleaning, sorting or grading seed, grain or dried leguminous vegetables, and parts thereof; machinery used in the milling industry or for the working of cereals or dried leguminous vegetables, other than farm type machinery; parts thereof 8438 Machinery, not specified or included elsewhere in this chapter, for the industrial preparation or manufacture of food or drink, other than machinery for the extraction or preparation of animal or fixed vegetable fats or oils; parts thereof 8439 Cellulose pulp, paper and board manufacturing or finishing machines 8440 Bookbinding machinery, including book-sewing machines, and parts thereof 8441 Other machinery for making up paper pulp, paper or paperboard, including cutting machines of all kinds, and parts thereof 8442 Machinery, apparatus and equipment (other than the machines of headings 8456 to 8465), for preparing or making plates, cylinders or other printing components; plates, cylinders and other printing components; plates, cylinders and lithographic stones, prepared for printing purposes (for example, planed, grained or polished); parts thereof 8443 Printing machinery used for printing by means of plates, cylinders and other printing components of heading 8442; other printers, copying machines and facsimile machines, whether or not combined; parts and accessories thereof 8444 Machines for extruding, drawing, texturing or cutting man-made textile materials 8445 Machines for preparing textile fibers; spinning, doubling or twisting machines and other machinery for producing textile yarns; textile reeling or winding (including weft winding) machines and machines for preparing textile yarns for use on the machines of heading 8446 or 8447 8446 Weaving machines (looms) 8447 Knitting machines, stitch-bonding machines and machines for making gimped yarn, tulle, lace, embroidery, trimmings, braid or net and machines for tufting 8448 Auxiliary machinery for use with machines of heading 8444, 8445, 8446 or 8447 (for example, dobbies, Jacquards, automatic stop motions and shuttle changing mechanisms); parts and accessories suitable for use solely or principally with the machines of this heading or of heading 8444, 8445, 8446 or 8447 (for example, spindles and spindle flyers, card clothing, combs, extruding nipples, shuttles, healds and heald-frames, hosiery needles) 8449 Machinery for the manufacture or finishing of felt or nonwovens in the piece or in shapes, including machinery for making felt hats; blocks for making hats; parts thereof 8450 Household- or laundry-type washing machines, including machines which both wash and dry; parts thereof 8451 Machinery (other than machines of heading 8450) for washing, cleaning, wringing, drying, ironing, pressing (including fusing presses), bleaching, dyeing, dressing, finishing, coating or impregnating textile yarns, fabrics or made up textile articles and machines for applying the paste to the base fabric or other support used in the manufacture of floor coverings such as linoleum; machines for reeling, unreeling, folding, cutting or pinking textile fabrics; parts thereof 8452 Sewing machines, other than book-sewing machines of heading 8440; furniture, bases and covers specially designed for sewing machines; sewing machine needles; parts thereof 8453 Machinery for preparing, tanning or working hides, skins or leather or for making or repairing footwear or other articles of hides, skins or leather, other than sewing machines; parts thereof
6-6 8454 Converters, ladles, ingot molds and casting machines, of a kind used in metallurgy or in metal foundries, and parts thereof 8455 Metal-rolling mills and rolls therefor; parts thereof 8456 Machine tools for working any material by removal of material, by laser or other light or photon beam, ultrasonic, electro-discharge, electro-chemical, electron-beam, ionic-beam or plasma arc processes; water-jet cutting machines 8457 Machining centers, unit construction machines (single station) and multistation transfer machines, for working metal 8458 Lathes (including turning centers) for removing metal 8459 Machine tools (including way-type unit head machines) for drilling, boring, milling, threading or tapping by removing metal, other than lathes (including turning centers) of heading 8458 8460 Machine tools for deburring, sharpening, grinding, honing, lapping, polishing or otherwise finishing metal or cermets by means of grinding stones, abrasives or polishing products, other than gear cutting, gear grinding or gear finishing machines of heading 8461 8461 Machine tools for planing, shaping, slotting, broaching, gear cutting, gear grinding or gear finishing, sawing, cutting-off and other machine tools working by removing metal or cermets, not elsewhere specified or included 8462 Machine tools (including presses) for working metal by forging, hammering or die-stamping; machine tools (including presses) for working metal by bending, folding, straightening, flattening, shearing, punching or notching; presses for working metal or metal carbides, not specified above 8463 Other machine tools for working metal or cermets, without removing material 8464 Machine tools for working stone, ceramics, concrete, asbestos-cement or like mineral materials or for cold working glass 8465 Machine tools (including machines for nailing, stapling, glueing or otherwise assembling) for working wood, cork, bone, hard rubber, hard plastics or similar hard materials 8466 Parts and accessories suitable for use solely or principally with the machines of headings 8456 to 8465, including work or tool holders, self-opening dieheads, dividing heads and other special attachments for the machines; tool holders for any type of tool for working in the hand 8467 Tools for working in the hand, pneumatic, hydraulic or with self-contained electric or nonelectric motor, and parts thereof 8468 Machinery and apparatus for soldering, brazing or welding, whether or not capable of cutting, other than those of heading 8515; gas-operated surface tempering machines and appliances; parts thereof 8469 Typewriters other than printers of heading 8443; word processors 8470 Calculating machines and pocket-size data recording, reproducing and displaying machines with calculating functions; accounting machines, postage-franking machines, ticket-issuing machines and similar machines, incorporating a calculating device; cash registers 8471 Automatic data processing machines and units thereof; magnetic or optical readers, machines for transcribing data onto data media in coded form and machines for processing such data, not elsewhere specified or included 8472 Other office machines (for example, hectograph or stencil duplicating machines, addressing machines, automatic banknote dispensers, coin-sorting machines, coin-counting or wrapping machines, pencil-sharpening machines, perforating or stapling machines) 8473 Parts and accessories (other than covers, carrying cases and the like) suitable for use solely or principally with machines of headings 8470 to 8472 8474 Machinery for sorting, screening, separating, washing, crushing, grinding, mixing or kneading earth, stone, ores or other mineral substances, in solid (including powder or paste) form; machinery for agglomerating, shaping or molding solid mineral fuels, ceramic paste, unhardened cements, plastering materials or other mineral products in powder or paste form; machines for forming foundry molds of sand; parts thereof 8475 Machines for assembling electric or electronic lamps, tubes or flashbulbs, in glass envelopes; machines for manufacturing or hot working glass or glassware; parts thereof 8476 Automatic goods-vending machines (for example, postage stamp, cigarette, food or beverage machines), including money-changing machines; parts thereof 8477 Machinery for working rubber or plastics or for the manufacture of products from these materials, not specified or included elsewhere in this chapter; parts thereof 8478 Machinery for preparing or making up tobacco, not specified or included elsewhere in this chapter; parts thereof 8479 Machines and mechanical appliances having individual functions, not specified or included elsewhere in this chapter; parts thereof
6-7 8480 Molding boxes for metal foundry; mold bases; molding patterns; molds for metal (other than ingot molds), metal carbides, glass, mineral materials, rubber or plastics 8481 Taps, cocks, valves and similar appliances, for pipes, boiler shells, tanks, vats or the like, including pressure-reducing valves and thermostatically controlled valves; parts thereof 8482 Ball or roller bearings, and parts thereof 8483 Transmission shafts (including camshafts and crankshafts) and cranks; bearing housings, housed bearings and plain shaft bearings; gears and gearing; ball or roller screws; gear boxes and other speed changers, including torque converters; flywheels and pulleys, including pulley blocks; clutches and shaft couplings (including universal joints); parts thereof 8484 Gaskets and similar joints of metal sheeting combined with other material or of two or more layers of metal; sets or assortments of gaskets and similar joints, dissimilar in composition, put up in pouches, envelopes or similar packings; mechanical seals 8486 Machines and apparatus of a kind used solely or principally for the manufacture of semiconductor boules or wafers, semiconductor devices, electronic integrated circuits or flat panel displays; machines and apparatus specified in Note 9 (C) to this chapter; parts and accessories 8487 Machinery parts, not containing electrical connectors, insulators, coils, contacts or other electrical features, and not specified or included elsewhere in this chapter 2 Electrical equipment and machinery HS Code Product Description 8501 Electric motors and generators (excluding generating sets) 8502 Electric generating sets and rotary converters 8503 Parts suitable for use solely or principally with the machines of heading 8501 or 8502 8504 Electrical transformers, static converters (for example, rectifiers) and inductors; parts thereof 8505 Electromagnets; permanent magnets and articles intended to become permanent magnets after magnetization; electromagnetic or permanent magnet chucks, clamps and similar holding devices; electromagnetic couplings, clutches and brakes; electromagnetic lifting heads; parts thereof 8506 Primary cells and primary batteries; parts thereof 8507 Electric storage batteries, including separators therefor, whether or not rectangular (including square); parts thereof 8508 Vacuum cleaners; parts thereof 8509 Electromechanical domestic appliances, with self-contained electric motor, other than vacuum cleaners of heading 8508; parts thereof 8510 Shavers, hair clippers and hair-removing appliances, with self-contained electric motor; parts thereof 8511 Electrical ignition or starting equipment of a kind used for spark-ignition or compression-ignition internal combustion engines (for example, ignition magnetos, magneto-dynamos, ignition coils, spark plugs and glow plugs, starter motors); generators (for example, dynamos, alternators) and cut-outs of a kind used in conjunction with such engines; parts thereof 8512 Electrical lighting or signaling equipment (excluding articles of heading 8539), windshield wipers, defrosters and demisters, of a kind used for cycles or motor vehicles; parts thereof 8513 Portable electric lamps designed to function by their own source of energy (for example, dry batteries, storage batteries, magnetos), other than lighting equipment of heading 8512; parts thereof 8514 Industrial or laboratory electric furnaces and ovens (including those functioning by induction or dielectric loss); other industrial or laboratory equipment for the heat treatment of materials by induction or dielectric loss; parts thereof
6-8 8515 Electric (including electrically heated gas), laser or other light or photon beam, ultrasonic, electron beam, magnetic pulse or plasma arc soldering, brazing or welding machines and apparatus, whether or not capable of cutting; electric machines and apparatus for hot spraying of metals or cermets; parts thereof 8516 Electric instantaneous or storage water heaters and immersion heaters; electric space heating apparatus and soil heating apparatus; electrothermic hairdressing apparatus (for example, hair dryers, hair curlers, curling tong heaters) and hand dryers; electric flatirons; other electrothermic appliances of a kind used for domestic purposes; electric heating resistors, other than those of heading 8545; parts thereof 8517 Telephone sets, including telephones for cellular networks or for other wireless networks; other apparatus for the transmission or reception of voice, images or other data, including apparatus for communication in a wired or wireless network (such as a local or wide area network), other than transmission or reception apparatus of heading 8443, 8525,8527 or 8528; parts thereof 8518 Microphones and stands therefor; loudspeakers, whether or not mounted in their enclosures; headphones and earphones, whether or not combined with a microphone, and sets consisting of a microphone and one or more loudspeakers; audio-frequency electric amplifiers; electric sound amplifier sets; parts thereof 8519 Sound recording or reproducing apparatus 8521 Video recording or reproducing apparatus, whether or not incorporating a video tuner 8522 Parts and accessories suitable for use solely or principally with the apparatus of heading 8519 or 8521 8523 Discs, tapes, solid-state non-volatile storage devices, "smart cards" and other media for the recording of sound or of other phenomena, whether or not recorded, including matrices and masters for the production of discs, but excluding products of Chapter 37 8525 Transmission apparatus for radio-broadcasting or television, whether or not incorporating reception apparatus or sound recording or reproducing apparatus; television cameras, digital cameras and video camera recorders 8526 Radar apparatus, radio navigational aid apparatus and radio remote control apparatus 8527 Reception apparatus for radiobroadcasting, whether or not combined, in the same housing, with sound recording or reproducing apparatus or a clock 8528 Monitors and projectors, not incorporating television reception apparatus; reception apparatus for television, whether or not incorporating radio-broadcast receivers or sound or video recording or reproducing apparatus 8529 Parts suitable for use solely or principally with the apparatus of headings 8525 to 8528 8530 Electrical signaling, safety or traffic control equipment for railways, streetcar lines, subways, roads, inland waterways, parking facilities, port installations or airfields (other than those of heading 8608); parts thereof 8531 Electric sound or visual signaling apparatus (for example, bells, sirens, indicator panels, burglar or fire alarms), other than those of heading 8512 or 8530; parts thereof 8532 Electrical capacitors, fixed, variable or adjustable (pre-set); parts thereof 8533 Electrical resistors (including rheostats and potentiometers), other than heating resistors; parts thereof 8534 Printed circuits 8535 Electrical apparatus for switching or protecting electrical circuits, or for making connections to or in electrical circuits (for example, switches, fuses, lightning arresters, voltage limiters, surge suppressors, plugs and other connectors, junction boxes), for a voltage exceeding 1,000 V 8536 Electrical apparatus for switching or protecting electrical circuits, or for making connections to or in electrical circuits (for example, switches, relays, fuses, surge suppressors, plugs, sockets, lamp-holders and other connectors, junction boxes), for a voltage not exceeding 1,000 V; connectors for optical fibers, optical fiber bundles or cables 8537 Boards, panels, consoles, desks, cabinets and other bases, equipped with two or more apparatus of heading 8535 or 8536, for electric control or the distribution of electricity, including those incorporating instruments or apparatus of chapter 90, and numerical control apparatus, other than switching apparatus of heading 8517 8538 Parts suitable for use solely or principally with the apparatus of heading 8535, 8536 or 8537 8539 Electrical filament or discharge lamps, including sealed beam lamp units and ultraviolet or infrared lamps; arc lamps; light-emitting diode (LED) lamps; parts thereof 8540 Thermionic, cold cathode or photocathode tubes (for example, vacuum or vapor or gas filled tubes, mercury arc rectifying tubes, cathode-ray tubes, television camera tubes); parts thereof 8541 Diodes, transistors and similar semiconductor devices; photosensitive semiconductor devices, including photovoltaic cells whether or not assembled in modules or made up into panels; light-emitting diodes (LED); mounted piezoelectric crystals; parts thereof
6-9 8543 Electrical machines and apparatus, having individual functions, not specified or included elsewhere in this chapter; parts thereof 8544 Insulated (including enameled or anodized) wire, cable (including coaxial cable) and other insulated electric conductors, whether or not fitted with connectors; optical fiber cables, made up of individually sheathed fibers, whether or not assembled with electric conductors or fitted with connectors 8545 Carbon electrodes, carbon brushes, lamp carbons, battery carbons and other articles of graphite or other carbon, with or without metal, of a kind used for electrical purposes 8546 Electrical insulators of any material 8547 Insulating fittings for electrical machines, appliances or equipment, being fittings wholly of insulating material apart from any minor components of metal (for example, threaded sockets) incorporated during molding solely for the purposes of assembly, other than insulators of heading 8546; electrical conduit tubing and joints therefor, of base metal lined with insulating material 8548 Waste and scrap of primary cells, primary batteries and electric storage batteries; spent primary cells, spent primary batteries and spent electric storage batteries; electrical parts of machinery or apparatus, not specified or included elsewhere in this chapter 3 Pharmaceutical products HS Code Product Description 3001 Glands and other organs for organotherapeutic uses, dried, whether or not powdered; extracts of glands or other organs or of their secretions for organotherapeutic uses; heparin and its salts; other human or animal substances prepared for therapeutic or prophylactic uses, not elsewhere specified or included 3002 Human blood; animal blood prepared for therapeutic, prophylactic or diagnostic uses; antisera, other blood fractions and immunological products, whether or not modified or obtained by means of biotechnological processes; vaccines, toxins, cultures of micro-organisms (excluding yeasts) and similar products 3003 Medicaments (excluding goods of heading 3002, 3005 or 3006) consisting of two or more constituents which have been mixed together for therapeutic or prophylactic uses, not put up in measured doses or in forms or packings for retail sale 3004 Medicaments (excluding goods of heading 3002, 3005 or 3006) consisting of mixed or unmixed products for therapeutic or prophylactic uses, put up in measured doses (including those in the form of transdermal administration systems) or in forms or packings for retail sale 3005 Wadding, gauze, bandages and similar articles (for example, dressings, adhesive plasters, poultices), impregnated or coated with pharmaceutical substances or put up in forms or packings for retail sale for medical, surgical, dental or veterinary purposes 3006 Pharmaceutical goods specified in note 4 to this chapter 4 Aircraft (orders and deliveries) HS Code Product Description 8802 Other aircraft (for example, helicopters, airplanes); spacecraft (including satellites) and suborbital and spacecraft launch vehicles 5 Vehicles HS Code Product Description 8703 Motor cars and other motor vehicles principally designed for the transport of persons (other than those of heading 8702), including station wagons and racing cars 8704 Motor vehicles for the transport of goods 6 Optical and medical instruments HS Code Product Description 9002 Lenses, prisms, mirrors and other optical elements, of any material, mounted, being parts of or fittings for instruments or apparatus, other than such elements of glass not optically worked; parts and accessories thereof 9003 Frames and mountings for spectacles, goggles or the like, and parts thereof 9011 Compound optical microscopes, including those for photomicrography, cinemicrography or microprojection; parts and accessories thereof 9012 Microscopes other than optical microscopes; diffraction apparatus; parts and accessories thereof 9018 Instruments and appliances used in medical, surgical, dental or veterinary sciences, including scintigraphic apparatus, other electro-medical apparatus and sight-testing instruments; parts and accessories thereof 9019 Mechano-therapy appliances; massage apparatus; psychological aptitude-testing apparatus; ozone therapy, oxygen therapy, aerosol therapy, artificial respiration or other therapeutic respiration apparatus; parts and accessories thereof 9020 Other breathing appliances and gas masks, excluding protective masks having neither mechanical parts nor replaceable filters; parts and accessories thereof
6-10 9021 Orthopedic appliances, including crutches, surgical belts and trusses; splints and other fracture appliances; artificial parts of the body; hearing aids and other appliances which are worn or carried, or implanted in the body, to compensate for a defect or disability; parts and accessories thereof 9022 Apparatus based on the use of X-rays or of alpha, beta or gamma radiations, whether or not for medical, surgical, dental or veterinary uses, including radiography or radiotherapy apparatus, X-ray tubes and other X-ray generators, high tension generators, control panels and desks, screens, examination or treatment tables, chairs and the like; parts and accessories thereof 7 Iron and steel HS Code Product Description 7201 Pig iron and spiegeleisen in pigs, blocks or other primary forms 7202 Ferroalloys 7203 Ferrous products obtained by direct reduction of iron ore and other spongy ferrous products, in lumps, pellets or similar forms; iron having a minimum purity by weight of 99.94 percent, in lumps, pellets or similar forms 7204 Ferrous waste and scrap; remelting scrap ingots of iron orsteel 7205 Granules and powders, of pig iron, spiegeleisen, iron or steel 7206 Iron and nonalloy steel in ingots or other primary forms (excluding iron of heading 7203) 7207 Semifinished products of iron or nonalloy steel 7208 Flat-rolled products of iron or nonalloy steel, of a width of 600 mm or more, hot-rolled, not clad, plated or coated 7209 Flat-rolled products of iron or nonalloy steel, of a width of 600 mm or more, cold-rolled (cold-reduced), not clad, plated or coated 7210 Flat-rolled products of iron or nonalloy steel, of a width of 600 mm or more, clad, plated or coated 7211 Flat-rolled products of iron or nonalloy steel, of a width of less than 600 mm, not clad, plated or coated 7212 Flat-rolled products of iron or nonalloy steel, of a width of less than 600 mm, clad, plated or coated 7213 Bars and rods, hot-rolled, in irregularly wound coils, of iron or nonalloy steel 7214 Other bars and rods of iron or nonalloy steel, not further worked than forged, hot-rolled, hot-drawn or hot-extruded, but including those twisted after rolling 7215 Other bars and rods of iron or nonalloy steel 7216 Angles, shapes and sections of iron or nonalloy steel 7217 Wire of iron or nonalloy steel 7218 Stainless steel in ingots or other primary forms; semi-finished products of stainless steel 7219 Flat-rolled products of stainless steel, of a width of 600 mm or more 7220 Flat-rolled products of stainless steel, of a width of less than 600 mm 7221 Bars and rods, hot-rolled, in irregularly wound coils, of stainless steel 7222 Other bars and rods of stainless steel; angles, shapes and sections of stainless steel 7223 Wire of stainless steel 7224 Other alloy steel in ingots or other primary forms; semi-finished products of other alloy steel 7225 Flat-rolled products of other alloy steel, of a width of 600 mm or more 7226 Flat-rolled products of other alloy steel, of a width of less than 600 mm 7227 Bars and rods, hot-rolled, in irregularly wound coils, of other alloy steel 7228 Other bars and rods of other alloy steel; angles, shapes and sections, of other alloy steel; hollow drill bars and rods, of alloy or non-alloy steel 7229 Wire of other alloy steel 7301 Sheet piling of iron or steel, whether or not drilled, punched or made from assembled elements; welded angles, shapes and sections, of iron or steel 7302 Railway or tramway track construction material of iron or steel, the following rails, check-rails and rack rails, switch blades, crossing frogs, point rods and other crossing pieces, sleepers (cross-ties), fish-plates, chairs, chair wedges, sole plates (base plates), rail clips, bedplates, ties and other material specialized for jointing or fixing rails
6-11 7303 Tubes, pipes and hollow profiles, of cast iron 7304 Tubes, pipes and hollow profiles, seamless, of iron (other than cast iron) or steel 7305 Other tubes and pipes (for example, welded, riveted or similarly closed), having circular cross sections, the external diameter of which exceeds 406.4 mm, of iron or steel 7307 Tube or pipe fittings (for example, couplings, elbows, sleeves), of iron or steel 8 Other manufactured goods HS Code Product Description 2201 Waters, including natural or artificial mineral waters and aerated waters, not containing added sugar or other sweetening matter nor flavored; ice and snow 2202 Waters, including mineral waters and aerated waters, containing added sugar or other sweetening matter or flavored, and other nonalcoholic beverages, not including fruit or vegetable juices of heading 2009 2801 Fluorine, chlorine, bromine and iodine 2802 Sulfur, sublimed or precipitated; colloidal sulfur 2803 Carbon (carbon blacks and other forms of carbon not elsewhere specified or included) 2804 Hydrogen, rare gases and other nonmetals (including solar-grade polysilicon) 2805 Alkali or alkaline-earth metals; rare-earth metals, scandium and yttrium, whether or not intermixed or interalloyed; mercury 2806 Hydrogen chloride (Hydrochloric acid); chlorosulfuric acid 2807 Sulfuric acid; oleum 2808 Nitric acid; sulfonitric acids 2809 Diphosphorus pentaoxide; phosphoric acid;polyphosphoric acids, whether or not chemically defined 2810 Oxides of boron; boric acids 2811 Other inorganic acids and other inorganic oxygen compounds of nonmetals 2812 Halides and halide oxides of nonmetals 2813 Sulfides of nonmetals; commercial phosphorus trisulfide 2814 Ammonia, anhydrous or in aqueous solution 2815 Sodium hydroxide (Caustic soda); potassium hydroxide (Caustic potash); peroxides of sodium or potassium 2816 Hydroxide and peroxide of magnesium; oxides, hydroxides and peroxides, of strontium or barium 2817 Zinc oxide; zinc peroxide 2818 Artificial corundum, whether or not chemically defined; aluminum oxide; aluminum hydroxide 2819 Chromium oxides and hydroxides 2820 Manganese oxides 2821 Iron oxides and hydroxides; earth colors containing 70 percent or more by weight of combined iron evaluated as Fe2O3 2822 Cobalt oxides and hydroxides; commercial cobalt oxides 2823 Titanium oxides 2824 Lead oxides; red lead and orange lead 2825 Hydrazine and hydroxylamine and their inorganic salts; other inorganic bases; other metal oxides, hydroxides and peroxides 2826 Fluorides; fluorosilicates, fluoroaluminates and other complex fluorine salts 2827 Chlorides, chloride oxides and chloride hydroxides; bromides and bromide oxides; iodides and iodide oxides 2828 Hypochlorites; commercial calcium hypochlorite; chlorites; hypobromites 2829 Chlorates and perchlorates; bromates and perbromates; iodates and periodates
6-12 2830 Sulfides; polysulfides, whether or not chemically defined 2831 Dithionites and sulfoxylates 2832 Sulfites; thiosulfates 2833 Sulfates; alums; peroxosulfates (persulfates) 2834 Nitrites; nitrates 2835 Phosphinates (hypophosphites), phosphonates (phosphites) and phosphates; polyphosphates, whether or not chemically defined 2836 Carbonates; peroxocarbonates (percarbonates); commercial ammonium carbonate containing ammonium carbamate 2837 Cyanides, cyanide oxides and complex cyanides 2839 Silicates; commercial alkali metal silicates 2840 Borates; peroxoborates (perborates) 2841 Salts of oxometallic or peroxometallic acids 2842 Other salts of inorganic acids or peroxoacids (including aluminosilicates whether or not chemically defined), other than azides 2843 Colloidal precious metals; inorganic or organic compounds of precious metals, whether or not chemically defined; amalgams of precious metals 2844 Radioactive chemical elements and radioactive isotopes (including the fissile or fertile chemical elements and isotopes) and their compounds; mixtures and residues containing these products 2845 Isotopes other than those of heading 2844; compounds, inorganic or organic, of such isotopes, whether or not chemically defined 2846 Compounds, inorganic or organic, of rare-earth metals, of yttrium or of scandium, or of mixtures of these metals 2847 Hydrogen peroxide, whether or not solidified with urea 2848 Phosphides, whether or not chemically defined, does not include ferrophosphorus 2849 Carbides, whether or not chemically defined 2850 Hydrides, nitrides, azides, silicides and borides, whether or not chemically defined, other than compounds which are also carbides of heading 2849 2852 Inorganic or organic compounds of mercury, whether or not chemically defined, excluding amalgams 2853 Other inorganic compounds (including distilled or conductivity water and water of similar purity); liquid air (whether or not rare gases have been removed); compressed air; amalgams, other than amalgams of precious metals 2901 Acyclic hydrocarbons 2902 Cyclic hydrocarbons 2903 Halogenated derivatives of hydrocarbons 2904 Sulfonated, nitrated or nitrosated derivatives of hydrocarbons, whether or not halogenated 2905 Acyclic alcohols and their halogenated, sulfonated, nitrated or nitrosated derivatives (excluding methanol, mannitol, and sorbitol) 2906 Cyclic alcohols and their halogenated, sulfonated, nitrated or nitrosated derivatives 2907 Phenols; phenol-alcohols 2908 Halogenated, sulfonated, nitrated or nitrosated derivatives of phenols or phenol-alcohols 2909 Ethers, ether-alcohols, ether-phenols, ether-alcohol- phenols, alcohol peroxides, ether peroxides, ketone peroxides (whether or not chemically defined), and their halogenated, sulfonated, nitrated or nitrosated derivatives 2910 Epoxides, epoxyalcohols, epoxyphenols and epoxyethers, with a three-membered ring, and their halogenated, sulfonated, nitrated or nitrosated derivatives 2911 Acetals and hemiacetals, whether or not with other oxygen function, and their halogenated, sulfonated, nitrated or nitrosated derivatives 2912 Aldehydes, whether or not with other oxygen function; cyclic polymers of aldehydes; paraformaldehyde 2913 Halogenated, sulfonated, nitrated or nitrosated derivatives of products of heading 2912 2914 Ketones and quinones, whether or not with other oxygen function, and their halogenated, sulfonated, nitrated, or nitrosated derivatives 2915 Saturated acyclic monocarboxylic acids and their anhydrides, halides, peroxides and peroxyacids; their halogenated, sulfonated, nitrated or nitrosated derivatives
6-13 2916 Unsaturated acyclic monocarboxylic acids, cyclic monocarboxylic acids, their anhydrides, halides, peroxides and peroxyacids; their halogenated, sulfonated, nitrated or nitrosated derivatives 2917 Polycarboxylic acids, their anhydrides, halides, peroxides and peroxyacids; their halogenated, sulfonated, nitrated or nitrosated derivatives 2918 Carboxylic acids with additional oxygen function and their anhydrides, halides, peroxides and peroxyacids; their halogenated, sulfonated, nitrated or nitrosated derivatives 2919 Phosphoric esters and their salts, including lactophosphates; their halogenated, sulfonated, nitrated or nitrosated derivatives 2920 Esters of other inorganic acids of nonmetals (excluding esters of hydrogen halides) and their salts; their halogenated, sulfonated, nitrated or nitrosated derivatives 2921 Amine-function compounds 2922 Oxygen-function amino-compounds 2923 Quaternary ammonium salts and hydroxides; lecithins and other phosphoaminolipids, whether or not chemically defined 2924 Carboxyamide-function compounds; amide-function compounds of carbonic acid 2925 Carboxyimide-function compounds (including saccharin and its salts) and imine-function compounds 2926 Nitrile-function compounds 2927 Diazo-, azo- or azoxy-compounds 2928 Organic derivatives of hydrazine or of hydroxylamine 2929 Compounds with other nitrogen function 2930 Organo-sulfur compounds 2931 Other organo-inorganic compounds 2932 Heterocyclic compounds with oxygen hetero-atom(s) only 2933 Heterocyclic compounds with nitrogen hetero-atom(s) only 2934 Nucleic acids and their salts, whether or not chemically defined; other heterocyclic compounds 2935 Sulfonamides 2936 Provitamins and vitamins, natural or reproduced by synthesis (including natural concentrates), derivatives thereof used primarily as vitamins, and intermixtures of the foregoing, whether or not in any solvent 2937 Hormones, prostaglandins, thromboxanes and leukotrienes, natural or reproduced by synthesis; derivatives and structural analogues thereof, including chain modified polypeptides, used primarily as hormones 2938 Glycosides, natural or reproduced by synthesis, and their salts, ethers, esters and other derivatives 2939 Alkaloids, natural or reproduced by synthesis, and their salts, ethers, esters and other derivatives 2940 Sugars, chemically pure, other than sucrose, lactose, maltose, glucose and fructose; sugar ethers, sugar acetals and sugar esters, and their salts, other than products of heading 2937, 2938 or 2939 2941 Antibiotics 2942 Other organic compounds 2933 Heterocyclic compounds with nitrogen hetero-atom(s) only 2934 Nucleic acids and their salts, whether or not chemically defined; other heterocyclic compounds 2935 Sulfonamides 2936 Provitamins and vitamins, natural or reproduced by synthesis (including natural concentrates), derivatives thereof used primarily as vitamins, and intermixtures of the foregoing, whether or not in any solvent 2937 Hormones, prostaglandins, thromboxanes and leukotrienes, natural or reproduced by synthesis; derivatives and structural analogues thereof, including chain modified polypeptides, used primarily as hormones 2938 Glycosides, natural or reproduced by synthesis, and their salts, ethers, esters and other derivatives 2939 Alkaloids, natural or reproduced by synthesis, and their salts, ethers, esters and other derivatives 2940 Sugars, chemically pure, other than sucrose, lactose, maltose, glucose and fructose; sugar ethers, sugar acetals and sugar esters, and their salts, other than products of heading 2937, 2938 or 2939
6-14 2941 Antibiotics 2942 Other organic compounds 3303 Perfumes and toilet waters 3304 Beauty or make-up preparations and preparations for the care of the skin (other than medicaments), including sunscreen or sun tan preparations; manicure or pedicure preparations 3305 Preparations for use on the hair 3306 Preparations for oral or dental hygiene, including denture fixative pastes and powders; yarn used to clean between the teeth (dental floss), in individual retail packages 3307 Pre-shave, shaving or after-shave preparations, personal deodorants, bath preparations, depilatories and other perfumery, cosmetic or toilet preparations, not elsewhere specified or included; prepared room deodorizers, whether or not perfumed or having disinfectant properties 4401 Fuel wood, in logs, in billets, in twigs, in faggots or in similar forms; wood in chips or particles; sawdust and wood waste and scrap, whether or not agglomerated in logs, briquettes, pellets or similar forms 4402 Wood charcoal (including shell or nut charcoal), whether or not agglomerated 4403 Wood in the rough, whether or not stripped of bark or sap- wood, or roughly squared 4404 Hoopwood; split poles; piles, pickets and stakes of wood, pointed but not sawn lengthwise; wooden sticks, roughly trimmed but not turned, bent or otherwise worked, suitable for the manufacture of walking-sticks, umbrellas, tool handles or the like; chipwood and the like 4405 Wood wool (excelsior); wood flour 4406 Railway or tramway sleepers (cross-ties) of wood 4407 Wood sawn or chipped lengthwise, sliced or peeled, whether or not planed, sanded or end-jointed, of a thickness exceeding 6 mm 4408 Sheets for veneering (including those obtained by slicing laminated wood), for plywood or for similar laminated wood and other wood, sawn lengthwise, sliced or peeled, whether or not planed, sanded, spliced or end-jointed, of a thickness not exceeding 6 mm 4409 Wood (including strips and friezes for parquet flooring, not assembled) continuously shaped (tongued, grooved, rebated, chamfered, V-jointed, beaded, molded, rounded or the like) along any of its edges, ends or faces, whether or not planed, sanded or end-jointed 4410 Particle board, oriented strand board (OSB) and similar board (for example, waferboard) of wood or other ligneous materials, whether or not agglomerated with resins or other organic binding substances 4411 Fiberboard of wood or other ligneous materials, whether or not bonded with resins or other organic substances 4412 Plywood, veneered panels and similar laminated wood 4413 Densified wood, in blocks, plates, strips or profile shapes 4414 Wooden frames for paintings, photographs, mirrors or similar objects 4415 Packing cases, boxes, crates, drums and similar packings, of wood; cable-drums, of wood; pallets, box-pallets and other load boards, of wood; pallet collars of wood 4416 Casks, barrels, vats, tubs and other coopers' products and parts thereof, of wood, including staves 4417 Tools, tool bodies, tool handles, broom or brush bodies and handles, of wood; boot or shoe lasts and trees, of wood 4418 Builders' joinery and carpentry of wood, including cellular wood panels and assembled flooring panels; shingles and shakes 4419 Tableware and kitchenware, of wood 4420 Wood marquetry and inlaid wood; caskets and cases for jewelry or cutlery and similar articles, of wood; statuettes and other ornaments, of wood; wooden articles of furniture not falling within chapter 94 4421 Other articles of wood 4501 Natural cork, raw or simply prepared; waste cork; crushed, granulated or ground cork 4503 Articles of natural cork 4504 Agglomerated cork (with or without a binding substance) and articles of agglomerated cork
6-15 4601 Plaits and similar products of plaiting materials, whether or not assembled into strips; plaiting materials, plaits and similar products of plaiting materials, bound together in parallel strands or woven, in sheet form, whether or not being finished articles (for example, mats, matting, screens) 4602 Basketwork, wickerwork and other articles, made directly to shape from plaiting materials or made up from articles of heading 4601; articles of loofah 8542 Electronic integrated circuits; parts thereof 2. Agriculture 9 Oilseeds HS Code Product Description 1201 Soybeans, whether or not broken 10 Meat HS Code Product Description 0201 Meat of bovine animals, fresh or chilled 0202 Meat of bovine animals, frozen 0203 Meat of swine, fresh, chilled, or frozen 0204 Meat of sheep or goats, fresh, chilled or frozen 0206 Edible offal of bovine animals, swine, sheep, goats, horses, asses, mules or hinnies, fresh, chilled or frozen 0207 Meat and edible offal, of the poultry of heading 0105, fresh, chilled or frozen 0208 Other meat and edible meat offal, fresh, chilled or frozen 0209 Pig fat, free of lean meat, and poultry fat, not rendered or otherwise extracted, fresh, chilled, frozen, salted, in brine, dried or smoked 0210 Meat and edible meat offal, salted, in brine, dried or smoked; edible flours and meals of meat or meat offal 1601 Sausages and similar products, of meat, meat offal or blood; food preparations based on these products 1602 Other prepared or preserved meat, meat offal or blood 1603 Extracts and juices of meat (not related to fish or crustaceans, molluscs or other aquatic invertebrates) 11 Cereals HS Code Product Description 1001 Wheat and meslin 1003 Barley 1004 Oats 1005 Corn (maize) 1006 Rice 1007 Grain sorghum 1008 Buckwheat, millet and canary seeds; other cereals (including wild rice) 1101 Wheat or meslin flour 1102 Cereal flours other than of wheat or meslin 1103 Cereal groats, meal and pellets 1104 Cereal grains, otherwise worked (hulled, rolled etc.), except rice (heading 1006); germ of cereals, whole, rolled, flaked or ground
6-16 1105 Flour, meal flakes, granules and pellets of potatoes 1106 Flour and meal of dried leguminous vegetables (hd. 0713), of sago or roots etc. (hd. 0714); flour, meal and powder of fruit and nuts etc. (ch. 8) 1107 Malt, whether or not roasted 1108 Starches; inulin 1109 Wheat gluten, whether or not dried 12 Cotton HS Code Product Description 5201 Cotton, not carded or combed 5202 Cotton waste (including yarn waste and garnetted stock) 5203 Cotton, carded or combed 13 Other agricultural commodities HS Code Product Description 0101 Horses, asses, mules and hinnies, live 0102 Bovine animals, live 0103 Swine, live 0104 Sheep and goats, live 0105 Poultry, live; chickens, ducks, geese, turkeys and guineas 0106 Animals, live, nesoi 0205 Meat of horses, asses, mules or hinnies, fresh, chilled or frozen 0401 Milk and cream, not concentrated nor containing added sweetening 0402 Milk and cream, concentrated or containing added sweetening 0403 Buttermilk, curdled milk and cream, yogurt, kephir etc., whether or not flavored etc. or containing added fruit or cocoa 0404 Whey and other products consisting of natural milk constituents, whether or not concentrated or sweetened, nesoi 0405 Butter and other fats and oils derived from milk 0406 Cheese and curd 0407 Birds' eggs, in shell, fresh, preserved or cooked 0408 Birds' eggs, not in shell and egg yolks, fresh, dried, cooked by steam etc., molded, frozen or otherwise preserved, sweetened or not 0409 Honey, natural 0410 Edible products of animal origin, nesoi 0501 Human hair, unworked, whether or not washed or scoured; waste of human hair 0502 Pigs', hogs' or boars' bristles and hair; badger and other brushmaking hair; waste of such bristles or hair 0504 Animal guts, bladders and stomachs (other than fish), whole and pieces thereof, fresh, chilled, frozen, salted, in brine, dried or smoked
6-17 0505 Bird skins and other feathered parts of birds, feathers and parts of feathers and down, not further worked than cleaned etc. 0506 Bones and horn-cores, unworked, defatted, simply prepared (not cut to shape), treated with acid etc.; powder and waste of these products 0507 Ivory, tortoise-shell, whalebone and whalebone hair, horns, hooves, claws etc., unworked or simply prepared, not cut to shape 0510 Ambergris, castoreum, civet and musk; cantharides; bile; glands and other animal products for use in pharmaceutical products, fresh, frozen, etc. 0601 Bulbs, tubers, tuberous roots, corms etc., dormant, in growth or in flower; chicory plants and roots for planting 0602 Live plants nesoi (including their roots), cuttings and slips; mushroom spawn 0603 Cut flowers and buds suitable for bouquets or ornamental purposes, fresh, dried, dyed, bleached, impregnated or otherwise prepared 0604 Foliage, branches, grasses, mosses etc. (no flowers or buds), for bouquets or ornamental purposes, fresh, dried, dyed, bleached etc. 0701 Potatoes (other than sweet potatoes), fresh or chilled 0702 Tomatoes, fresh or chilled 0703 Onions, shallots, garlic, leeks and other alliaceous vegetables, fresh or chilled 0704 Cabbages, cauliflower, kohlrabi, kale and similar edible brassicas, fresh or chilled 0705 Lettuce (lactuca sativa) and chicory (cichorium spp.), fresh or chilled 0706 Carrots, turnips, salad beets, salsify, radishes and similar edible roots, fresh or chilled 0707 Cucumbers and gherkins, fresh or chilled 0708 Leguminous vegetables, shelled or unshelled, fresh or chilled 0709 Vegetables nesoi, fresh or chilled 0710 Vegetables (uncooked or cooked by steam or boiling water), frozen 0711 Vegetables provisionally preserved (by sulfur dioxide gas, in brine etc.), but unsuitable in that state for immediate consumption 0712 Vegetables, dried, whole, cut, sliced, broken or in powder, but not further prepared 0713 Leguminous vegetables, dried shelled 0714 Cassava (manioc), arrowroot, salep, jerusalem artichokes, sweet potatoes and similar roots etc. (high starch etc. content), fresh or dried; sago pith 0801 Coconuts, brazil nuts and cashew nuts, fresh or dried 0802 Nuts nesoi, fresh or dried 0803 Bananas, including plantains, fresh or dried 0804 Dates, figs, pineapples, avocados, guavas, mangoes and mangosteens, fresh or dried 0805 Citrus fruit, fresh or dried 0806 Grapes, fresh or dried 0807 Melons (including watermelons) and papayas (papaws), fresh 0808 Apples, pears and quinces, fresh 0809 Apricots, cherries, peaches (including nectarines), plums (including prune plums) and sloes, fresh
6-18 0810 Fruit nesoi, fresh 0811 Fruit and nuts (uncooked or cooked by steam or boiling water), whether not sweetened, frozen 0812 Fruit and nuts provisionally preserved (by sulfur dioxide gas, in brine etc.), but unsuitable in that state for immediate consumption 0813 Fruit, dried, nesoi (other than those of headings 0801 to 0806); mixtures of nuts or dried fruits of this chapter 0814 Peel of citrus fruit or melons (including watermelons), fresh, frozen, dried or provisionally preserved 0901 Coffee, whether or not roasted or decaffeinated; coffee husks and skins; coffee substitutes containing coffee 0902 Tea, whether or not flavored 0903 Mate 0904 Pepper of the genus piper; fruits of the genus capsicum (peppers) or of the genus pimenta, dried, crushed or ground 0905 Vanilla 0906 Cinnamon and cinnamon-tree flowers 0907 Cloves (whole fruit, cloves and stems) 0908 Nutmeg, mace and cardamons 0909 Seeds of anise, badian, fennel, coriander, cumin or caraway; juniper berries 0910 Ginger, saffron, tumeric (curcuma), thyme, bay leaves, curry and other spices 1002 Rye 1202 Peanuts (ground-nuts), not roasted or otherwise cooked, whether or not shelled or broken 1203 Copra 1204 Flaxseed (linseed), whether or not broken 1205 Rape or colza seeds, whether or not broken 1206 Sunflower seeds, whether or not broken 1207 Oil seeds and oleaginous fruits nesoi, whether or not broken 1208 Flours and meals of oil seeds or oleaginous fruits, other than those of mustard 1209 Seeds, fruit and spores, of a kind used for sowing 1210 Hop cones, fresh or dried, whether or not ground, powdered or in the form of pellets; lupulin 1211 Plants and parts of plants (including seeds and fruits), used in perfumery, pharmacy, or for insecticidal or similar purposes, fresh or dried 1212 Locust beans, seaweeds etc., sugar beet and sugar cane; fruit stones and kernels and other vegetable products used for human consumption, nesoi 1214 Cereal straw and husks, unprepared, whether or not chopped, ground, pressed or in the form of pellets 1214 Rutabagas (swedes), mangolds, hay, alfalfa (lucerne), clover, forage kale, lupines and similar forage products, whether or not in the form of pellets 1301 Lac; natural gums, resins, gum-resins and balsams 1302 Vegetable saps and extracts; pectic substances, pectinates and pectates; agar-agar and other mucilages and thickeners, derived from vegetable products
6-19 1401 Vegetable materials used primarily for plaiting, including bamboos, rattans, reeds, rushes, osier, raffia, processed cereal straw and lime bark 1404 Vegetable products, nesoi 1501 Pig fat (including lard) and poultry fat, other than of heading 0209 or 1503 1502 Fats of bovine animals, sheep or goats, other than those of heading 1503 1503 Lard stearin, lard oil, oleostearin, oleo-oil and tallow oil, not emulsified or mixed or otherwise prepared 1505 Wool grease and fatty substances derived therefrom, including lanolin 1506 Animal fats and oils and their fractions, nesoi, whether or not refined, but not chemically modified 1507 Soybean oil and its fractions, whether or not refined, but not chemically modified 1508 Peanut (ground-nut) oil and its fractions, whether or not refined, but not chemically modified 1509 Olive oil and its fractions, whether or not refined, but not chemically modified 1510 Olive-residue oil and blends of olive oil and oil-residue oil, not chemically modified 1511 Palm oil and its fractions, whether or not refined, but not chemically modified 1512 Sunflower-seed, safflower or cottonseed oil, and their fractions, whether or not refined, but not chemically modified 1513 Coconut (copra), palm kernel or babassu oil and their fractions, whether or not refined, but not chemically modified 1514 Rapeseed, colza or mustard oil and their fractions, whether or not refined, but not chemically modified 1515 Fixed vegetable fats and oils (including jojoba oil) and their fractions, whether or not refined, but not chemically modified 1516 Animal or vegetable fats and oils and their fractions, partly or wholly hydrogenated etc., whether or not refined, but not further prepared 1517 Margarine; edible mixtures or preparations of animal or vegetable fats or oils or of fractions of different specified fats and oils 1518 Animal or vegetable fats, oils and their fractions, boiled, oxidized, etc.; inedible mixes or preparations of animal or vegetable fats and oils, nesoi 1520 Glycerol (glycerine), whether or not pure; glycerol waters and glycerol lyes 1521 Vegetable waxes (other than triglycerides), beeswax, other insect waxes and spermaceti, whether or not refined or colored 1522 Degras; residues resulting from the treatment of fatty substances or animal or vegetable waxes 1701 Cane or beet sugar and chemically pure sucrose, in solid form 1702 Sugars nesoi, including chemically pure lactose, maltose, glucose and fructose in solid form; sugar syrups (plain); artificial honey; caramel 1703 Molasses resulting from the extraction or refining of sugar 1704 Sugar confectionary (including white chocolate), not containing cocoa 1801 Cocoa beans, whole or broken, raw or roasted 1802 Cocoa shells, husks, skins and other cocoa waste 1803 Cocoa paste, whether or not defatted 1804 Cocoa butter, fat and oil
6-20 1805 Cocoa powder, not containing added sugar or other sweetening matter 1806 Chocolate and other food preparations containing cocoa 1901 Malt extract; food preparations of flour, meal etc. containing under 40% cocoa nesoi; food preparations of milk etc. containing under 50% cocoa nesoi 1902 Pasta, whether or not cooked or stuffed or otherwise prepared, including spaghetti, lasagna, noodles etc.; couscous, whether or not prepared 1903 Tapioca and substitutes therefor prepared from starch, in the form of flakes, grains, pearls, siftings or similar forms 1904 Prepared foods from swelling or roasting cereals or products; cereals (excluding corn), in grain form flakes or worked grain prepared nesoi 1905 Bread, pastry, cakes, biscuits and other bakers' wares; communion wafers, empty capsules for medicine etc., sealing wafers, rice paper etc. 2001 Vegetables, fruit, nuts and other edible parts of plants, prepared or preserved by vinegar or acetic acid 2002 Tomatoes prepared or preserved otherwise than by vinegar or acetic acid 2003 Mushrooms and truffles, prepared or preserved otherwise than by vinegar or acetic acid 2004 Vegetables, other than tomatoes, mushrooms and truffles, prepared or preserved otherwise than by vinegar or acetic acid, frozen, excluding products of 2006 2005 Vegetables, other than tomatoes, mushrooms and truffles, prepared or preserved otherwise than by vinegar or acetic acid, not frozen excluding products of 2006 2006 Vegetables, fruit, nuts, fruit-peel and other parts of plants preserved by sugar (drained, glace or crystallized) 2007 Jams, fruit jellies, marmalades, fruit or nut puree and fruit or nut pastes, being cooked preparations, whether or not containing added sweetening 2008 Fruit, nuts and other edible parts of plants, otherwise prepared or preserved, whether or not containing added sweetening or spirit, nesoi 2009 Fruit juices not fortified with vitamins or minerals (including grape must) & vegetable juices, unfermented & not containing added spirit, whether or not containing added sweetening 2101 Extracts, essences and concentrates of coffee, tea or mate and preparations thereof; roasted chicory etc. and its extracts, essences and concentrates 2102 Yeasts; other single-cell micro-organisms, dead (other than medicinal vaccines of heading 3002); prepared baking powders 2103 Sauces and preparations therefor; mixed condiments and mixed seasonings; mustard flour and meal and prepared mustard 2104 Soups and broths and preparations therefor; homogenized composite food preparations 2105 Ice cream and other edible ice, whether or not containing cocoa 2106 Food preparations not elsewhere specified or included 2203 Beer made from malt 2204 Wine of fresh grapes, including fortified wines; grape must other than that of heading 2009 2205 Vermouth and other wine of fresh grapes flavored with plants or aromatic substances 2206 Other fermented beverages (for example, cider, perry, mead, sak¨); mixtures of fermented beverages and mixtures of fermented beverages and non-alcoholic beverages, not elsewhere specified or included 2207 Undenatured ethyl alcohol of an alcoholic strength by volume of 80 percent vol. or higher; ethyl alcohol and other spirits, denatured, of any strength 2208 Undenatured ethyl alcohol of an alcoholic strength by volume of less than 80 percent vol.; spirits, liqueurs and other spirituous beverages 2209 Vinegar and substitutes for vinegar obtained from acetic acid 2301 Flours, meals and pellets, of meat or meat offal, of fish or of crustaceans, mollusks or other aquatic invertebrates, unfit for human consumption; greaves (cracklings)
6-21 2302 Bran, sharps and other residues (in pellets or not), derived from the sifting, milling or other working of cereals or leguminous plants 2303 Residues of starch manufacture and other residues and waste of sugar manufacture, brewing or distilling dregs and waste, whether or not in pellets 2304 Soybean oilcake and other solid residues resulting from the extraction of soy bean oil, whether or not ground or in the form of pellets 2305 Peanut (ground-nut) oilcake and other solid residues resulting from the extraction of peanut (ground-nut) oil, whether or not ground or in pellets 2306 Oilcake and other solid residues (in pellets or not), resulting from the extraction of vegetable fats or oils (except from soybeans or peanuts), nesoi 2307 Wine lees; argol 2308 Vegetable materials and waste, vegetable residues and by-products (in pellets or not), used in animal feeding, nesoi 2309 Preparations of a kind used in animal feeding 2401 Tobacco, unmanufactured (whether or not threshed or similarly processed); tobacco refuse 2402 Cigars, cheroots, cigarillos and cigarettes, of tobacco or of tobacco substitutes 2403 Tobacco and tobacco substitute manufactures, nesoi; homogenized or reconstituted tobacco; tobacco extracts and essences 290543/ 290544 Acyclic alcohols and their halogenated, sulfonated, nitrated or nitrosated derivatives 3301 Essential oils, concentrates and absolutes; resinoid; extracted oleoresins; concentrations of essential oils and terpenic byproducts; aqueous solutions etc. of essential oil 3302 Mixtures of odoriferous substances and mixtures (including alcoholic solutions) with a basis of one or more of these substances, of a kind used as raw materials in industry; other preparations based on odoriferous substances, of a kind used for the manufacture of beverages 3501 Casein, caseinates and other casein derivatives; casein glues 3502 Albumins (including concentrates with two or more whey proteins, containing by weight more than 80% whey proteins calculated on dry matter), albuminates & other albumin derivatives 3503 Gelatin (including gelatin in rectangular or square sheets) and gelatin derivatives; isinglass; other glue of animal origin (except casein glue) nesoi 3504 Peptones and derivatives; other proteins and derivatives, nesoi; hide powder, chromed or not 3505 Dextrins and other modified starches; glues based on starches, or on dextrins or other modified starches 380910 Finishing agents, dye carriers and other preparations (dressings, mordants etc.) used in the textile, paper, leather or like industries, nesoi 4101 Raw hides and skins of bovine or equine animals (fresh or preserved, but not tanned or further prepared), whether or not dehaired or split 4102 Raw skins of sheep or lambs, other than astrakhan, broadtail, caracul or similar skins (fresh or preserved, but not tanned or further prepared) 4103 Raw hides and skins nesoi (fresh or preserved, but not tanned or further prepared), whether or not dehaired or split 4301 Raw furskins nesoi (other than raw hides and skins usually used for leather), including heads, tails and pieces or cuttings suitable for furriers' use 5001 Silkworm cocoons suitable for reeling 5002 Raw silk (not thrown) 5003 Silk waste (including cocoons unsuitable for reeling, yarn waste and garnetted stock) 5101 Wool, not carded or combed 5102 Fine or coarse animal hair, not carded or combed 5103 Waste of wool or of fine or coarse animal hair, including yarn waste but excluding garnetted stock 5301 Flax, raw or processed but not spun; flax tow and waste (including yarn waste and garnetted stock)
6-22 5302 True hemp (cannabis sativa l.), raw or processed but not spun; tow and waste of true hemp (including yarn waste and garnetted stock) 14 Seafood HS Code Product Description 0301 Live fish 0302 Fish, fresh or chilled, excluding fish fillets and other fish meat of heading 0304 0303 Fish, frozen, excluding fish fillets and other fish meat of heading 0304 0304 Fish fillets and other fish meat (whether or not minced), fresh, chilled or frozen 0305 Fish, dried, salted or in brine; smoked fish, whether or not cooked before or during the smoking process; flours, meals and pellets of fish, fit for human consumption 0306 Crustaceans, whether in shell or not, live, fresh, chilled, frozen, dried, salted or in brine; smoked crustaceans, whether in shell or not, whether or not cooked before or during the smoking process; crustaceans, in shell, cooked by steaming or by boiling in water, whether or not chilled, frozen, dried, salted or in brine; flours, meals and pellets of crustaceans, fit for human consumption 0307 Molluscs, whether in shell or not, live, fresh, chilled, frozen, dried, salted or in brine; smoked molluscs, whether in shell or not, whether or not cooked before or during the smoking process; flours, meals and pellets of molluscs, fit for human consumption 0308 Aquatic invertebrates other than crustaceans and molluscs, live, fresh, chilled, frozen, dried, salted or in brine;smoked aquatic invertebrates other than crustaceans and molluscs, whether or not cooked before or during the smoking process; flours, meals and pellets of aquatic invertebrates other than crustaceans and molluscs, fit for human consumption 1604 Prepared or preserved fish; caviar and caviar substitutes prepared from fish eggs 1605 Crustaceans, molluscs and other aquatic invertebrates, prepared or preserved 3. Energy 15 Liquefied natural gas HS Code Product Description 271111 Liquefied natural gas 16 Crude oil HS Code Product Description 2709 Petroleum oils and oils obtained from bituminous minerals, crude 17 Refined products HS Code Product Description 271112 Liquefied propane 271113 Liquefied butane 27111990 Other unlisted liquefied petroleum gases and gaseous hydrocarbons 271311 Uncalcined petroleum coke 271312 Calcined petroleum coke 271012250 Naphtha (Excluding Motor Fuel), blend Stock not containing biodiesel 290511 Methanol 18 Coal HS Code Product Description 2701 Coal; briquettes, ovoids and similar solid fuels manufactured from coal
6-23 4. Services 19 Charges for use of IP BMP6 Category a BEA Line Number b BEA Category Charges for use of IP 29 Industrial processes 30 Computer software 31 Trademarks 32 Franchise fees 33 Audio-visual and related products 37 Other 20 Business travel and tourism BMP6 Category BEA Line Number BEA Category Travel (for all purposes including education) 13 Education-related travel 14 Other business travel and other personal travel 21 Financial services and insurance BMP6 Category BEA Line Number BEA Category Financial services 21 Financial services Insurance services 16 Direct insurance and auxiliary insurance services 17 Reinsurance 22 Other services BMP6 Category BEA Line Number BEA Category Maintenance and repair 2 Maintenance and repair Transport 3 Transport Other business services 47 Research and development 48 Professional and management consulting 53 Technical, trade-related, and other business services 23 Cloud and related services BMP6 Category BEA Line Number BEA Category Information services 66 Data hosting, processing, and related services Telecommunication, computer, and information services 43 Telecommunications services 44 Computer services 45 Information services a ''BMP6 Category'' refers to the services listed in the IMF's Balance of Payments Manual 6, Table 10.1 (''Overview of the Goods and Services Account''). b ''BEA Line Number'' refers to the line number in U.S. Bureau of Economic Analysis Table 2.3 (''U.S. Trade in Services, by Country of Affiliation and by Type of Service''), with one exception: line number 66, which corresponds to the BEA Category for ''Data hosting, processing, and related services,'' is found in U.S. Bureau of Economic Analysis Table 4.1 (''U.S. Services Supplied to Foreign Persons by U.S. Multinational Enterprises through their Majority-Owned Foreign Affiliates, by Industry of Affiliate and by Country of Affiliate'').
7-1 CHAPTER 7 BILATERAL EVALUATION AND DISPUTE RESOLUTION Article 7.1: Bilateral Evaluation and Dispute Resolution Arrangement 1. To ensure prompt and effective implementation of this Agreement, the Parties establish the following Bilateral Evaluation and Dispute Resolution Arrangement (the ''Arrangement''). 2. The purpose and mandate of the Arrangement are to effectively implement this Agreement, to resolve issues in the economic and trade relationship of the Parties in a fair, expeditious, and respectful manner, and to avoid the escalation of economic and trade disputes and their impact on other areas of the Parties' relationship. The Parties recognize the importance of strengthened bilateral communications in this effort. Article 7.2: Arrangement Structure 1. High-level Engagement. The Parties shall create the Trade Framework Group to discuss the implementation of this Agreement, which shall be led by the United States Trade Representative and a designated Vice Premier of the People's Republic of China. The Trade Framework Group shall discuss (a) the overall situation regarding implementation of this Agreement, (b) major problems with respect to implementation, and (c) arrangements for future work between the Parties. The Parties shall resume macroeconomic meetings to discuss overall economic issues, which shall be led by the United States Secretary of the Treasury and the designated Vice Premier of the People's Republic of China. Both Parties shall make every effort to ensure that meetings of the Trade Framework Group and the macroeconomic meetings are efficient and oriented toward solving problems. 2. Daily Work. The Arrangement shall include a Bilateral Evaluation and Dispute Resolution Office for each Party. (a) For the United States, the Bilateral Evaluation and Dispute Resolution Office shall be headed by a designated Deputy United States Trade Representative. For China, the Bilateral Evaluation and Dispute Resolution Office shall be headed by a designated Vice Minister under the designated Vice Premier. (b) Each Party shall designate an official (the ''designated official'') to assist in the work of the Arrangement. By the date of entry into force of this Agreement, each Party shall provide the contact information of its respective designated official. Each Party shall update such information as necessary. (c) The Bilateral Evaluation and Dispute Resolution Offices shall (a) assess specific issues relating to implementation of this Agreement, (b) receive complaints
7-2 regarding implementation submitted by either Party, and (c) attempt to resolve disputes through consultations. In carrying out its work, each Bilateral Evaluation and Dispute Resolution Office may consult with government agencies with relevant expertise. Article 7.3: Requests for Information A Party may request at any meeting, or prior to a meeting, information from the other Party regarding a matter relating to the implementation of this Agreement. The other Party shall provide a written response containing the requested information. In the event that a Party is not able to provide the requested information, the response shall contain a specific explanation of why the information cannot be provided within the time limit and the specific date when the information will be provided. Nothing in this provision shall obligate a Party to provide confidential information to the other Party. Article 7.4: Dispute Resolution 1. Appeal. Where one Party (the ''Complaining Party'') believes that the other Party (the ''Party Complained Against'') is not acting in accordance with this Agreement, the Complaining Party may submit an appeal (''Appeal'') to the Bilateral Evaluation and Dispute Resolution Office of the Party Complained Against. An Appeal shall be in writing and shall contain sufficient information to allow the Party Complained Against to make a proper assessment of the matter. The Appeal may, but need not, include information that could identify any company at issue or business confidential information. The Appeal and any information and matters related to it are confidential and shall not be shared beyond the Bilateral Evaluation and Dispute Resolution Office, absent the agreement of the Parties. 2. Scope of Appeal. (a) The dispute resolution process covers all matters that occur after the date of entry into force of this Agreement. (b) Any measure, including an action, of a Party taken prior to the date of entry into force of this Agreement, which is maintained or continues to have effect after that date, is also subject to the dispute resolution process. For an Appeal of such a measure, the Complaining Party shall provide to the Party Complained Against an explanation of the continuing effect of the measure. 3. Assessment. The Party Complained Against shall carry out and complete an assessment of the Appeal. The Party Complained Against shall consider the facts, nature, and seriousness of the issues presented by the Appeal. After the assessment is completed, the designated officials shall begin consultations. 4. Dispute Procedures. Both Parties will attempt to resolve the Appeal in the most efficient manner using the following procedures:
7-3 (a) If the Appeal cannot be resolved by the designated officials, the concerns may be raised to the designated Deputy United States Trade Representative and the designated Vice Minister. If the Appeal is not resolved at the deputy or vice-ministerial level, the Complaining Party may present the issue to the United States Trade Representative and the designated Vice Premier of the People's Republic of China. (b) If the concerns of the Complaining Party are not resolved at a meeting between the United States Trade Representative and the designated Vice Premier of the People's Republic of China, the Parties shall engage in expedited consultations on the response to the damages or losses incurred by the Complaining Party. If the Parties reach consensus on a response, the response shall be implemented. If the Parties do not reach consensus on a response, the Complaining Party may resort to taking action based on facts provided during the consultations, including by suspending an obligation under this Agreement or by adopting a remedial measure in a proportionate way that it considers appropriate with the purpose of preventing the escalation of the situation and maintaining the normal bilateral trade relationship. The Party Complained Against can initiate an urgent meeting between the United States Trade Representative and the designated Vice Premier of the People's Republic of China before the effective date of the action to be taken by the Complaining Party. If the Party Complained Against considers that the action by the Complaining Party pursuant to this subparagraph was taken in good faith, the Party Complained Against may not adopt a counter-response, or otherwise challenge such action. If the Party Complained Against considers that the action of the Complaining Party was taken in bad faith, the remedy is to withdraw from this Agreement by providing written notice of withdrawal to the Complaining Party. 5. Notwithstanding the provisions of subparagraph 4(a), if either the United States Trade Representative or the designated Vice Premier of the People's Republic of China considers that an implementation issue is a matter of urgency, either one may raise the matter directly at a meeting between them without prior discussions at lower level meetings. If such a meeting cannot be timely scheduled for this purpose, the Complaining Party may resort to taking action as provided in subparagraph 4(b). Article 7.5: Implementation Period The Arrangement shall be in effect at the same time as this Agreement and shall remain in place as long as this Agreement is in effect. The Parties may assess the Arrangement and discuss any necessary adjustments to it at Trade Framework Group meetings. Article 7.6: Miscellaneous 1. The Parties affirm their existing rights and obligations with respect to each other under the WTO Agreement and other agreements to which the Parties are party.
7-4 2. In the event that a natural disaster or other unforeseeable event outside the control of the Parties delays a Party from timely complying with its obligations under this Agreement, the Parties shall consult with each other.
7-5 Annex 7-A WORKING PROCEDURES OF THE BILATERAL EVALUATION AND DISPUTE RESOLUTION ARRANGEMENT Schedule of Meetings 1. Meetings of the Trade Framework Group shall be held every six months. 2. The macroeconomic meetings shall be held regularly. 3. The heads of each Party's Bilateral Evaluation and Dispute Resolution Office shall meet on a quarterly basis. 4. The designated officials of each Party shall meet at least once a month. 5. During the first two years after this Agreement enters into force, the frequency of meetings may be increased as appropriate. Meetings may be held in person or through any means available to the Parties. Responses to Requests for Information Pursuant to Article 7.3, a Party shall respond within 15 working days to any requests for information from the other Party. Dispute Resolution Timeline 1. Pursuant to Article 7.4.3, the Party Complained Against shall have 10 working days from the date of the receipt of the Appeal to carry out and complete an assessment of the Appeal. 2. Pursuant to Article 7.4.4(a): a. The designated officials shall have 21 calendar days from the date of the receipt of the Appeal to reach a resolution. b. If the Appeal is not resolved by the designated officials, the designated Deputy United States Trade Representative and the designated Vice Minister shall have 45 calendar days from the date of the receipt of the Appeal to reach a resolution. c. If the Appeal is not resolved at the deputy or vice-ministerial level and the Complaining Party presents the issue to the United States Trade Representative and the designated Vice Premier of the People's Republic of China, these officials shall hold a meeting within 30 calendar days from the date the Complaining Party requests such a meeting.
7-6 3. Pursuant to Article 7.4.5, if either the United States Trade Representative or the designated Vice Premier of the People's Republic of China requests to meet on a matter of urgency, a meeting shall be scheduled within 30 calendar days from the date of receipt of that request. 4. The Parties may agree, in writing, to extend the time periods set forth in this Annex. 5. The calculation of working days in this Annex is based on the official calendar of the government of the Party Complained Against.
8-1 CHAPTER 8 FINAL PROVISIONS Article 8.1: Annexes, Appendices, and Footnotes The annexes, appendices, and footnotes to this Agreement constitute an integral part of this Agreement. Article 8.2: Amendments 1. The Parties may agree, in writing, to amend this Agreement. 2. An amendment shall enter into force 60 days after the date on which the Parties exchange written notifications of the approval of the amendment in accordance with their respective applicable domestic procedures, or such other date as the Parties may decide. Article 8.3: Entry into Force and Termination 1. This Agreement shall enter into force within 30 days of signature by both Parties or as of the date on which the Parties have notified each other in writing of the completion of their respective applicable domestic procedures, whichever is sooner. 2. Either Party may terminate this Agreement by providing written notice of termination to the other Party. The termination shall take effect 60 days after the date on which a Party has provided that written notice to the other Party, or on such other date as the Parties may decide. Article 8.4: Further Negotiations The Parties will agree upon the timing of further negotiations. Article 8.5: Notice and Comment on Implementing Measures Except as otherwise provided in this Agreement, each Party shall provide no less than 45 days for public comment on all proposed measures implementing this Agreement. Each Party shall consider concerns raised by the other Party in any final measure or amendment intended to implement this Agreement. Article 8.6: Authentic Texts The English and Chinese versions of this Agreement are equally authentic.
8-2 IN WITNESS WHEREOF, the undersigned, being duly authorized by their respective Governments, have signed this Agreement. DONE, at Washington, District of Columbia, in duplicate, this 15th day of January, 2020. FOR THE GOVERNMENT OF THE FOR THE GOVERNMENT OF THE PEOPLE'S REPUBLIC OF CHINA: UNITED STATES OF AMERICA:
Faulty Iowa App Was Part of Push to Restore Democrats' Digital Edge - The New York Times
Tue, 04 Feb 2020 17:41
The faulty smartphone app behind the chaotic aftermath of Iowa's Democratic caucuses was the work of a little-known company called Shadow Inc. that was founded by veterans of Hillary Clinton's unsuccessful presidential campaign, and whose previous work was marked by a string of failures, including a near bankruptcy.
The app grew out of a broader push by Democrats, backed by tens of millions of dollars in donor money, to match the Republicans' prowess in digital advertising and organizing after the 2016 election. Much of the energy and investment have gone into enterprises that are intended to both boost the Democrats' digital game and turn a profit, like Shadow.
Yet instead of showcasing how far the Democrats had come since the 2016 defeat, the disarray surrounding the Iowa caucuses raised new questions about how the party hopes to compete in 2020 with the Trump campaign, a digital juggernaut that is churning out ads and raising record sums of money.
''It's the exact opposite of the Trump team approach '-- bring the engineers in house, figure out exactly what we need, we build it, we test it, we own it,'' said David Goldstein, chief executive of Tovo Labs, a progressive digital consulting firm.
Given less than two months to build an app for reporting caucus results to the Iowa Democratic Party, Shadow produced technology that proved difficult to download and use and ended up delivering incorrect tallies. Iowa's Democrats blamed a ''coding issue'' in the app, and the party said it would resort to a time-consuming manual tally based on information called in by precinct chairs or pictures sent on their smartphones '-- the same ones on which they could not make the app work.
With the wait on results dragging into Tuesday evening, many in the party began dissecting what turned the Democrats' first contest of the 2020 election into a chaotic display, starting with Shadow, and its main backer, Acronym, a progressive nonprofit that is focused on helping Democrats regain their digital edge.
Shadow, in a tweet, said, ''We sincerely regret the delay in the reporting of the results of last night's Iowa caucuses and the uncertainty it has caused.'' But the company offered no explanation for what went wrong, though Democratic officials said that data had been incorrectly transmitted from the app to a central database, and that many users had been unable to follow the complicated process for installing the app on their phones.
The fallout spread quickly on Tuesday. Nevada, which like Iowa holds caucuses instead of a primary election, said it was abandoning plans to use Shadow's app. The Biden campaign, which had hired Shadow to help it reach voters, announced that it had cut ties with the company last year.
Founded in 2017, Acronym quickly became a darling of the Democratic donor class with its talk of restoring the digital advantage that the party had enjoyed under President Barack Obama, and that it was seen to have lost in Mrs. Clinton's 2016 campaign. David Plouffe, the well-connected former Obama campaign manager, joined Acronym's board. Its founder, Tara McGowan, a former journalist, was the subject of glowing profiles, one of which called her ''the Democrats' Most Dangerous Digital Strategist.''
For a time, Acronym appeared poised to deliver on its promise. Late last year, it unveiled a plan to spend $75 million on digital advertising to counter President Trump's early spending advantage in key battleground states.
Months earlier, it also quietly invested millions of dollars in a nearly bankrupt company called Groundbase, a tech firm that renamed itself Shadow soon after.
The firm had been founded by a pair of Clinton campaign veterans, Gerard Niemira and Krista Davis, with an initial investment from another progressive nonprofit, Higher Ground Labs. But its main technology, a texting platform designed for campaigns, failed to catch on as users complained that it was slow and cumbersome.
The failure left the firm perilously underfunded, and it was close to shutting down when Acronym stepped in with an infusion of cash, and a plan to refocus Groundbase specifically on developing mobile technology for campaigns.
The new money brought new projects. There was an email app and a program called Lightrail, which was being built to help the Democratic Party centralize its data.
There were also new clients. According to the most recent campaign filing reports, Shadow earned roughly $150,000 last year working for the Nevada and Wisconsin state Democratic parties and three presidential campaigns '-- those of former Vice President Joseph R. Biden Jr., Pete Buttigieg, former mayor of South Bend, Ind., and Senator Kirsten Gillibrand of New York, who dropped out of the race in August.
Shadow's work for the Biden campaign involved the texting technology and digital advertising consulting aimed at small dollar donors, said campaign staffers. But the texting program was particularly problematic, they said, pointing to potential security concerns.
An aide to Mr. Biden, who spoke on the condition of anonymity to avoid alienating other Democrats, said the campaign had used Shadow to text voters ahead of its campaign kickoff in Philadelphia last year. But the technology ''did not pass our cybersecurity checklist.''
Still, when Iowa Democrats, on the advice of the national party, abandoned plans to have caucus results called in by phone because of security concerns and instead build an app, Shadow won the contract. State records show the Iowa Democrats paid the firm $63,183 in two installments. It was unclear on Tuesday whether there had been a competitive bidding process for the work.
Regardless of how it got the job, Shadow was put into a race that engineers at the most well-resourced tech giants, like Google, said could not be won. There was simply not enough time to build the app, test it widely to work out major bugs and then train its users.
Shadow was also handicapped by its own lack of coding know-how, according to people familiar with the company. Few of its employees had worked on major tech projects, and many of its engineers were relatively inexperienced.
Two people who work for Acronym, speaking on the condition of anonymity because they did not want to risk their jobs, acknowledged that the app had problems. It was so rushed, they said, that there was no time to get it approved by the Apple store. Had it been, it might have proved far easier for users to install.
Instead, the app had to be downloaded by bypassing a phone's security settings, a complicated process for anyone unfamiliar with the intricacies of mobile operating systems, and especially hard for many of the older, less tech-savvy caucus chairs in Iowa.
The app also had to be installed using two-factor authentication and PIN passcodes. The information was included on worksheets given to volunteers at the Iowa precincts tallying the votes, but it added another layer of complication that appeared to hinder people.
In the end, only one-quarter of the 1,700 precinct chairs successfully downloaded and installed the app, according to a Democratic consultant who spoke on the condition of anonymity to avoid losing work. Many who resorted to calling in the results found that there were too few operators to handle the calls.
Some also took pictures of the worksheets they had been given '-- the PINs fully visible '-- and tweeted them out in frustration. Had the app worked, the information might have given trolls or hackers a chance to download the program and tamper with it.
In the lead-up to the caucuses, officials at the state party and the D.N.C. made an effort to keep Shadow's involvement a secret, asking with no apparent irony that even the name of the company be withheld from the public, arguing that hackers could not attack what they did not know existed. But the relative obscurity meant that the app would not be subject to independent testing for bugs.
By Tuesday morning, it appeared that some of the people involved with developing and launching the app were trying to hide their connection to Shadow. At least one employee had removed the company from her LinkedIn profile, and two others had hidden their photos and personal details online.
Acronym, for its part, removed a mention of its role in developing the app from its website. In its place, the Acronym website now states that the organization ''invested'' in Shadow.
Twitter Safety on Twitter: "Our new rule: You may not deceptively share synthetic or manipulated media that are likely to cause harm. In addition, we may label Tweets containing synthetic and manipulated media to help people understand their authenticity
Tue, 04 Feb 2020 17:34
Twitter Safety @ TwitterSafety
3h A critical part of this change was developing this with input from the public, civil society groups, and academic experts. We received 6,500+ responses on our approach, and will continue to make changes like this openly and in consultation with people around the world.
View conversation ·
Cody Johnston on Twitter: "For the curious, Pete's campaign paid Shadow twice for "software rights and subscriptions", Biden's paid them once for "text messaging", and Gillibrand's made six payments for "software". https://t.co/VWYQGO3dw3" / Twitter
Tue, 04 Feb 2020 11:06
Log in Sign up Cody Johnston @ drmistercody For the curious, Pete's campaign paid Shadow twice for "software rights and subscriptions", Biden's paid them once for "text messaging", and Gillibrand's made six payments for "software".
pic.twitter.com/VWYQGO3dw3 11:36 PM - 3 Feb 2020 Twitter by: Cody Johnston @drmistercody Cody Johnston @ drmistercody
9h Replying to
@drmistercody "Text 30330 to Shadow."
View conversation · Daniel '›¸ Foster @ notgrey77
9h Replying to
@drmistercody Shadow is straight riddled with Hillary staffers.
twitter.com/YourUntamedDog'... View conversation · Yonatan @ yonatanb
9h Replying to
@notgrey77 @drmistercody So ... Democrats who worked the 2016 election?
View conversation · Isaac sez:"45 got impeached forever" @ WyrdestGeek
9h Replying to
@drmistercody In 2020, why are we *still* trusting companies to write software for *voting*? Generally, this is not something we should do until we learn how to do it well.Rule 1: it shouldn't be secretive. If your app is so flawed that you have to rely on obscurity, you're doing it wrong.
View conversation · Matthew Embrey 🧠@ embrey_matthew
9h Replying to
@WyrdestGeek @drmistercody Frankly, having actual companies do it would be a lot safer, as opposed to our current archaic act of doling out contracts to a bunch if nobodies because of favors.As much as we loathe Amazon and Bezos, they are still more trusted than the gov't itself and the parties.
View conversation · 04 01 02 06 @ ccstlh
9h Replying to
@drmistercody Hey americans (or is it just Iowa Dems?), I have this app I just made that counts and keeps tabs of things.. its called, a spreadsheet.
View conversation · DG @ dgraupman
6h Replying to
@ccstlh @drmistercody Seriously Google Docs would have worked.
View conversation · Annoyed Norwegian ðŸ'🍷 @ norwegian76
9h Replying to
@drmistercody Shadow provides software to mass-communicate over text messages. There's nothing untoward about the relationship with multiple campaigns.
View conversation · Annoyed Norwegian ðŸ'🍷 @ norwegian76
9h Replying to
@drmistercody Here's a link to the actual product page :
shadowinc.io/messaging View conversation · Michael T. White @ Sillymike7
9h Replying to
@drmistercody 👠👠ðŸ‘
twitter.com/morphonios/sta'... View conversation · TypeSpeed (スãƒ--ードさã‚') @ 0TypeSpeed0
9h Replying to
@Sillymike7 @drmistercody i know that pete may smelling bad right now but ffs, why every left-learning person need say "ITS THE CIA" like if we were on the cold war?
View conversation · Enter a topic, @name, or fullname
Settings Help Back to top ·
Turn images off
Visa planning biggest changes to swipe fees in a decade
Tue, 04 Feb 2020 09:43
Visa is planning the biggest changes in a decade to the rates U.S. merchants pay to accept its cards, hoping to persuade more people to abandon checks and adjusting its fees for new businesses such as ride-hailing services.
The company's interchange rates '-- fees charged every time a consumer uses a card '-- will go up or down depending on the merchant and the way a consumer pays for their purchases, according to a document Visa sent to banks that outlines the changes. Higher rates are looming for transactions on e-commerce sites, while retailers in certain services categories, such as real estate and education, will see fees decline.
Bloomberg News''The U.S. credit interchange structure has been largely unchanged for the past 10 years,'' Visa said in the document, which was seen by Bloomberg. ''Based on the most recent review in the U.S., Visa is adjusting its default U.S. interchange rate structure to optimize acceptance and usage and reflect the current value of Visa products.''
While the changes amount to just a few cents on every transaction, those pennies add up. Swipe fees are already a flashpoint between merchants, banks and payment networks such as Visa and Mastercard. Retailers have long complained about the more than $100 billion they spend each year to accept electronic payments, a figure that's grown in recent years as fees increase and consumers flock to premium cards, which carry higher interchange rates.
Payment processors are updating their systems and readying merchants for the new rates, which will be rolled out in April and October, according to the document. San Francisco-based Visa planned the two-part implementation as a way to give processors more time to implement the changes, according to a person familiar with the network's thinking who asked not to be named because the matter is private.
Visa and Mastercard are the intermediaries that facilitate more than $6.5 trillion in card payments in the U.S. each year. While they set the rates that merchants are charged, those fees are technically paid to the bank that issues the card. The bank then passes along a portion of the fee to the network involved in the transaction.
Visa declined to comment on the changes proposed in the document. Mastercard, which has its own interchange policies, had no immediate comment on whether it's proposing changes of its own.
With Visa's changes, the interchange rate for so-called card-not-present transactions, which include those made online or over the phone, will increase. For a traditional Visa card, the fee on a $100 transaction will climb to $1.99 from $1.90. For premium Visa cards, the fee will rise to $2.60 from $2.50.
On a premium-card transaction of $50 for the category that includes large supermarkets, the interchange fee will drop 33%, to 77 cents from $1.15.
The changes proposed in the document apply to Visa's so-called published rates. Banks and payments networks can negotiate one-on-one deals with retailers for lower pricing.
For banks, the $91.2 billion in fees they earn on credit-card portfolios is now more than the interest they charge on the loans. Swipe fees contribute the largest portion '--$52 billion '-- of the fee income that banks collect, according to data compiled by consultancy R.K. Hammer.
Visa's new rates for certain service businesses reflect a strategy of trying to boost acceptance of its cards. The network has lowered the rates it charges for the health-care, education and real estate industries as part of the push.
As part of its focus on expanding acceptance of its cards in the U.S., Visa included categories such as rent, parking and vending machines. In 2019, the company's cards were accepted at 61 million locations around the world, a 14% increase from the previous year.
Bloomberg News
Canada-China Relations: Halt Trade Until Beijing Follows International Norms, Says Liberal MP
Tue, 04 Feb 2020 09:43
Canada should halt all trade with China until Beijing abides by international norms and the rule of law, says Liberal MP John McKay, the chair of the House of Commons public safety and national security committee.
The Toronto-area MP's comments come after the recent establishment of a special all-party committee to re-evaluate all aspects of Canada-China relations.
The committee was formed on Dec. 10, 2019, exactly one year after China detained Canadians Michael Kovrig and Michael Spavor in apparent retaliation for Canada's arrest of Huawei CFO Meng Wanzhou in early December 2018 at the behest of the United States.
''When your starting point is kidnapping of Canadian citizens for absolutely no reason at all, you have to realize that there's no basis for any arrangements: trade deals, contractual arrangements, diplomatic arrangements,'' McKay said in an interview.
''Understandings are only going to last for as long as the Chinese government decides it lasts, and that's the end of it.''
Doing business with the Chinese regime exposes Canada to vulnerabilities, as Beijing could cut off trade at any time and without warning, McKay says. He cites Canada's canola farmers who were hit by a sudden Chinese embargo on imports in March 2019 to the tune of $2 billion.
Trade should be paused until China is ''prepared to adhere to international norms of the rule of law and respect for human rights and citizens' rights,'' he says.
As for trade agreements with China, U.S. President Donald Trump and Chinese leader Xi Jinping recently signed a bilateral trade deal in which China will, over the next two years, purchase at least US$200 billion of American products and services more than it did in 2017. The agreement also includes a dispute resolution mechanism to ensure full enforceability.
McKay says such a scenario isn't likely to occur between Canada and China, however.
''We are a middle power at best, and our leverage is not the same as the U.S. leverage,'' he says. ''Trump could have a deal one day, and he slaps sanctions or trade tariffs on the next, and he can do it because they are the United States and the biggest consumer in the world. And the Chinese need to have access to the American market, so they need to come to the table.''
As for Canada, McKay says that ''they don't need us, to be realistic about it. '... Our leverage is quite modest, and so I don't know that we should be pursuing any deal with China with any enthusiasm.''
China experts have termed Beijing's aggressive foreign policy measures as ''asymmetrical warfare.'' McKay describes the regime's use of this tactic as ''unique.''
''It's all things at all times in all places,'' he says, citing two examples: a Canadian government scientist and her research team from China who were escorted from a lab in Winnipeg by RCMP in July 2019 and are under investigation; and the possibility of Chinese telecom giant Huawei's participation in Canada's 5G network.
''I'm sure [Huawei has] got very fine technology,'' he adds, ''but if in fact their ultimate masters are in Beijing, and if Beijing wants to know something about somebody or something, Huawei will be obliged to provide it.''
'Not an Exoneration'--A Cover-Up': Nationwide Protests Planned to Denounce GOP Acquittal of Trump
Tue, 04 Feb 2020 09:34
At more than 160 events across the country on Wednesday evening, organizers say protestors will hold Donald Trump and Republican Senators accountable for betraying the American people and the Constitution. (Image: Indivisible Guide)
By Jon Queally | Common Dreams
Demonstrations will be held in cities across the United States on Wednesday to denounce the expected acquittal of President Donald Trump by his fellow Republicans in the Senate'--which progressives argue should formally tie the president's legacy of corruption and disregard for the Constitution to the modern GOP as a whole.
''Trump's enablers in Congress led by Mitch McConnell are about to acquit our lawless president,'' organizers declared Monday on a website detailing more than 160 rallies already scheduled in cities nationwide.
''This was never a trial,'' the groups behind the actions said. ''It's a cover-up.''
According to the call to action, ''We must mobilize like never before'--and ensure that this dark moment in our nation's history is followed by an unprecedented level of civic action. Each of us has a critical part to play in making sure we leave a better democracy for the next generation.''
Find an event near you here, or organize one in your community here.
WHAT: Reject the Cover Up Rallies
WHERE: Nationwide
WHEN: Wed., Feb. 5 at 5:30pm local time
We're taking to the streets to hold our senators accountable for covering up for this lawless president.https://t.co/rZqN2rrVsG
'-- Indivisible Guide (@IndivisibleTeam) February 3, 2020
The actions are being organized by a diverse coalition of progressive groups'--including By the People, Common Cause, Greenpeace, Indivisible, NextGen America, Public Citizen, Sierra Club, Stand Up America, Stand Up Republic, Women's March, and others'--and are intended to make sure that Republicans understand their votes to acquit will not be forgotten come national elections later this year.
''On Wednesday night, the people will be heard in protests across the nation,'' said Karen Hobert Flynn, president of Common Cause. ''Seventy-five percent of Americans wanted to hear from witnesses in the impeachment trial, but Mitch McConnell refused to call even a single witness. We the people do not accept this disgraceful attempt to cover up Donald Trump's abuse of the powers of the presidency and we will make our voices heard in protests Wednesday and on Election Day.''
''Senate Republicans have thrown all democratic norms and decades of precedent out of the window by preventing witnesses from testifying before the Senate. Any 'acquittal' made after blocking key evidence is not an exoneration, it's a cover-up,'' said Sean Eldridge, Stand Up America founder and president. ''We're mobilizing thousands of protestors across the country to make it clear that voters are watching, and we'll remember the lawmakers who chose cowardice over patriotism.''
Our work is licensed under a Creative Commons Attribution-Share Alike 3.0 License. Feel free to republish and share it widely.
Read more great articles at Common Dreams.
Tags: "featured, #rejectthecoverup, Election 2020, featured, GOP acquittal of Donald Trump, Impeach Trump, President Donald Trump, President Donald Trump Impeachment, Republican Party, US Senate
Coronavirus. Why are no children affected? |
Tue, 04 Feb 2020 09:32
Chances are you've heard the news about a new and potentially lethal coronavirus.1 Ground zero is Wuhan City, Hubei Province in China. As of February 2, 2020, mainland China reported2 a total of 17,187 confirmed cases, including 2,110 severe cases and 362 deaths (including a retired doctor working with coronavirus patients in Wuhan3 ).
The first case was reported in Wuhan on December 21, 2019. According to ProMED International Society for Infectious Diseases:4
''Patients' clinical manifestations were consistent with viral pneumonia. Most patients had severe and nonproductive cough following illness onset, some had dyspnea, and almost all had normal or decreased leukocyte counts and radiographic evidence of pneumonia.
Huanan Seafood Wholesale Market has western and eastern sections, and 15 environmental specimens collected in the western section were positive for 2019-nCoV virus through RT-PCR testing and genetic sequencing analysis. Despite extensive searching, no animal from the market has thus far been identified as a possible source of infection.''
On January 21, 2020, the U.S. Centers for Disease Control and Prevention confirmed the first U.S. case5 '-- a patient in Washington state who had recently visited Wuhan, China. A second case, in Illinois, was confirmed January 24, 2020.6 This patient had also recently returned from a visit to Wuhan. As of February 2, 2020, there were 11 confirmed cases in the U.S.7
Since then cases have also been reported in at least 23 other countries,8 including Canada, Australia,9 Japan, Thailand, South Korea,10 France,11 Taiwan, Vietnam, Singapore, Saudi Arabia12 and Africa. Globally, there were 14, 557 confirmed cases and one death as of February 2, 2020.13
January 22, 2020, China shut down all transport networks in and out of Wuhan '-- a city with a population of 11 million '-- in an effort to contain the spread of the disease.14
Elderly Appear Particularly VulnerableSo far, most of those who have died have been elderly. As reported by the Foreign Policy Journal:15
''One puzzling aspect so far is the thankful lack of child victims. Usually, children, with less developed immune systems than adults, come down with one illness after another '...
Yet few children have yet been reported with coronavirus symptoms. That does not mean that no children have been infected. A similar pattern of benign disease in children, with increasing severity and mortality with age, was seen in SARS and MERS.
SARS had a mortality rate averaging 10 percent. Yet no children, and just 1 percent of youths under 24, died, while those older than 50 had a 65 percent risk of dying. Is being an adult a risk factor per se? If so, what is it about childhood that confers protection?''
The Foreign Policy Journal goes on to suggest children may be protected by other vaccines given during childhood, such as the measles and rubella vaccines. It even goes so far as to wonder whether innate immunity against the coronavirus might be boosted in adults by giving them the measles vaccine.
If you ask me, that would be a significant long-shot. Vaccines have risks, so getting a vaccine on the remote chance that it might confer protection against a completely different infection than what it's designed for seems inappropriate in the extreme. As noted in the Washington Examiner:16
''Sending out coronavirus vaccines won't make sense unless the spread gets worse '... The bare facts, at least as far as anyone knows them yet, are that a global rollout of a coronavirus vaccine would kill some 7,000 people or so.
Of course, we're never going to get everyone vaccinated. And I'm guessing here, but that average death rate from vaccination, for all things, is one in a million.
Yes, that's including those influenza shots the old folks are abjured to get every winter '-- we know that some will die because of them. That we know this is exactly why we have the vaccine compensation program '...
The '... trade-off in this situation is how many we kill by giving them the vaccine, versus how many die without it? The coronavirus is simply not widespread enough yet to take the risk of jabbing everyone.''
Advertisement
Source of Novel Coronavirus Remains UnknownLike other coronaviruses, such as the Middle East respiratory syndrome coronavirus (MERS-CoV) and the severe acute respiratory syndrome coronavirus (SARS-CoV), this new coronavirus (dubbed 2019-nCoV17 ), is suspected of being zoonotic, meaning it can be transmitted between animals and humans.
The disease itself has been named ''novel coronavirus-infected pneumonia'' or NECIP.18 As reported by CNN:19
''Both SARS and MERS are classified as zoonotic viral diseases, meaning the first patients who were infected acquired these viruses directly from animals.
This was possible because while in the animal host, the virus had acquired a series of genetic mutations that allowed it to infect and multiply inside humans. Now these viruses can be transmitted from person to person '...
In the case of this 2019 coronavirus outbreak, reports state that most of the first group of patients hospitalized were workers or customers at a local seafood wholesale market which also sold processed meats and live consumable animals including poultry, donkeys, sheep, pigs, camels, foxes, badgers, bamboo rats, hedgehogs and reptiles.''
However, while media have been quick to blame the outbreak on snakes20 and bat soup,21 as of January 22, none of the animals sold at the Wuhan Huanan Wholesale Seafood Market had been found to carry the virus.22
Meanwhile, a number of other reports cast a disturbing light on the outbreak, raising questions about biohazard safety at laboratories working with dangerous pathogens.
Season of Fear and National Budgeting Go Hand in HandWhatever the source, the hysteria being drummed up follows a now well-worn pattern where the population is kept in a perpetual state of anxiety and fear about microbes so that drug companies (aided by federal health officials) can come to the rescue with yet another expensive (and potentially mandatory) drug or vaccine.
Back in 2005, headlines warned the U.S. was facing a cataclysmic extermination event with a calculated 2 million Americans succumbing to the bird flu; the best-case scenario had a calculated death toll of 200,000. The same scare tactics were used during the 2009 swine flu outbreak.
Both pandemics turned out to be grossly exaggerated threats, but that didn't result in a more conservative, cool-headed approach to subsequent outbreaks. If anything, efforts to drum up fear and hysteria have only escalated.
In 2014, we were told Ebola might overtake the U.S. and then it was pertussis outbreaks.23 In January 2015, it was measles in Disneyland. In January 2016, it was zika, followed by more news about pertussis outbreaks.24 In 2017 and 2018 it was influenza,25 then back to measles again in 2019.26 Now we have coronavirus.
January and February appear to be a favorite time to launch a global disease scare with the dutiful assistance of corporatized media. It's convenient, seeing how usually by the first Monday in February every year (Feb. 3, 2020), the president sends the U.S. Congress the administration's budget requesting funds to be allocated to federal agencies for the next fiscal year's budget (Oct. 1, 2020 '' Sept. 30, 2021).27
Each time there's a public health scare, the Pharma and public health lobby is able to vie for a larger slice of taxpayer money to pay for drug and vaccine development.28
January 23, 2020, Dr. Anthony Fauci, director of the NIH's National Institute of Allergy and Infectious Diseases, announced a coronavirus vaccine is in the pipeline, with human trials set to start in about three months.29 Stock prices for makers of coronavirus vaccines experienced an immediate upswing30 ,31 in response to media reports of impending doom.
Moratorium on SARS/MERS Experiments Lifted in 2017As mentioned, a number of reports raise questions about the source of the 2019-nCoV. For starters, a 2014 NPR article32 was rather prophetic. It discusses the October 2014 U.S. moratorium on experiments on coronaviruses like SARS and MERS, as well as influenza virus, that might make the viruses more pathogenic and/or easy to spread among humans.
The ban came on the heels of ''high-profile lab mishaps'' at the CDC and ''extremely controversial flu experiments'' in which the bird flu virus was engineered to become more lethal and contagious between ferrets. The goal was to see if it could mutate and become more lethal and contagious between humans, causing future pandemics.
However, for the past decade there have been red flags raised in the scientific community about biosecurity breaches in high containment biological labs in the U.S. and globally.33 There were legitimate fears that a lab-created superflu pathogen might escape the confines of biosecurity labs where researchers are conducting experiments. It's a reasonable fear, certainly, considering that there have been many safety breaches at biolabs in the U.S. and other countries.34 ,35 ,36 ,37
The federal moratorium on lethal virus experiments in the U.S. was lifted at the end of December 2017,38 even though researchers announced in 2015 they had created a lab-created hybrid coronavirus similar to that of SARS that was capable of infecting both human airway cells and mice.
The NIH had allowed the controversial research to proceed because it had begun before the moratorium was put in place '-- a decision criticized by Simon Wain-Hobson, a virologist at Pasteur Institute in Paris, who pointed out that ''If the [new] virus escaped, nobody could predict the trajectory.''39
Others, such as Richard Ebright, a molecular biologist and biodefence expert at Rutgers University, agreed, saying ''The only impact of this work is the creation, in a lab, of a new, non-natural risk.''40
Wuhan Is Home to Lab Studying World's Deadliest PathogensIn January 2018, China's first maximum security virology laboratory (biosecurity level 4) designed for the study of the world's most dangerous pathogens opened its doors '-- in Wuhan.41 ,42 Is it pure coincidence that Wuhan City is now the epicenter of this novel coronavirus infection?
The year before, Tim Trevan, a Maryland biosafety consultant, expressed concern about viral threats potentially escaping the Wuhan National Biosafety Laboratory,43 which happens to be located just 20 miles from the Wuhan market identified as ground zero for the current NCIP outbreak.44 As reported by the Daily Mail:45
''The Wuhan lab is also equipped for animal research,'' and ''Regulations for animal research '-- especially that conducted on primates '-- are much looser in China than in the U.S. and other Western countries '... But that was also cause for concern for Trevan.
Studying the behavior of a virus like 209-nCoV and developing treatments or vaccines for it requires infecting these research monkeys, an important step before human testing.
Monkeys are unpredictable though, warned [Rutgers University microbiologist Dr. Richard] Ebright. 'They can run, they can scratch they can bite,' he said, and the viruses they carry would go where their feet, nails and teeth do.'''
Coronavirus Outbreak Simulation Took Place in October 2019Equally curious is the fact that Johns Hopkins Center for Health Security, the World Economic Forum and the Bill and Melinda Gates Foundation sponsored a novel coronavirus pandemic preparedness exercise October 18, 2019, in New York called ''Event 201.''46 The simulation predicted a global death toll of 65 million people within a span of 18 months.47 As reported by Forbes December 12, 2019:48
''The experts ran through a carefully designed, detailed simulation of a new (fictional) viral illness called CAPS or coronavirus acute pulmonary syndrome. This was modeled after previous epidemics like SARS and MERS.''
Sounds exactly like NCIP, doesn't it? Yet the new coronavirus responsible for NCIP had not yet been identified at the time of the simulation, and the first case wasn't reported until two months later.
Forbes also refers to the fictional pandemic as ''Disease X'' '-- the same designation used by The Telegraph in its January 24, 2020, video report, ''Could This Coronavirus be Disease X?''49 which suggests that media outlets were briefed and there was coordination ahead of time with regard to use of certain keywords and catchphrases in news reports and opinion articles.
Johns Hopkins University (JHU) is the biggest recipient of research grants from federal agencies, including the National Institutes of Health, National Science Foundation and Department of Defense and has received millions of dollars in research grants from the Gates Foundation.50 In 2016, Johns Hopkins spent more than $2 billion on research projects, leading all U.S. universities in research spending for the 38th year in a row.51
If research funded by federal agencies, such as the DOD or HHS is classified as being performed ''in the interest of national security,'' it is exempt from Freedom of Information Act (FOIA) requests.52
Research conducted under the Biomedical Advanced Research and Development Authority (BARDA) is completely shielded from FOIA requests by the public.53 Additionally, agencies may deny FOIA requests and withhold information if government officials conclude that shielding it from public view ''protects trade secrets and commercial or financial information which could harm the competitive posture or business interests of a company.''54
The U.S. Centers for Disease Control and Prevention under the U.S. Department of Health and Human Services states that its mission is ''to protect America from health, safety and security threats, both foreign and in the U.S.''55 Clearly, it will be difficult to obtain information about government-funded biomedical research on microbes like coronavirus conducted at major universities or by pharmaceutical corporations in biohazard labs.
How likely is it, then, that the coronavirus outbreak making people so sick today ''suddenly'' emerged simply because people ate bats and snakes in a Wuhan market? It looks more like a biosecurity accident but, until more is known, inevitably there will be more questions than answers about whether this latest global public health emergency is a more ambitious tactical ''sand table exercise,'' echoing unanswered questions about the 2009 swine flu pandemic fiasco.
This time, there could be a lot more bodies left on the field, although some statisticians conducting benefit cost analyses may consider 65 million casualties in a global human population of 7.8 billion people56 to be relatively small when advancing medical research conducted in the name of ''the greater good.''
Signs and Symptoms of NCIPAccording to the WHO, signs and symptoms of NCIP in its initial stages include:57
Fever Fatigue Sore throat Shortness of breath Dry cough In more severe cases, the infection can lead to pneumonia, severe acute respiratory syndrome and kidney failure.
Care AdviceWHO's ''rapid advice note,'' detailing how to care for patients presenting mild symptoms of NCIP in the home can be downloaded here. Recommendations include:
Placing the patient in a well-ventilated room Limiting the number of caretakers. Ideally, designate a healthy younger person who has no underlying risk factors to care for the patient (older people appear to be more susceptible to severe disease) Keeping other household members in a different room, or keeping a distance of at least 1 meter (3.2 feet) from the patient Limiting the movement of the patient and minimizing shared space. Make sure shared spaces such as kitchen and bathroom are well-ventilated by keeping the windows open Instructions on protective gear, such as protective masks and gloves, and the safe handling and disposal of them are also detailed, as are special instructions for how to maintain good hygiene to prevent the spread of the virus throughout the home.
General recommendations for how to reduce your risk of contracting an infection at home, work or when traveling can be found on WHO's Novel Coronavirus Advice for the Public page.58
A key recommendation '-- which applies to all infections, both bacterial and viral '-- is to frequently wash your hands with soap and water. Also, be sure to cover your mouth and nose when coughing or sneezing, and avoid close contact with anyone exhibiting symptoms of cold or influenza.
According to Peter Horby, professor of emerging infectious diseases and global health at the Centre of Tropical Medicine and Global Health at the University of Oxford, NCIP has the hallmark signs of ''classic viral pneumonia,'' and since there are currently no antivirals available for NCIP, the focus of care is to support the lungs and other organs until the patient recovers.59
During this time, I recommend boosting your immune system with regular sensibly controlled sun exposure and, when unable to do that, taking oral vitamin D3. Adding liposomal vitamin C and quercetin supplements can also be helpful.
All three help protect against infections in general, and quercetin may offer benefits as a treatment for SARS coronavirus infections.60 According to a study61 in the Journal of Virology, ''quercetin offers great promise as a potential drug in the clinical treatment of SARS.'' Resveratrol is another antioxidant that could be useful. It's been shown to inhibit MERS-CoV infection, at least in vitro.62
There are some events that happen, which are not in our control, but one thing we can do is learn how to better respond to bad news that causes stress, which can depress the immune system.
Living in a constant state of anxiety and fear is not healthy. Finding ways to lower stress through regular exercise, spending time in nature, practicing meditation and getting plenty of sleep on a daily basis all help optimize immune function and decrease the effects of stress that are all too often a part of our lives today.
https://articles.mercola.com/sites/articles/archive/2020/02/04/novel-coronavirus.aspx?cid_source=dnl&cid_medium=email&cid_content=art1ReadMore&cid=20200204Z2&et_cid=DM450901&et_rid=803556056
Here's the plan
Tue, 04 Feb 2020 09:21
(C) 1994-2020 Dave Winer.
Last update: Monday February 3, 2020; 10:12 PM EST.
You know those obnoxious sites that pop up dialogs when they think you're about to leave, asking you to subscribe to their email newsletter? Well that won't do for Scripting News readers who are a discerning lot, very loyal, but that wouldn't last long if I did rude stuff like that. So here I am at the bottom of the page quietly encouraging you to sign up for the nightly email. It's got everything from the previous day on Scripting, plus the contents of the linkblog and who knows what else we'll get in there. People really love it. I wish I had done it sooner. And every email has an unsub link so if you want to get out, you can, easily -- no questions asked, and no follow-ups. Go ahead and do it, you won't be sorry! :-)
Watters presents Bill Clinton-signed treaty allowing Trump to request assistance from Ukraine on Biden
Tue, 04 Feb 2020 08:14
1999 Treaty with Ukraine on Mutual Legal Assistance in Criminal Matters '... Congress.govA 1999 treaty with Ukraine, signed by Bill Clinton, provides a rock-solid basis for President Trump's request for Ukrainian President Zelensky to investigate former Vice President Joe Biden and his son Hunter Biden for alleged corruption.
The Bidens are in up to their armpits with regard to a potential renewed Burisma Holdings natural gas probe '... an overdue investigation that was in fact initially stopped by VP Biden while he was in office '... a fact that he subsequently bragged about.
On Thursday, Jesse Watters revealed on ''The Five'' that he found the treaty that provides solid legal ground for President Trump's appeal for investigative assistance from Ukraine.
''I have found from 1999-2000 a treaty with Ukraine signed by Bill Clinton,'' said Watters. ''And the treaty with Ukraine on mutual legal assistance in criminal matters, which basically establishes a range of cooperation between the two governments of Ukraine and the United States about making testimony available, making people available, making documents and records available and assisting in the cooperation of mutual criminal matters. And they don't even have to be criminal. They can just be allegations.
''So, there is a firm legal underpinning to the request, the commander-in-chief to a country, an ally who we have a treaty with about criminal procedure to say, 'Hey, can you look into some potential corruption allegations involving a U.S. Citizen?''' he added.
''Now, if you are going to say that Biden is not under this treaty,'' continued Watters, ''that means because he's a potential candidate against the president, since he is a political opponent in an election season he can't be investigated, that means any time that I'm accused of a crime overseas I can just declare I'm running for president and then I can't be prosecuted by the government?''
''Under that then, to your point about the Obama team and Hillary Clinton team under that same treaty, asking for Ukrainian help to investigate Donald Trump would fit underneath the same treaty,'' Dana Perino commented.
Watters disagreed, saying, ''If that is an investigation that is a counterintelligence investigation, that does not fall under criminal investigation because that's what that was under Barack Obama. And, remember, there were no bases for those inquiries, either. If you are going to say that that's okay, then what Trump did is okay, too.''
Notably, resident leftist on the panel Juan Williams had no further argument and had to fold his tent, saying, ''Okay, okay. You win. I give up.''
The impeachment frenzy among Democrats as we head into the heart of the 2020 election season will continue unabated. Facts and strong, legal arguments in defense of President Trump will have to be the Republican order of battle going forward.
If Juan Williams gives up, you win. Solid argument. 🤣
'-- Ryan Fournier (@RyanAFournier) September 27, 2019
Watch the segment from ''The Five'' here:
Video by Fox News Even without this treaty, @POTUS still has broad Constitutional Authority as #ChiefExecutive in charge of National Intel, Criminal Prosecution, and National Security!
'-- David Higgins (@dhiggins63) September 28, 2019
Well done, Jesse! Juan won't be the only one giving up.
'-- Rhonda Kazmierski (@KazmierskiR) September 27, 2019
About Latest Posts Victor RantalaStaff Writer
[email protected] Victor Rantala is an Army vet who lives in Minnesota, he is a former intelligence analyst and business owner, and is an NRA Life member who is officially retired but has yet to slow his roll.
Latest posts by Victor Rantala (see all)
'Terror attack' in south London: Armed police shoot man dead | Daily Mail Online
Tue, 04 Feb 2020 08:10
Armed police have shot dead a suspected terrorist wearing a fake suicide vest after he grabbed a knife from a shop and stabbed a man and a woman during a brutal high-street rampage in south London.
The attack comes just three months after the London Bridge attack where Usman Khan was shot dead by armed police after he killed two people and injured three others while wearing a fake suicide vest.
Police believe the Streatham incident - where the suspect was shot dead by armed officers as part of a proactive Counter Terrorism operation - was Islamist-related.
A man is fighting for his life in hospital while a woman has non-life threatening injuries.
Another woman received minor injuries, believed to have been caused by flying glass following the gunshot.
The attacker was known to police, sources told Sky News.
Officers raced to the scene outside a supermarket on High Road in Streatham at around 2pm today following reports of gunfire.
Photos from the scene show a lifeless body face down on the pavement with what have been described as 'silver canisters' strapped to his chest with a large knife lying beside him.
Scotland Yard said the broad-daylight carnage was a terror-related incident around an hour after first reports from the scene.
Armed police have shot dead a suspected terrorist wearing a fake suicide vest after he grabbed a knife from a shop and stabbed a man and a woman during a brutal high-street rampage in south London
Officers raced to the scene outside a supermarket on High Road in Streatham at around 2pm today following reports of gunfire
Photos from the scene show a lifeless body face down on the pavement with what have been described as 'silver canisters' strapped to his chest with a large knife is lying beside him
Police officers inspect the suspect lying face down on Streatham High Road at around 2pm on Sunday (left) and officers suddenly backing off (right)
The officers inspect the suspect (left) after he was shot and lying face down on the pavement (right) wearing a fake suicide vest
Officers in a marked police SUV stop suddenly in the middle of the street (left) before getting out of the vehicle as the prepare to approach the suspect who is lying face down on the pavement on Sunday afternoon on Streatham high road
In one video, armed police can be seen approaching the suspect before suddenly backing off after they spotted what is now known to be a fake suicide vest.
The suspect is seen lying face down on the pavement as undercover officers train their guns on him.
A police SUV then speeds down the south London high street and brakes suddenly in the middle of the road.
Three officers leap from the marked car, approach the suspect with handguns drawn and appear to be examining him before they rush back.
Nardos Mulugeta, 52, a mechanical engineer who lives in Streatham, said he heard gunshots before seeing one victim lying in the street.
He said: 'I heard a shot and then there was a 20-second gap. Then there were three or four shots together.
'I went over and I saw the first victim, a male victim on the ground, near the White Lion Pub, and people were helping him.
'Then five minutes later a woman came over and said: "I've been stabbed too in the back." And then people starting helping her.
'I saw one body laying down further away. He was face-down between Argos and Iceland. It's really scary.'
Witness David Chawner said: 'I was going to the cinema. I saw what I thought was just a shop lifting. I saw someone run down the street, bump into someone and then they fell to the ground, got up again, and then somebody shouted and then I heard what I thought was a car backfiring.
'I didn't assume it was a gunshot until I saw what later turned out to be two officers pointing guns at an assailant on the road.'
He added: 'And because I was going to the cinema I always carry a blanket with me. It's a stupid thing but I always get really cold in the cinema. So I took that out my bag and gave it to them to compress the wound.'
Student Rafe Askem was walking along the High Road when he heard a man shouting 'ahh' and then saw the victim bleeding.
The 21-year-old said he saw two boys pushing a man against some shutters and heard a shout before looking over to see blood on the floor.
The student, from Streatham in south London, said: 'I saw somebody getting stabbed. It all happened very quickly.
'Then I just heard shouting and I saw people running. I saw him bleeding out.
'He didn't say anything. All I heard was him shouting out "ahh".'
A 19-year-old student from Streatham - who did not want to be named - claimed to have witnessed the shooting on Streatham High Road in front of a Boots store.
Police forensic officers with a bag at the scene in Streatham High Road, south London, after an attacker was shot dead by armed officers
Police can be seen behind a cordon in Streatham. London Ambulance Service Strategic Commander Graham Norton said: 'We were called at 1.58pm today (2 February) to reports of an incident in Streatham High Road'
Streatham 'terror attack': How the incident - that left three injured - unfoldedThe suspected terrorist armed with a knife rampaged through Streatham High Street before undercover officers shot him dead at around 2pm.
Police said that two people had been injured, one is believed to be in a serious condition in hospital.
Witnesses said the attacker was armed with a machete and had silver canisters strapped to his chest.
Plain clothes officers repeatedly told the suspect to stop, according to a bystander, before they opened fire. Three shots were heard.
The suspect was seen lying face down outside a Boots shop as officers aimed their guns at him.
The undercover officers appear to have been in the area when the attack unfolded and dozens more police cars, as well as ambulances rushed to the scene.
People were ordered to leave the area and shops were evacuated over fears the suspect was wearing a suicide vest.
Scotland Yard has described the incident as 'terrorist-related.'
He said: 'I was crossing the road when I saw a man with a machete and silver canisters on his chest being chased by what I assume was an undercover police officer - as they were in civilian clothing.
'The man was then shot. I think I heard three gun shots but I can't quite remember.
'After that I ran into the library to get to safety.
'From the library I saw a load of ambulances and armed police officers arrive on the scene.'
He said people began running into nearby stores after the incident.
'We were all informed to stay in buildings by armed police, until we were evacuated,' he said.
Dozens of emergency vehicles lined the area and an air ambulance landed on Tooting Bec Common a few hundred yards from the scene of the shooting.
The Met's deputy assistant commissioner Lucy D'Orsi said: 'At approximately 2pm on Sunday two people were stabbed in Streatham High Road, Lambeth.
'As part of a proactive Counter Terrorism operation, armed officers were in immediate attendance and shot a male suspect, who was pronounced dead at the scene.
'A third person also received minor injuries '' believed to have been caused by glass following the discharge of the police firearm.
'A device was found strapped to the body of the suspect and specialist officers attended.
'Cordons were put in place and it was quickly established that this was a hoax device.
A man is fighting for his life in hospital while a woman has non-life threatening injuries. Police forensic officers work near a car at the scene
Another woman received minor injuries, believed to have been caused by flying glass following the gunshot. Pictured: Forensic officers at the scene
A woman reacts near to the scene where a man was shot and killed by armed police. The attacker was known to police, sources told Sky News
'Three victims have been taken to south London hospitals. One man is being treated as life-threatening, one woman has non-life threatening injuries and another woman has minor injuries.
'My thoughts are with the victims and their loved-ones at this time.
'The situation has been contained and officers from the Met's Counter Terrorism Command are now leading an investigation into the incident. The incident was quickly declared as a terrorist incident and we believe it to be Islamist-related.'
London Ambulance Service Strategic Commander Graham Norton said: 'We were called at 1.58pm today (2 February) to reports of an incident in Streatham High Road.
'We worked closely with the other emergency services and sent a number of resources including five ambulance crews, an advanced paramedic practitioner, an incident response officer and a motorcycle responder, with the first of our medics arriving in four minutes. We also dispatched London's Air Ambulance.
'We treated three patients for injuries at the scene, and took all three people to hospital.'
The incident comes just three months after the London Bridge attack where Usman Khan was shot dead by armed police after he killed two people and injured three others while wearing a fake suicide vest. Pictured: An armed police officer recovers medical bags from the scene
A police forensics officer works outside a Boots pharmacy at the scene. Emma Taylor, from Streatham Hill, told Sun Online: 'I was walking up the high street after going for brunch with some friends and we saw a woman screaming outside a small hardware shop next to Iceland'
A police forensic officer was seen working at the scene. Dave Chawner tweeted to say: 'I had to stay with someone who'd just been #stabbed in #Streatham for 30 minutes before a single ambulance arrived'
A 33-year-old woman who lives near the scene also MailOnline how she was locked in a nearby Odeon for 20 minutes after the attack, before being rushed out a fire exit round the back. Pictured: Forensic officers at the scene
One officer was filmed telling pedestrians that the suspect was wearing a possible suicide vest before directing them away from the scene. Pictured: A forensic officer at the scene
Just minutes after the attack in London, Belgian police also shot a 'knifeman' who is thought to have stabbed two people on a busy high street in Ghent. Pictured: An armed police officer recovers medical bags from the scene
In the Belgium attack, the suspect was reportedly injured by officers in Ghent during the incident on Bevrijdingslaan, according to HLN. Pictured: A police officer at the scene
Student Rafe Askem was walking along the High Road when he heard a man shouting 'ahh' and then saw the victim bleeding. Pictured: Forensic officers after the attack
Dozens of emergency vehicles lined the area and an air ambulance landed on Tooting Bec Common a few hundred yards from the scene of the shooting. Pictured: Forensic officers at the scene
One officer was filmed telling pedestrians that the suspect was wearing a possible suicide vest before directing them away from the scene.
Just minutes after the attack in London, Belgian police also shot a 'knifeman' who is thought to have stabbed two people on a busy high street in Ghent.
The suspect was reportedly injured by officers in Ghent during the incident on Bevrijdingslaan, according to HLN.
Pictures show a man pinned to the ground by police on the busy road as witnesses watch in horror.
Police were filmed standing behind an unmarked police car and pointing their guns towards a suspect who appeared to be lying on the pavement outside the Boots store on the high street
Scotland Yard declared the broad daylight carnage as a terror-related incident around an hour after first reports from the scene
In one video, police toting machine guns and masked undercover officers are seen approaching the suspect's body before rapidly moving away from the area
A large section of the A23 remains sealed off to traffic as buses continue to be diverted.
Prime Minister Boris Johnson has since tweeted about the attack.
He said: 'Thank you to all emergency services responding to the incident in Streatham, which the police have now declared as terrorism-related.
'My thoughts are with the injured and all those affected.'
He is expected to return from Chequers to Downing Street this evening to respond to the attack.
Labour leader Jeremy Corbyn posted his thanks to those who have been dealing with the terror-related incident in London on Sunday.
'My thoughts go out to those injured and affected by the incident in Streatham," tweeted the leader of the opposition.
'I would like to thank the police and emergency services for their dedication and quick response.'
An officer was pictured crouching down to reach someone lying on the floor (left) as a large section of the A23 was cordoned off (right)
Dozens of emergency vehicles are currently lining the area as well as reports of an air ambulance and police helicopter circling above
An armed police officer was standing guard in Streatham after the scene had been fully contained by officers earlier this afternoon
One officer was filmed telling pedestrians that the suspect was wearing a possible suicide vest before directing them away from the scene. Pictured: Pedestrians ducking under the cordon
Mayor of London, Sadiq Khan, wrote a statement which read: 'A man has been shot dead by armed police in Streatham following an incident that is being treated as terrorism-related.
'A number of people are believed to have been stabbed.
'I am in close contact with the Met Commissioner and local representatives and wanted to thank our police, security and emergency services staff for their swift and courageous response.
'They truly are the best of us.
'Terrorists seek to divide us and to destroy our way of life - here in London we will never let them succeed.'
Labour leadership favourite Sir Keir Starmer added: 'Shocking reports from Streatham. My thoughts are with everyone affected.
'Huge thanks to our emergency services for everything they do to keep us safe.
And Home Secretary Priti Patel wrote: 'I am being kept updated by @metpoliceuk on this afternoon's incident in Streatham, which has been declared terrorist-related.
'My first thoughts are with the victims, our brave police and emergency services and their families.'
Similarly, Health Secretary Matt Hancock wrote: 'All our gratitude goes to the NHS paramedics and emergency services who responded so rapidly to today's incident in Streatham.
'Thinking of everyone involved. We must never be divided by terrorism.'
Jack Odell, 28, from Streatham told MailOnline: 'Police came and knocked on the door and told us to evacuate.
'They just told us to move away from the area. I only saw what was pictured in my tweet of the junction.'
Mr Odell said officers did not say when he could return to his property.
Cars come to a standstill in Streatham after armed police officers stand guard (left). A police officer outside an Iceland store in Streatham (right)
One police officer securing the area lifted the cordon for a woman to exit the high street following the incident
A police officer stands guard in a car park behind a Boots store near to the scene where a man was shot and killed
Richard Mustonen-Smith, 59, a response pastor for Ascension Trust, has lived in the area all his life.
He said: 'I'm shocked it's happened in Streatham. I've been here all my life. We're always getting accidents down here but not this.
'My grandson was in the Odeon and they got told to go out the back because there was a bomb. They got them to go out of the back of the cinema. They were there to watch a film.
'When it's a member of your family so close to you you don't expect it. You're always worried about your family being on the streets but this is even worse.
'I heard two people got stabbed and apparently one man was shouting Allahu Akbar but people thought he was just a crazy man, so he got away. Apparently he had two rucksacks.'
An unmarked police car pulled up in the middle of the road as members of the public huddled together as the suspect was laying on the pavement
Police at the scene on Streatham High Road. Metropolitan Police tweeted: 'We believe there are two injured victims. We await updates on their conditions'
A 33-year-old woman who lives near the scene also MailOnline how she was locked in a nearby Odeon for 20 minutes after the attack, before being rushed out a fire exit round the back.
She said officers came in and ordered them to stand well away from the windows.
She continued: 'I heard it and just thought it was a car backfiring. Everyone did.
'I ran into the Odeon just down the road. There were quite a few people in there. Only a few ran inside to start with.'
She said staff shut the doors. 'Everyone just thought it was a car.'
Four police cars and 12 officers were pictured taking control of the scene on High Road in Streatham earlier today. The incident has since been contained
Prime Minister Boris Johnson is expected to return from Chequers to Downing Street this evening to respond to the attack. Pictured: Police swarmed the high street after reports of gunfire
Metropolitan Police tweeted: 'We can confirm that the man shot by police at around 2pm today in #Streatham High Road has been pronounced dead'. Pictured: Streatham High Road
She said another woman locked in the cinema, who had been on the way to Poundland, witnessed the shooting and was shaking with fear.
'She thought it was a gang shooting because the two men were dressed all in black.
'She was really shaking, she was quite distressed and was panicking and all over the place.'
The woman ran upstairs in the cinema before people were let out the back.
She said she sprinted home as police cars 'zoomed around the area and helicopters circled above'.
She had to take a scenic route back home due to the main road being sealed off.
Police cars are seen at the scene surrounding the police cordons. London Ambulance Service were called just before 2pm
Members of the public have been commenting on social media.
Rector Anna Norman-Walker, who works at St Leonard's Church in Streatham, said: 'Situated in the #Streatham Rectory with police tape both sides of us... prayers for our wonderful police who are doing such a remarkable job in a frightening situation.'
One user wrote: 'What the hell is going on in Streatham?!? Helicopters circling above and sirens outside. Twitter saying a man has been shot dead. 'It's a Sunday afternoon and families are everywhere. Very scary.'
Another added: 'Be careful out today I'm London, just seen about two dozen armed police, a man shot and a two stab victims receiving urgent medical care.
'I don't know but I think like I heard 3 gun shot in Streatham.'
A third man said: 'Something major happening in Streatham High Road. Armed police and roads closed off.'
Dozens of emergency vehicles are currently lining the area and a helicopter ambulance landed on Tooting Bec Common a few hundred yards from the scene of the shooting
Two police officers wearing hazmat suits arrived on the scene on Streatham High Road a short time later. The road remains closed as they continue to investigate
Clothing and used medical litter was left discarded on the street in Streatham where a man was shot by police after reports that he stabbed two people
Emma Taylor, from Streatham Hill, told Sun Online: 'I was walking up the high street after going for brunch with some friends and we saw a woman screaming outside a small hardware shop next to Iceland.'
She said the distressed woman, who owns a hardware shop, shouted 'he's just grabbed a knife from my shop and stabbed a lady.'
The 31-year-old said the woman was just five yards in front her being treated by paramedics.
Ms Taylor described how there were armed police everywhere and said the woman being treated was in 'pure shock'.
Streatham High Road, Lambeth, London, has been cordoned off by police after reports of a man shot by police
A car believed to be an armed response car that crashed on the way to the scene as officers investigate the incident
Mr Chawner tweeted to say: 'I had to stay with someone who'd just been #stabbed in #Streatham for 30 minutes before a single ambulance arrived.
'I'm just over one mile from a hospital - I'm not having a go at anyone but that's not right.
'I just hope he made it.'
Speaking to Sky TV later, he said: 'In that moment I did not think it was a terrorist attack, I did not think it was anything out of the ordinary, until I saw the guns...
'My only concern was the poor person in the street. '
Rory Stewart, who is an Independent candidate for Mayor of London in the upcoming 2020 election, responded to Mr Chawner's post.
He wrote: 'So much respect for your courage and presence of mind - remember to get to counselling immediately - at least have a chance to calmly talk it through.
'All my respect and best wishes.'
'Highly pathogenic' H5N1 bug that can spread to humans kills 4,500 chickens in China | Daily Mail Online
Tue, 04 Feb 2020 08:10
China has reportedly seen an outbreak of a 'highly pathogenic' strain of H5N1 bird flu which has already killed 4,500 chickens.
The outbreak was initially reported at a farm in Shaoyang city in the southern province of Hunan, south of the epicentre of the Coronavirus in Wuhan.
According to the Reuters report, Chinese authorities have already culled 17,828 poultry in the wake of the outbreak.
The bird flu has been classed as highly pathogenic because of the number of birds which have died from the disease.
According to the NHS, the H5N1 strain of the virus has 'caused concern' in recent years.
Although the disease doesn't easily infect humans and it is hard to spread it from human to human, several people have been infected around the world and died.
When people do become infected by the disease, the rate of mortality is about 60 per cent, according to the World Health Organisation.
People can become infected by coming into close contact with infected live or dead birds, or H5N1-contaminated environments.
Shaoyang is about 302 miles from the central city of Wuhan, where the coronavirus outbreak began late last month.
The coronavirus death toll has now reached 305. Only one person has died outside of China, in the Philippines.
It can take up to two weeks, or potentially more, for symptoms to appear so people may not know they are infected.
Someone who is infected with the Wuhan coronavirus can spread it with just a simple cough or a sneeze, scientists say.
At least 213 people with the virus are now confirmed to have died and more than 9,800 have been infected in at least 21 countries and regions. But experts predict the true number of people with the disease could be 100,000, or even as high as 350,000 in Wuhan alone, as they warn it may kill as many as two in 100 cases. Here's what we know so far:
An aerial view shows the newly completed Huoshenshan Hospital, a dedicated hospital built in eight days to treat coronavirus patients, in Wuhan
A general view of Jianguo Road in Beijing, China, as the country is hit by an outbreak of the new coronavirus
What is the Wuhan coronavirus?
A coronavirus is a type of virus which can cause illness in animals and people. Viruses break into cells inside their host and use them to reproduce itself and disrupt the body's normal functions. Coronaviruses are named after the Latin word 'corona', which means crown, because they are encased by a spiked shell which resembles a royal crown.
The coronavirus from Wuhan is one which has never been seen before this outbreak. It is currently named 2019-nCoV, and does not have a more detailed name because so little is known about it.
Dr Helena Maier, from the Pirbright Institute, said: 'Coronaviruses are a family of viruses that infect a wide range of different species including humans, cattle, pigs, chickens, dogs, cats and wild animals.
Thailand health officials claim 'good results' after using two antiviral drugs on coronavirus patientsThailand has seen promising results after using a mix of two antiviral drugs, according to a health ministry briefing, reports Bloomberg.
Medics tested the drug mix on a patient who was in a serious condition with the disease and within 48 hours they were declared disease-free.
The drugs, originally used for HIV and influenza treatment, were a success according to Dr Kriangsak Attipornwanich.
Thailand has seen 19 confirmed cases of the coronavirus, 11 are still in hospital but the rest have returned home.
Deputy Prime Minister and Public Health Minister Anutin Chanvirakul said that the nation will repatriate more than 100 people from Wuhan on February 4 after they pass medical screening in China.
They will then be quarantined for 14 days after returning to Thailand.
'Until this new coronavirus was identified, there were only six different coronaviruses known to infect humans. Four of these cause a mild common cold-type illness, but since 2002 there has been the emergence of two new coronaviruses that can infect humans and result in more severe disease (Severe acute respiratory syndrome (SARS) and Middle East respiratory syndrome (MERS) coronaviruses).
'Coronaviruses are known to be able to occasionally jump from one species to another and that is what happened in the case of SARS, MERS and the new coronavirus. The animal origin of the new coronavirus is not yet known.'
The first human cases were publicly reported from the Chinese city of Wuhan, where approximately 11million people live, after medics first started seeing infections on December 31.
By January 8, 59 suspected cases had been reported and seven people were in critical condition. Tests were developed for the new virus and recorded cases started to surge.
The first person died that week and, by January 16, two were dead and 41 cases were confirmed. The next day, scientists predicted that 1,700 people had become infected, possibly up to 7,000.
Just a week after that, there had been more than 800 confirmed cases and those same scientists estimated that some 4,000 '' possibly 9,700 '' were infected in Wuhan alone. By that point, 26 people had died.
By January 27, more than 2,800 people were confirmed to have been infected, 81 had died, and estimates of the total number of cases ranged from 100,000 to 350,000 in Wuhan alone.
By January 29, the number of deaths had risen to 132 and cases were in excess of 6,000.
Where does the virus come from?
Nobody knows for sure. Coronaviruses in general tend to originate in animals '' the similar SARS and MERS viruses are believed to have originated in civet cats and camels, respectively.
The first cases of the virus in Wuhan came from people visiting or working in a live animal market in the city, which has since been closed down for investigation.
Although the market is officially a seafood market, other dead and living animals were being sold there, including wolf cubs, salamanders, snakes, peacocks, porcupines and camel meat.
Bats are a prime suspect '' researchers at the Chinese Academy of Sciences said in a recent statement: 'The Wuhan coronavirus' natural host could be bats'... but between bats and humans there may be an unknown intermediate.'
And another scientific journal article has suggested the virus first infected snakes, which may then have transmitted it to people at the market in Wuhan.
Peking University researchers analysed the genes of the coronavirus and said they most closely matched viruses which are known to affect snakes. They said: 'Results derived from our evolutionary analysis suggest for the first time that snake is the most probable wildlife animal reservoir for the 2019-nCoV,' in the Journal of Medical Virology.
Opinion | China and America Can Compete and Coexist - The New York Times
Tue, 04 Feb 2020 08:06
Even strategic enemies can build trust when they measure the stakes of a full-on clash.
By Zhou Bo
Mr. Zhou is a senior colonel in the People's Liberation Army.
Feb. 3, 2020A U.S. fighter jet preparing to land on the U.S.S. Ronald Reagan following a patrol of the international waters off the South China Sea. Credit... Bullit Marquez/Associated Press BEIJING '-- Forget the trade war. If the gravest challenge of the 21st century is finding ways that China and the United States can coexist competitively, the real danger is that an unexpected incident might trigger a conflict that neither side has anticipated or could possibly control. The likeliest potential flash point is the South China Sea.
China believes, and has said as much in a 2014 position paper, that it has ''indisputable sovereignty'' over the South China Sea islands and the adjacent waters. This claim is solidly grounded in history and law, the government argues, because ''China was the first country to discover, name, explore and exploit the resources of the South China Sea islands and the first to continuously exercise sovereign powers over them.''
Some coastal states in the region disagree '-- most notably perhaps the Philippines, but also Vietnam, Brunei, Malaysia and more recently, Indonesia. They defend other, sometimes competing, territorial claims, based on their own accounts of history and geography.
The United States, for its part, has historically vowed not to take sides in these disputes over sovereignty, arguing that it only wants to protect free navigation in the region's waters.
But China has denounced America's professed commitment to neutrality as hypocritical in several ways. And as academics like M. Taylor Fravel have argued, there seems to be something of an inherent contradiction in the United States' policy: between its claim to want to stay out of local disputes and the resurgence of its operations in the region, particularly since it identified one country '-- China '-- as ''the primary source of increased tensions'' there.
What's more, whenever an American vessel sails close to islands or rocks controlled by China, in waters patrolled by Chinese ships, the risk of a dangerous encounter rises.
In 2001, a Chinese fighter jet collided with a United States Navy surveillance plane, killing the Chinese pilot. A tense diplomatic standoff over the detained American pilot and crew was resolved after Washington said, twice, that it was ''very sorry'' '-- without officially accepting responsibility for the accident and death. Since then, there have been quite a few close encounters between American and Chinese military vessels and aircraft, again in 2001, and then in 2009, 2013, 2014, 2015 and 2018.
Under the Trump administration, the United States Navy has increased its freedom-of-navigation operations, including in waters that China claims as its own, and those maneuvers increase the risk of an incident. The American destroyer Decatur and the Chinese destroyer Lanzhou narrowly avoided a collision, by just 45 yards, in September 2018 '-- the hairiest encounter in years.
Should another collision occur today, it won't be resolved as easily as the one in 2001 was. An ever-rising China can only be more determined to safeguard what it sees as its sovereign rights, especially when Washington has deliberately intensified its competition with Beijing, and rather aggressively. Thucydides identified three motivations '-- fear, honor and interest '-- as the main causes of a war, and the South China Sea features them all.
Partly because China has ramped up its military arsenal and fleet in recent years, as well as built up outposts in the South China Sea, the Trump administration has called it a ''strategic competitor,'' including in the 2017 National Security Strategy paper and the 2018 National Defense Strategy. Washington has also said that Beijing is a ''revisionist power.''
China, in turn, released a defense white paper last summer that described the United States as having ''adopted unilateral policies'' and ''provoked and intensified competition among major countries.''
With the temperature seeming to rise on both sides, how can a conflict, or something like a new cold war, between China and the United States be avoided? Precisely by looking at the actual Cold War.
In the early years of that protracted standoff, American and Soviet aircrafts didn't hesitate to fire at one another. There were three crises over the status of divided Berlin, in 1948, 1958 and 1961. The Cuban missile crisis brought the two superpowers to the brink of nuclear war in October 1962. And yet outright conflict was averted, thanks to a few modest agreements and well-established hotlines for emergency communication. Even bitter enemies can build trust, and with imperfect tools, when they measure the stakes of a full-on clash.
In 1972, Washington and Moscow signed the Agreement on the Prevention of Incidents on and Over the High Seas '-- vowing, among other things, to use clear communication signals, avoid ''embarrassing or endangering'' even ships under their surveillance and exercise ''the greatest caution and prudence in approaching'' vessels on the high seas. The accord didn't prevent two Soviet ships from bumping into two American ships in Soviet territorial waters in February 1988, but that was an outlier incident, and the agreement does seem to have drastically reduced the overall risk of dangerous encounters. Within two years of its entry into force, according to a 2012 paper by Raul (Pete) Pedrozo, then a law professor at the United States Naval War College, the number of incidents per year had dropped from 100 to 40.
If the Soviet Union and the United States managed to avoid a major conflict during the Cold War, then some degree of confidence seems in order today about the far less confrontational relations between China and the United States.
Unlike the military rivalry between the United States and the Soviet Union, which was global, any military competition between the United States and China is confined to the western Pacific. America thinks that China wants to drive it out of the region; China believes America wants to block its legitimate ambition to develop a blue-water navy and hopes instead to confine China's influence to the eastern coast of continental Asia.
Yet even though China has built up its military capacity at an awesome speed, it has shown no appetite to replace the United States as world policeman. China's operations far from its shores, such as in the Gulf of Aden or on the African continent, are limited to addressing threats such as piracy or participating in peacekeeping and disaster relief. The United States Navy, on the other hand, regularly sends ships to the Asia-Pacific region in a deliberate effort to ''challenge'' '-- its own term '-- the ''excessive maritime claims'' of some coastal states.
Still, even the wariest of observers have yet to describe China and the United States as actual enemies. At the last Xiangshan Forum in October '-- the Chinese government's version of the Shangri-La Dialogue '-- Wei Fenghe, the defense minister, said, ''The China-United States military relationship is generally stable, but we are confronted with many difficulties and challenges.''
The confidence-building measures that exist today between China and the United States are rudimentary compared to those between the Soviet Union and the United States during the Cold War. In a way, this may be a comforting fact: a suggestion that relations haven't become so hostile as to require many such measures. Yet more of them will be necessary in the long run.
In 1998, China and the United States, acting in ''the spirit of mutual respect,'' signed the Military Maritime Consultative Agreement to ''establish a stable channel for consultations between their respective maritime and air forces.'' In 2014 came the nonbinding Code for Unplanned Encounters at Sea and the Memorandum of Understanding regarding the Rules of Behavior for Safety of Air and Maritime Encounters.
Chinese and American aircraft nonetheless collided after the 1998 agreement, and there have been dangerously close calls even since the two later sets of guidelines. In other words, confidence-building measures alone can neither prevent incidents nor overcome strategic distrust '-- today no more than in the past. And yet they remain essential to preventing any mishap from escalating and to developing working relations between China and America despite their divergent interests.
As China's military strength continues to grow and it closes the gap with the United States, both sides will almost certainly need to put more rules in place, not only in areas like antipiracy or disaster relief '-- where the two countries already have been cooperating '-- but also regarding space exploration, cyberspace and artificial intelligence.
For Chinese people, who traditionally believe in yin and yang, the notion that rivals can cooperate isn't a contradiction in terms. It seems to be a problem for America, however. Officials in Washington and other Western capitals have expressed dismay that China hasn't become more like the United States, or at least more democratic. But did China ever pledge to become like the United States? And so what if it hasn't become that? Competitive coexistence is still possible.
Zhou Bo is a senior colonel in the People's Liberation Army of China. This essay reflects his opinions alone.
The Times is committed to publishing a diversity of letters to the editor. We'd like to hear what you think about this or any of our articles. Here are some tips. And here's our email: letters@nytimes.com.
Follow The New York Times Opinion section on Facebook, Twitter (@NYTopinion) and Instagram.
Yesterday, I wrote a long bio weapon conspiracy here implicating China. Just a few minutes after posting, I received a long meticulously thought out message detailing a counter conspiracy blaming the U.S. written in Mandarin Chinese. : conspiracy
Tue, 04 Feb 2020 08:03
My recent conspiracy post:
https://www.reddit.com/r/conspiracy/comments/extiks/scientific_article_regarding_an_engineered_sars/
The original Mandarin is inside the Pastebin, along with their english translation.
After I received their message, I suggested they post it, but their account was too young, so I promised I would post it for them.
æ‰æ'‰ä¸­å›½äººæ°‘åº--该ç‹å"发现å'Œå­...ä¹ çšæ'大图片゠The Biggest Picture that all Chinese people should immediately discover and learn.....
https://privatebin.net/?90c00ca1dbf61958#8nymyvKmn6t7xAVgtNTa16BCHMjhMdzHH8VG7FtFEZtJ
https://pastebin.com/WKbr24M8
I believe and have compelling circumstantial reason to believe that the American CIA injected and planted the so-called "Wuhan virus" into Wuhan, China in or around the dates of October 31st 2019 and December 31st 2019 with intent to harm China and with potential to destablize and perhaps even motive to collapse China from within.
US wants to re-route global supply chain around China, to bypass China and isolate China on the world stage vs China wanting to use Huawei-enabled digital-blockchain Yuan, cashless WeChat, etc to topple the US Petrodollar hegemony and the BRI relationships and bi-lateral trade/infrastructure agreements in order to propel the world to adopt the use of the digital Yuan, and in order to have the world bypass the SWIFT system (since US has abused its dollar status and weaponized it for unlawful sanctions) and the US dollar as the default global reserve currency etc. It was a race against time to see whom would pull the rug from underneath the other countries feet first. US, unable to compete fairly due to its structural disadvantages and many other shortcomings, decided to go the biological attack route, which allows it to hide under the cover of "plausible denialability" (since it is more difficult to conclusively prove the attribution or source of a new mysterious virus than it would be to track the trajectory of an incoming thermnonuclear missile etc) to inflict maximum damage to China while minimizing the potential blow back.
Right after the signing of the so-called "Trade Deal" in which the US didn't get what it wanted (the US did not get the sort of Plaza Accord concessions that it was hoping XI/CCP would kowtow to etc) and immediately into the start of the new decade (marking the turn of the second decade in what the PNAC would called the "new american century") the US resorted to biological attacks in order to contain, isolate and attempt to cripple China/CCP internally and on the world stage at large. After its NED/CIA sponsored Hong Kong destablization/radicialization didn't spill over into the rest of mainland China, and right after its intense year long anti-China anti-Huawei campaigns have peaked in effectiveness, the US releases the evil demon virus into the heart of mainland China, at the absolutely worst possible location (Wuhan being one of the Chinese main Central hubs in terms of transportation and an important city for China's Belt and Road initiatives and estimated to have as high as 8% growth in GDP in 2020) and in also the absolute worse possible timing (right before the Chinese Lunar New year, otherwise known as the greatest annual human migration event, during a time in which shopping, spending and consumerisms activity would have been at a peak etc) in order to cripple China economically, to cut China off from the rest of the world and even force China to isolate its own cities from within, and to have the effect of smearing China's reputation on the world stage and invoking the escalation of fear, racisms and bigotry towards the Chinese people abroad.
All this comes right on top of the heels of the event last fall, African swine fever (ASF), which had never before seen in China but now mysteriously appeared with the onset of the US trade war, decimated half of China's pigs, which doubled pork prices and contributed to inflation causing pricy US pork exports to double in China. The odds for two such consequent anomalies, timing and location are exceedingly low. Yet both did occur '' in almost perfect sequence. Particularly devasting is the very real possibility that this virus was intentionally engineered to have as long an incubation period as possible, and with the ability to hide within plain site, by being asymptomatic during its initial stages hence making it orders of magnitude more difficult to eradicate. Just recently, as recent as Feb 1st 2020, there has been yet a third mysterious outbreak in China, this time of the bird flu kind that is far more deadly to humans and wiping out Chinese chicken and poultry at the most dire of times. Indeed the coronavirus victims so far, both inside and outside of China, are only people with Chinese type of blood, Haplogroup O-M175, designed to attack that type of blood and specifically Chinese people.
Dr. Steven Hatfill Biological Weapons Expert says the Wuhan virus it will have to play it out and "run its course" not only in Wuhan but the greater mainland China. The host Steve Bannon (Trump chief campaign advisor) predicted this will crush China economically, and that its the end of the Xi/BRI/OBOR and will give US the chance to re-route trade of all countries to go-around and bypass China bringing the global supply chain back to US and its allies whilst isolating China economically, politically, etc. They are selling this to the American people and pitching it to the world as this Chinese Belt and Road connectivity is what is allowing this virus to spread so fastly to the rest of the world and that it would behoove mankind and all nations to reconsider the security and stability of their own supply chains and basically urging everyone to pull their companies, people, trade, businesses etc out of China. This is not unlike what Wilber Ross US Commerce Secretary already stated a few days ago... that this virus is good for America and will help bring lots of jobs back to the USA... seems like the goal is to use this event to pull the rug underneath China's development feets.
I suppose it could be a coincidence that China, the geopolitical adversary and economic enemy to the United States (according to the US itself), suddenly gets this mysterious virus seemingly more potent than SARS (which itself apparently only targeted Chinese ethnic DNA and left the white/Caucasin population untouched) at the worst possible timing and in the worst possible location. Wuhan being Chinese's central hub and this being the Chinese Lunar New Year, it has the highest ability to spread and go "super viral" whilst impacting the max amount of damage to the stability of the China, both in terms of having the max potential to cause political turmoil in the homeland (ruining people's new year, quarantinee and lockdowns of cities of unprecendeted porportion, causing many Chinese citizens to get angry etc) and doing the maximum amount of possible damaage to the Chinese economy, ruining the New Year in which consumerisms was supposed to be at its very highest points.
Even the SARS of 2003 had an negative impact on Chinese GDP by as much as 2%, and has already turned out to be far worse and at a much more accelerated speed of spread and deaths. Unsuprisingly without need for a single bullet fired or sanction imposed, it already managed to force China to self-impose the closure of its borders and cities, most nations have already stopped flights to China including the United States itself, on the world stage it is another "ding" for China's image and gives the propaganda mouthpieces of the West something else to gripe about, whilsts at the same time an attempt to cap Chinese One Belt One Road ambitions and sabotage China's growing economy and hegemonic rise. It comes right on the crisp of Trump signing the fake "Trade Deal" and the UK decided to go against the US and work with Huawei.... I say something else is going on behind the scenes, more than what we are being told. We could have transition from Trade War, to Tech War to now maybe bio-war, if that is the case, then very likely the US already fired the first, second, and third shots, so to speak.
China should at least stay vigilant and have a credible deterrence contingency plan in place... In the nuclear world in which China has DF-41, the "MAD" doctrine is still well in place. But a mystery virus affords far more "plausible deniability" for the US. Thus achieving the goal with less fear of attribution and thus retribution. Instead of directly confronting China in the SCS militaristically immediately, maybe they think a better way to take China down a notch or two would be the use of "other means" to an ends.. Science and technology in the world has come a long way since the days of Westerners giving Native Americans blankets laced with smallpox to "thanksgiving" them. It is the human condition to be risk/loss adverse. A nation that would stop at nothing to achieve Maniesft Destiny on the way up surely wouldn't have any qualms of preserving its hegemony at all costs on the way down. After all, the American way of life is nonnegotiable and Graham T. Allison predicted the likelyhood that this confrontation of a rising power with a declining power will inevitably lead to war, and history has shown that to be indeed the case. The US is applying its doctrine of maximum pressure to destroy China on all fronts, with Trade War, Tech and supply chain War, cyberwar, information and pysops war, and now biological warfare and most likely to be followed up with conventional or even nuclear war once US believes China is sufficently weakened.
Steve Bannon was hoping to "break the back of the CCP" by cutting off China's supply chain, and was hoping the HK roits was going to catch fire in the rest of the mainland and force the CCP to lose control making it easier to do an opportunistic regime change.
I'm sure both China and US have their own red lines. If the US had any involvement in this new virus, if China finds any credible evidence, then there are a number of things China can do besides retailiting with its own bioweapon... for example, we all know the Trade War is not about trade, but wanting China to slow down in terms of hegemonic rise... for example China could simply start building Huangyan Island in the SCS, making a move that would seal the US fate as the "falling empire". If China militarizes the island it would give China total control of the SCS region, so China can declare ADIZ over SCS, America would be pushed back to Guam, and it woulld be the beginning of the end of the petrodollar hegemony (which never could have lasted forever anyway but it would push it up along the timeline to make it collapse that much faster)
Some have said that well the virus is RNA single stranded which makes it harder to target any race specific without mutations losing the specificity over many infections cycles. And that if it were double stranded it would make it that much easier to create vaccines for and kill/contain. But I believe in this case it is about maintaining "plausible deniability" whilst not crossing any hard red lines in case attribution is established in the future. A virus outbreak that dings China's GDP by 2 to 5 % in 2020 is not comparable to an end of civilization event that wipes out 90% of the Chinese population, for example. Whatever blowback or collateral risk is considered acceptable levels since it was deployed to China's central Wuhan, naturally China has a self interest in containment, and the vast majority of the damage will be internal to China. It may have been engineerred as race specific single stranded RNA and knowingly by hostile forces that predicted by the time it lost its race specificity that China would have already contained it. Hence "mission accomplished" with little attribution and minimal blowback. What better way to undermine China/CCP than to have its population grow resentful of or turn against its very Government!? Already Western media is talking about how Chinese are filthy and if it wasn't for eating rats, bats, dogs, etc this wouldn't ever have befallen. Perfect cover for re-enforceing racists stereotypes for the ulterior motives of containing and isolating China, and that of Chinese culture, and Chinese ideology on the world stage.
All of this should be seen within the larger context and backdrop of the so called Thucydides's Trap. For various reason, biological warfare against mainland China gives America multiprong strategic and asymmetric advantages, hence why it has now become the method and weapon of choice for the US to use against China. At what point does China take action or else find itself too little and too late to be suffering same fate as Native Americans? History has shown that America is willing to wipe out entire Han civilization to maintain american hegemony and regain full spectrum dominance and supremacy.
Kissinger is credited for giving Nixon the idea to open up China. It appears as the 45 year rapprochement comes to a sudden close, the US has regretted the long term decision. When viewed threw the lens of optimization of entropy maximization and the 2nd law of thermodynamics it is all about the counterbalance needed to an unchallenged US uni-polar scheme that impedes the progress and destiny of a universe in evolution.
Steve Bannon was quoted to say that it is Ten times more important for the US to kill Huawei than it is for Trump to sign any trade deal. USA realizes that China will soon surpass them if status quo isn't changed. The true motive of the trade war is to decouple the US from China quickly enough to asymmetrically target and destroy any tip of the spear Chinese companies/projects/tech such as the Huawei, 5G, DJI, EV, trains, Cancer research, TikTok, SenseTime, etc etc to cripple China's plans to move up the value chain and hi-tech-ify its economy and to do so with enough force to set back China and permanently prevent it from successfully climbing the arch trajectory of replacing the US. For the US it's not just about losing the top spot to China, if America were to ever lose its petrodollar hegemony it would collapse in much the same way as happened to the USSR. The whole US empire is built on house of cards, ever since Brentwood they got away with taxing/usurping the world using the dollar as economic weaponization through 'quantitative easing' and its military to control OPEC to sustain the petrodollar hegemony. In the 1980's Japan became a threat to the US so they forced Tokyo to acquiesce to the Plaza Accord resulting in the "lost four decades" and Japan never recovering. Nowadays Trump, Steve Bannon, Pompeo and other Hawks are trying to impose the same sort of colonization on China, but much harder to do since China doesn't entertain US troops/US bases unlike the Japanese vassal so the next best thing is to subvert Hong Kong by way of CIA/NED and other propaganda techniques. And which nation killed a million civilians in Iraq after a false flag event and a WMD pretext but now is banning Chinese AI startups ostensibly because they care about the human rights of Muslims in China's internal Xinjiang region?
This is all part of the bigger picture to contain China's continued rise, as we see that if the US ever lost its hegemony it would be game over... America views Chinese ambitions such as Made In China 2025, One Belt One Road, 5G, AI, etc as existential threats to its very lifestyle and way of life, hence the whole "Huawei is a national security issue" stance... Now even TikTok, a dancing video app, has become a "national security" threat and targeted and singled out by the US Congress. By "national security" they really mean China is offering the world a better deal and they are pissed that they are being undercut and view Chinese success as a direct threat to American hegemony. The West had its chance to help out Africa but did nothing, now China wants to help them develop and US is getting resentful, the supreme irony is accusing China of predatory lending. This will only get much worse, Xi predicted this will last a period of 30 years until which time China has become the undisputed Number One in the world economically, technologically, politically and militaristically. As the declining power the US isn't going to just go down without fighting..... Just like the Roma Empire, as the US declines on the way down the lip service of freedom, democracy, etc stops and the true colors of the ugly side all comes out, they just did another coup in Bolivia after China signed a lithium deal to secure development of batteries for EVs, and now US is even sanctioning its own "allies" like Germany for daring to buy energy from Russia (NordStream 2, etc)...
Like others have already brought to light and mentioned, with the multiple initial sources surrounding this Wuhan virus, it makes "intentionally starting a pandemic with a bioweapon" scenario much more likely. The virus failed to spread with the first group of targets, so they tried again with the market.
For those who refuse to believe the US could ever be morally capable of doing such a coordinated strike and biological attack on mainland China, even if you do not at all believe US had anything to do with it, and even if US in reality had nothing to do with it, it still doesn't change the fact that this virus has changed the power dynamic and upset the balance; and we already have evidence from US such as Wilber Ross etc willing to take full advantage of the situation. China must be prepared to adapt and adjust to this fluid situation as well, short term and as well as long term. This thing could very well politically isolate China (it is already having such an effect) and crater China's GDP, and most importantly strategically pressure China to give up its long term development aspirations and also to sign away certain concessions (give up on MIC2025 etc) right at the most critical moment in history.
Sure we understand that the flu killed already 10000 US person this year alone, I also know the numbers in terms of how many up to 80,000 die of flu alone last year. And yes some of the hysteria and panic of this Wuhan thing may cause more damage than good at this point, sometimes the fear is more than just the virus damage itself.
Having said that, on the other hand, the facts are this banning of all flights from China to the US, the enactment of the quarantine is described by the US CDC itself as the heaviest action it has taken in 50 years. Indeed when was the last time Russia closed its borders to China? When was the last time Disney shutdown, and all these hundreds of other things shutting down in China and all the countries closing their door to China? Precisely my point regardless of whether or not the real or percieved threat of this virus is overblown or not, the fact is the reaction to it has already greatly harmed China substantitively at what could be argued as the worst possible timing... so yes, this virus has changed the power dynamic and upset the balance.
The fact of the matter is the rest of the world isn't closing its flights and borders to the USA, despite the flu in the US killing way more people, but the world is closing its doors to China... This cannot be good no matter how it is spun. I'm concerned this will be the point of inflection in which the tide permanently turns and China regresses back to being closed, isolated country and America pulled the supply chain rung under China's feet while China is down/ill and then convinences the rest of the world to a new Brentwoods to basically maintain US hegemony for the next 100 years. Perhaps this is what Trump was secretly hinting at when he gleefully announced at Davos that "now is the time for renewed and great optimism"... Maybe he was hinting at world events to come that will greatly benefit America at the direct expense of China, events that by the time he made the speech at Davos would have already been put in place by the CIA.
If America has declared war on China, --(first by economic decoupling via sanctions and tariffs then by trying to kill off Chinese technology ascension by attempting to cut off China's tech supply chain, and finally by covert biowarfare to destroy China's food supply and then poision the Chinese people with a sinister virus in hopes of destablizing the entire country,)-- etc and by all appearances it has, with Pompeo openly stating that the Chinese CCP was the "central threat of our times", and Bannon calling for Trump to "takedown Xi" and "break the spirit and crack the back of the Chinese people", then it behooves China to defend itself and its citizens and interests appropriately.
This information better be spread across Chinese media so that the average Chinese develops a healthy and warranted suspicion of certain nations that have taken it upon themselves to stop at nothing to destroy the Chinese way of life and to destroy China's development and progress. Making more mainland Chinese aware of the underlining truth that all of China is constantly being targeted with warfare of all categories and at all levels by everything American cannot possibly be a bad thing. America has been applying every kind of means of warfare that exists under the sun against China, against the Chinese government and against the Chinese people and their well-being; be it Trade War, Economic War, Proxy War (Taiwan, HK, etc), Tech War (Huawei/5G/AI/tiktok), Supply Chain War, CyberWar, Information propaganda Warfare (including the "reverse conspiracy theory" and other false flags), Biological Warfare and soon to be Conventional war and perhaps even someday Nuclear war.
The Chinese people for their own good should be more aware of the ideological war that America has inflicted upon the Chinese citizens both at home and abroad... The stark constrasting juxposition could not be more supremely ironic and hypocritical. Brain drain from the rest of the nations in the world to the US is called "free market" and labeled as "freedom loving scientists going to work in open democractic Universities with higher pay and better quality of life" and yet this same notion of "brain drain" from the US to the rest of the world is called "intellectual property theft", "spying", or "sending spies to steal 'American technology'". For when as China or Russia or India jailed their scientists for working with US universities and earning US research grants. If they did that, immediately the US media will instantly accuse them of being "totalitarian communist police state with no academic freedom" etc.
During China's moment of greatest need and vulnerability we see Westerners racism and xenophobia come out in full blossom from Universities that say it is normal to be xenophobia to so-called "free speech" newspapers that take delight in China's plight and openly incite hatred and racisms by publishing intentionally vile depictions of the Chinese people and the Chinese flag in order to kick China while it is down.
America knows that "time is on China's side" be it with regards to GDP PPP, or the situation in the South China Sea, or that of Hong Kong, and later Taiwan, as China's sphere of influence continues to grow in Eurasia; or even in the larger context of the digital blockchain Yuan and China's BRI/OBOR to replace or supplant the US petrodollar hegemony and so many other aspects... America knows that if status quo doesn't abruptly change that one day it will be too late to confront China. Trump, as their self-proclaimed "Chosen One" has openly stated from the beginning that he won't allow China to surpass America "on his watch" and that if his administration doesn't stop China right now that no future generation of administrations will ever be able to do so again. The US recognizes that the situation is quickly reaching an inflection point past which there is no point of return or going back. It is now or never. And since a direct nuclear confrontation is not going to help America achieve its goals or retaining its status, nor reversing its decline, and coming back on top in terms of once again being sole unipolar hyperpower with no contender or meaningful challenger, then only option left after a failed trade war and failed tech war was to attack China in the back by secretly using biological warfare against China, not once, not twice, but now for a third and potentially ever more devastating time as each attack is increased in boldness and exponential in unprovoked escalation.
https://www.the-scientist.com/news-opinion/lab-made-coronavirus-triggers-debate-34502/amp
https://www.fxstreet.com/analysis/the-concern-for-the-secretive-bio-geopolitics-201910110327
https://www.fxstreet.com/analysis/the-mystery-of-the-african-swine-fever-in-china-and-asia-201908260134
https://www.bloomberg.com/news/features/2019-06-13/the-u-s-is-purging-chinese-americans-from-top-cancer-research
The end.
After I promised to post it, he sent me one final message to underline and summarize everything said:
Motive, means, and TIMING, all just too suspicious... in terms of the African Swine Flu that started attacking chinese pigs for the VERY FIRST TIME immediately after Trump started the Trade war in 2018 causing China to buy MORE Pork from the US at higher price/cost!
Then immediately after China signs the "trade deal phase 1" this wuhan virus happens, and US already saying they will bring jobs back and push china harder on phase 2!!!!
Then, on top of everything, bird flu happens in china too, and now chickens are going dead!
The timing is just too suspect, how come India and bunch of other dirty countries that eat bats and whatever never had outbreak?
Then they found out this virus only targets Chinese DNA!
////
"We also noticed that the only Asian donor (male) has a much higher ACE2-expressing cell ratio than white and African American donors (2.50% vs. 0.47% of all cells). This might explain the observation that the new Coronavirus pandemic and previous SARS-Cov pandemic are concentrated in the Asian area." "The result indicates that the ACE2 virus receptor expression is concentrated in a small population of type II alveolar cells (AT2). Surprisingly, we found that this population of ACE2-expressing AT2 also highly expressed many other genes that positively regulating viral reproduction and transmission. A comparison between eight individual samples demonstrated that the Asian male one has an extremely large number of ACE2-expressing cells in the lung.''
https://www.biorxiv.org/content/10.1101/2020.01.26.919985v1.full
Americans of Chinese descent, including those with partial Chinese ancestry constitute 1.5% of the total U.S. population as of 2017.
https://en.wikipedia.org/wiki/Chinese_Americans
Which conspiracy do you like more? Which one is more believable?
Trump Rids Major U.S. Container Port of Chinese Communist Control | Judicial Watch
Tue, 04 Feb 2020 07:58
October 08, 2019 | Judicial WatchUnder a long-term deal sealed by the Obama administration, a Chinese Communist company was set to control the second-busiest container port in the United States. In an unreported Trump administration victory, the Communists are out after a drawn-out national security review forced a unit of China-based COSCO Shipping Holdings Co. (Orient Overseas Container Line'--OOCL) to sell the cherished container terminal business, which handles among the largest freight of imports into the U.S.
It all started with a 40-year container terminal lease between the Port of Long Beach in southern California and Hong Kong. The Obama administration proudly signed the agreement in 2012 giving China control of America's second-largest container port behind the nearby Port of Los Angeles. One of the Trump administration's first big moves was to get the Communists out of the Port of Long Beach. After a national security review and federal intervention, the Long Beach terminal business, which handles millions of containers annually, is finally being sold to an Australian company called Macquarie Infrastructure Partners. That essentially kills China's decades-long contract with the Obama administration.
The deal never should have been signed in the first place considering the facility's size, significance and the national security issues associated with a hostile foreign government controlling it. The southern California port is the premier U.S. gateway for trans-Pacific trade, according to its website, and handles trade valued at more than $194 billion annually. It is one of the few ports that can accommodate the world's largest vessels and serves 140 shipping lines with connections to 217 seaports around the world. The facility encompasses 3,200 acres with 31 miles of waterfront, 10 piers, 62 berths and 68 post-Panamax gantry cranes. In 2018, the Long Beach port handled more than 8 million container units, achieving the busiest year in its history.
Removing Chinese Communists from this essential port is a tremendous feat and a huge victory for U.S. national security. You'd never know it because the media, consumed with the impeachment debacle, has ignored this important achievement. The only coverage of the finalized transfer is found in Long Beach's local newspaper, which published a brief article omitting important background information on the Trump administration's work to take back the terminal from the Communists. The story makes it seem like a regular business transaction in which ''a Chinese state-owned company, reached a deal to sell the terminal, one of the busiest in the port, for $1.78 billion.'' The piece also quotes the Port of Long Beach's deputy executive director saying that the transaction process was intricate and involved one of ''our most valuable port assets.'' Buried at the bottom of the article is a sentence mentioning that the U.S. government, which regulates mergers for antitrust and security reasons, stepped in and required COSCO to sell its rights to the container terminal.
In the last few years China has bought cargo ports throughout the world, including in Latin America, the Indian Ocean and Mediterranean Sea. Chinese-owned ports are located in Greece, Italy, Spain and other European locations. In sub-Saharan Africa there are dozens of existing or planned port projects funded or operated by China, according to a study that highlights the threat the Chinese investments present to U.S. influence in the region. One troubling analysis points out that ''COSCO's commercial expansion has created leverage for Beijing '-- leverage that has already resulted in countries that host COSCO ports adopting China's position on key international issues.''
Iowa Caucus Results Delayed by Apparent App Issue - WSJ
Tue, 04 Feb 2020 07:18
The mobile app that appears to have caused problems during the Iowa presidential caucuses was built by a small Washington, D.C.-based company called Shadow Inc., the tech arm connected to nonprofit progressive digital strategy firm Acronym, according to people familiar with the matter.
State records show that the Iowa Democratic Party paid Shadow a little more than $63,000 over two payments in November and December. Shadow describes itself as a company that builds ''affordable and easy-to-use tools'' for progressives, according to its website.
In a statement, the Iowa Democratic Party said there had been no evidence of a hack of the app. The party hasn't publicly disclosed the identity of the app's creator, a decision that previously prompted alarm from cybersecurity experts.
In a statement late Monday, Acronym distanced itself from Shadow, saying it was one of a number of investors in the company. Acronym also said it was ''reading confirmed reports of Shadow's work with the Iowa Democratic Party on Twitter '' and awaiting more information from the party about what had happened. Last year, Acronym's Chief Executive Tara McGowan said it was launching Shadow as part of an acquisition of a political customer-relationship management tool.
The problems that surfaced Monday deeply frustrated party officials in Iowa, where voting was supposed to have wrapped up hours ago. Some precinct chairs struggled to transmit caucus results, according to people familiar with the situation, both via a mobile app and by a backup telephone system.
The state party said last month that it would record votes from the Iowa caucuses using the smartphone app because they said it would be easier and faster to report results from some 1,700 caucus sites.
The app was intended to help the precinct chairs record the results from each round of voting and take care of the delegate math. Then the precinct chair was supposed to use the app to send the results to the Iowa Democratic Party.
But critics expressed concern about the reliability of the app given security concerns around the 2020 elections. Cybersecurity experts also roundly criticized the Iowa Democratic Party's decision to not identify the app maker publicly or allow it to be subject to open security and reliability testing.
The cybersecurity wing of the Department of Homeland Security recently offered to do some security testing on the app but the Iowa Democratic Party declined the outreach, according to people familiar with the matter. DHS declined to comment on the app, referring questions to the Iowa Democratic Party. After being sent multiple requests for comment, a spokeswoman for the Iowa Democratic Party said that she was checking about this and would circle back.
The state party has defended its plan, with officials saying in January that they were confident in their security systems and that if there were errors, the party would be able to correct them because there would also be paper records of the votes.
Monday's challenges were the latest example of the perils that can result when technology is introduced to the voting process. Though digitized election equipment can often streamline vote tabulation and reporting, it introduces often unforeseen vulnerabilities that can shake public trust in the democratic process'--a concern that has been top of mind for election officials since Russia's interference in the 2016 presidential contest.
Last summer, the Iowa Democratic Party dropped plans to allow voting by phone'--so-called ''virtual caucuses'''--after the party's national committee objected to the proposal due to security concerns.
The apparent app mishap wasn't the first time that the Democratic Party has faced technical issues due to a vendor. In 2018 the party's national committee had to walk back the announcement of a suspected attempt to hack its voter database after it learned the issue was a false alarm set off by a security firm that detected a phishing test built by DigiDems, a volunteer group of technology experts that does work for Democrats.
Problems began surfacing on Monday a few hours before voting started after some precinct chairs said that they had trouble downloading or logging into the app. At the time, the state Democratic Party said the reported issues so far were mainly from areas with poor cell service or involved minor user errors that were being resolved.
The state party also said that precinct chairs could call in the results over a secure phone line, which they had already set up as a backup measure. But Monday night, caucus workers reported that they were stuck on hold, some for over an hour, when they tried to phone in the results.
The state party said that their paper records would allow them to conduct a full recount if needed. They could be called upon to do that now amid the difficulties with reporting the results.
Nevada is currently planning to use a similar mobile app to record results during its caucus later this month. The Nevada State Democratic Party paid $58,000 to Shadow in August, according to Federal Election Commission records. Representatives for the Nevada State Democratic Party didn't immediately respond to requests for comment.
Acronym is led by Ms. McGowan, a Democrat political strategist, and has several related arms, including a political-action committee with a roughly $75 million advertising budget to target voters in swing states.
'--Dustin Volz and Ken Thomas contributed to this article.
Write to Deepa Seetharaman at Deepa.Seetharaman@wsj.com and Emily Glazer at emily.glazer@wsj.com
African students stranded in coronavirus heartland plead with embassies | World news | The Guardian
Tue, 04 Feb 2020 07:18
Thousands of African students in Wuhan, the centre of the coronavirus epidemic, face dwindling food supplies, limited information and lockdowns restricting them to their campuses or hostels.
Two weeks after restrictions on movement were imposed, residents are running short of basic necessities, say students in the central Chinese city.
What is the virus causing illness in Wuhan?
It is a member of the coronavirus family that has never been encountered before. Like other coronaviruses, it has come from animals, or possibly seafood. New and troubling viruses usually originate in animal hosts. Ebola and flu are examples.
What other coronaviruses have there been?
Severe acute respiratory syndrome (Sars) and Middle Eastern respiratory syndrome (Mers) are both caused by coronaviruses that came from animals.
What are the symptoms of the Wuhan coronavirus?
The virus causes pneumonia. Those who have fallen ill are reported to suffer coughs, fever and breathing difficulties. In severe cases there can be organ failure. As this is viral pneumonia, antibiotics are of no use. The antiviral drugs we have against flu will not work. If people are admitted to hospital, they may get support for their lungs and other organs as well as fluids. Recovery will depend on the strength of their immune system. Many of those who have died are known to have been already in poor health.
Is the virus being transmitted from one person to another?
Human to human transmission has been confirmed by China's national health commission. As of 3 February, 361 people have died in China, and one in the Philippines. Confirmed infections in China are 17,238, and the official Chinese figures include Taiwan, Hong Kong and Macau. Outside of China, infections stand at more than 150.
Two members of one family have been confirmed to have the virus in the UK, after more than 160 were tested and found negative. The actual number to have contracted the virus could be far higher as people with mild symptoms may not have been detected. Modelling by World Health Organization (WHO) experts at Imperial College London suggests there could be as many as 100,000 cases, with uncertainty putting the margins between 30,000 and 200,000.
How worried are the experts?
There were fears that the coronavirus might spread more widely during the week-long lunar new year holidays, which start on 24 January, when millions of Chinese travel home to celebrate, but the festivities have largely been cancelled and Wuhan and other Chinese cities are in lockdown.
At what point should you go to the doctor if you have a cough, say?
Unless you have recently travelled to China or been in contact with someone infected with the virus, then you should treat any cough or cold symptoms as normal. The NHS advises that there is generally no need to visit a doctor for a cough unless it is persistent or you are having other symptoms such as chest pain, difficulty breathing or you feel very unwell.
Should we panic?
No. The spread of the virus outside China is worrying but not an unexpected development. It increases the likelihood that the World Health Organization will declare the outbreak to be a public health emergency of international concern on Thursday evening. The key concerns are how transmissible this new coronavirus is between people and what proportion become severely ill and end up in hospital.
Sarah Boseley Health editor and Hannah Devlin
Several people described profound anxiety, insufficient food and a lack of information. Many complained about the lack of assistance received from their own embassies but refrained from criticising Chinese authorities.
There are more than 80,000 African students in China, often attracted by generous government scholarships. About 5,000 are thought to be in Wuhan, where there are scores of further education establishments offering qualifications that are prized in Africa.
A 21-year-old student from Cameroon living in Jingzhou city was reported on Tuesday to be among new cases. He is thought to have contracted the illness on a trip to Wuhan two weeks ago before the lockdown was imposed on the city but is not in any danger, university officials said.
More than 56 students from Malawi, mostly on scholarships, are among those trapped in Wuhan.
Bright Chipao, the president of the Association of Malawians in the city, said the students were desperate. ''There is panic among us as we don't know how long we are going to survive. We are also increasingly running out of foodstuffs,'' he said.
Chipao said the students lacked masks, food and water. Prices had tripled in the city, he said.
Coronavirus casesThe students have asked the Malawian government to airlift them out of the city and return them home, citing the example of other countries in Africa. However Chinese authorities have asked local embassies to tell their citizens not to seek to return home to avoid further spread of the disease.
Many educational establishments have imposed rigorous curbs on students, restricting them to their campuses or hostels. A statement from one colleges read: ''Considering your safety, please stay inside your dormitory during this period '... Most of the materials are in short supply. Please save resources, cherish your life.''
Coronavirus deathsKondwani Chembezi, a Malawian student at Wuhan University of Technology, said he and his roommate had only 2 gallons (9 litres) of water and some food.
He said: ''Wuhan is becoming a death zone each passing day as the numbers of infected persons, as well as death toll, keep rising. There's a great atmosphere of panic and despair as others have been repatriated to their nations, yet others remain here trying to survive this unpredictable period.
''Going [to buy things] is a grave personal risk as no one knows who has been exposed to the virus '' anyone can be a carrier. Prices of commodities have really gone high '' three or more times the usual price. It's a hustle to actually buy what you need as the demand is also high.''
A Kenyan postgraduate student who has been in Wuhan for five years said the biggest problems were a shortage of reliable information and of food.
He said: ''The worst part about it all is not knowing what is going on because all the information we are getting is from online sources or from friends from other universities '... We have been forced to have one meal a day.
''Our institute gave us some rice, milk, oil and some vegetables but advises we also use them sparingly because when they are over we might not [be able] to get more.''
Many students contacted by the Guardian were reluctant to talk or be named, as they feared expulsion or other sanctions.
A Ugandan doctor in Shanghai said she and her colleagues felt better on Monday after a ''worrying weekend''.
''We're wearing our masks, washing our hands and avoiding crowded places,'' she said. ''But most importantly we're trying to be positive and not live in constant fear and panic.''
Additional reporting by April Zhu in Nairobi
Introducing Shadow Inc: Shining a Light on Political Data
Tue, 04 Feb 2020 00:53
Since we initially announced our acquisition by ACRONYM earlier this year, Shadow has been hard at work to publicly launch and bring you new tools to help progressive campaigns and causes win up and down the ballot. That's why we're excited to share two big announcements today:
In January I wrote about the challenges in moving data around our political tech ecosystem. It's harder than it needs to be, which means that campaign staff are doing busy work like data entry when we should instead be out talking to voters or recruiting volunteers. That's why we're excited to announce that we've been building an unprecedented piece of infrastructure for the progressive movement: Lightrail.
Lightrail is the universal adapter for progressive political data. It makes it easy for you to move data from tool to tool and back to your data warehouse so that you can get your data where it needs to go without having to know Python or SQL.
We call these connections between tools ''pipelines'' and we started by focusing on one pipeline that we know is especially complicated but especially important: syncing ActBlue donations and contributors to BigQuery. Getting data about small-dollar contributions and donors has never been more urgent than right now, but the mechanics of actually doing that are complicated enough that most campaigns and organizations won't take on the task of doing it themselves. That's where Lighrail comes in! We let you easily connect your ActBlue and BigQuery accounts and then handle the rest.
Over the summer we'll be releasing more connections and more pipelines, like BSD Tools, VAN, MobilizeAmerica, Redshift, and more, but if you're interested in getting started with Lightrail today, let us know!
Our goal is to make tools that empower organizers and advocates to do what they are already doing but faster, easier, and in a way that makes it simple to scale their impact. We know that peer-to-peer SMS is only one tool that organizers use to communicate with their people and in some cases it may not be the most cost-effective way to organize. So we're adding a new tool to our peer-to-peer messaging suite: peer-to-peer email.
Isn't all email kind of peer-to-peer? Well, right now email tools are either focused on sending a single email at a time (like Gmail) or impersonal email blasts to people who have opted-into your email list. But campaign organizers need something that exists in the middle of those two things: peer-to-peer email.
This new email tool lets organizers send email from their own email address that's templated to a list synced or uploaded to our tool. Replies go directly to the organizer's inbox where they're managed like any other email, but data about the initial send is tracked (bounce rates, open rates, clickthrough rates) and can be synced into VAN so you can see directly in your CRM who received the mail.
We think that this will be an extremely powerful tool to help with volunteer recruitment and retention, event management and shifting, as well as small-scale fundraising. But we're most excited to get it into your hands and see what you do with it, so hit us up if you're interested in giving it a try.
Our peer-to-peer email tool will be available alongside our existing peer-to-peer SMS tool in one place and under one umbrella: Shadow Messaging. That's right, Groundbase users / die-hards, we're changing the name as well as the look and feel. Current Groundbase users will automatically be moved over to Shadow Messaging and will automatically have access to peer-to-peer email by default.
If you're interested in using any of our tools, drop us a line at hello@shadowinc.io, or visit our website. We'd love to hear from you!
Shadow Inc
Tue, 04 Feb 2020 00:34
LightrailMessagingAboutSign InWe are campaign and technology veterans who have built and implemented technology at Hillary for America, Obama for America, Google, Kiva, Apple, the AFL-CIO, and the DNC.
Our passion is to create a permanent advantage for progressive campaigns'¨ and causes through technology.
When a light is shining, Shadows are a constant companion. We see ourselves as building a long-term, side-by-side ''Shadow'' of tech infrastructure to the Democratic Party and the progressive community at large.
Hedge Fund Billionaires Power New Democratic Super PAC '' Eyes on the Ties
Tue, 04 Feb 2020 00:10
Seth Klarman (center) at the 2017 Preakness Stakes in Maryland. Klarman's horse, Cloud Computing, won the race. (Image: 142nd Preakness Stakes Pimlico Race Course via Wikipedia Commons)
This article was produced by Sludge, an independent, ad-free investigative news site covering money in politics. Click here to support Sludge.
A new super PAC that says it will spend $75 million to support Democrats in 2020 is funded in large part by billionaires who run hedge funds, including some with a history of supporting Republicans, according to recent filings with the Federal Election Commission.
Pacronym, a super PAC affiliated with the ''dark money'' nonprofit Acronym, disclosed its fundraising and spending information for the first time on Wednesday night. In the final quarter of 2019, the group raised more than $7.7 million from dozens of donors, including four who gave $1 million or more.
The group's top donor is Seth Klarman, the billionaire and former GOP megadonor who is CEO of Baupost Group, a Boston-based hedge fund whose investments include liquid natural gas companies Cheniere Energy and Antero Resources. Klarman gave Pacronym $1.5 million on Dec. 27, 2019, according to the group's year-end FEC filing.
In the recent past, Klarman gave his money to groups that worked to elect Republicans. He gave $300,000 in 2014 to Karl Rove's American Crossroads super PAC, which spent more than $17 million that year on ads and other expenditures opposing Democrats. It spent the most that year on ads attacking Democratic Sen. Mark Begich of Alaska in his ''toss up'' race against Republican Dan Sullivan, who ended up winning. In 2016, the group made independent expenditures opposing Hillary Clinton in her race against President Trump.
Klarman has also donated to the Congressional Leadership Fund, which is a super PAC that is closely aligned with Republican House leadership, as well as to a super PAC called Ending Spending that is affiliated with a group focused on shrinking the federal budget.
After the 2016 election, Klarman began supporting Democratic efforts to take control of Congress and defeat Trump. A Sludge review of FEC records shows that he has given maximum contributions to the campaigns of Democratic presidential candidates Pete Buttigieg, Amy Klobuchar, and John Delaney.
Several policies that financial reform advocates have called for would negatively impact the financial industries tied to big Democratic donors. A proposal to close the carried interest loophole that provides a tax break to partners at private equity and hedge funds could directly hit Klarman. A May 2018 report by Public Citizen wrote that super PAC donations to both parties block policies with overwhelming public support such as addressing inequality, establishing a wealth tax, and strengthening white collar law enforcement.
Another hedge-fund billionaire backing Pacronym is Donald Sussman, the founder and chief investment officer of hedge fund Paloma Partners. Sussman, who gave the group $1 million in November, is a prolific Democratic donor. In 2018, Sussman gave more than $6 million to Senate Majority PAC, a super PAC that spends millions to support Democrats in competitive Senate races.
Sussman has not made campaign contributions to any of the Democratic presidential candidates, but he has made donations to a wide range of House and Senate races, including centrists like American Legislative Exchange Council alumnus Rep. Tom O'Halleran (D-Ariz.) and recent party flipper Rep. Jeff Van Drew (R-N.J.), as well as progressives like Marie Newman who is mounting a primary against centrist Rep. Dan Lipinski (D-Ill.).
In September 2019, Sussman's daughter, Emily Tisch Sussman, said on MSNBC that Democratic primary voters who support Sen. Bernie Sanders (D-Vt.) over Sen. Elizabeth Warren (D-Mass.) are sexist.
Pacronym and its affiliated nonprofit are not backing a Democratic presidential candidate at this point in the race. Instead, the group has been spending millions on anti-Trump ads targeting swing voters in key states. On its website the groups says its ad spending ''relies on cutting-edge, real-time message testing and measurement to optimize content and drive results.''
The group is run by Tara McGowan, a former press secretary for Sen. Jack Reed (D-R.I.) and digital producer for Obama's 2012 campaign. David Plouffe, President Obama's former campaign manager, is on the group's board.
Other Pacronym donors the group disclosed yesterday include Michael Moritz, partner at venture investment fund Sequoia Capital ($1 million); Kenneth Duda, founder and chief technology office at software company Arista ($1 million); Mimi Haas, director of Levi Strauss & Co. ($600,000); filmmaker Steven Spielberg ($500,000); and Jim Swartz, co-founder of venture firm Accel Partners ($400,000).
Lee Fang on Twitter: "Nevada Dem federal account paid Shadow $58k in August, Iowa Dems state account paid Shadow $63,183 in two payments over Nov & Dec, suggesting app wasn't developed until just months ago? Both caucus states. Shadow is a spin-off fr
Tue, 04 Feb 2020 00:06
Lee Fang @ lhfang
53m Three different sources say a firm called "Shadow" developed the Iowa Dem caucus app. They haven't responded to comment, neither has Iowa Dem Party. The firm was paid by both Nevada & Iowa Democratic Party, disclosures show. Also by Mayor Pete's campaign.
View details · @ lhfang Replying to @lhfang Nevada Dem federal account paid Shadow $58k in August, Iowa Dems state account paid Shadow $63,183 in two payments over Nov & Dec, suggesting app wasn't developed until just months ago? Both caucus states. Shadow is a spin-off from PACRONYM, a new Dem dark money/superPAC hybrid.
Lee Fang @ lhfang
41m There's no evidence Robby Mook was involved in the development of this app. David Plouffe, however, is on the board of PACRONYM and has been on cable news talking about the Iowa caucus all evening. Worth a question for him.
View conversation · Lee Fang @ lhfang
2m Kind of crazy only one current presidential campaign, Pete Buttigieg, pays the technology company that builds the app to count the caucus votes. It's a glaring appearance of conflict of interest.
View conversation ·
Iowa caucus: Lack of information about voting app stirs hacking, legitimacy concerns | Fortune
Mon, 03 Feb 2020 23:59
(C) 2019 Fortune Media IP Limited. All Rights Reserved. Use of this site constitutes acceptance of our Terms of Use and Privacy Policy (Your California Privacy Rights).Fortune may receive compensation for some links to products and services on this website. Offers may be subject to change without notice.Quotes delayed at least 15 minutes. Market data provided by Interactive Data. ETF and Mutual Fund data provided by Morningstar, Inc. Dow Jones Terms & Conditions: http://www.djindexes.com/mdsidx/html/tandc/indexestandcs.html.S&P Index data is the property of Chicago Mercantile Exchange Inc. and its licensors. All rights reserved. Terms & Conditions. Powered and implemented by Interactive Data Managed Solutions. | EU Data Subject Requests
J. Lo's Stripper Routine Was Not 'Empowering' | National Review
Mon, 03 Feb 2020 23:39
Jennifer Lopez performs during the Super Bowl halftime show. February 2,2020(Shannon Stapleton/Reuters)
At a press conference last week, Jennifer Lopez was asked about the prospect of being one of the two stars of the Super Bowl halftime show, billed as the first time two Latinas would do such a concert together. Lopez replied, ''That statement alone to me is empowering. When I think of my daughter, when I think of all the little girls in the world, to be able to have that, to see that two Latinas are doing this in this country at this time, it's just very empowering for us.''
Given the character of Miami, where the game was played, it makes sense for Latinas to perform in the Super Bowl halftime show, but let's not mistake Lopez and Shakira's double-booty shake as a feminist breakthrough. Lopez and Shakira wore Vegas showgirl costumes and Lopez cavorted around a stripper pole. I would not expect either of them to come out on stage in a tweed jacket and recite Shakespeare's sonnets, and I'm sure each of them cashed a large paycheck for their gyrations, but let's at least be honest about the meretricious nature of what the show was. It was pure self-objectification, flaunting feminine sexual appeal for the purpose of titillation. Everybody's got to make a living, but some careers are more worthy of respect than others.
To me, an excellent test for whether something is ''empowering'' for women is the following question: Is this the best you can picture for your daughter? Daughter as astronaut, daughter as president, daughter as physicist: empowering. Daughter as stripper: not so empowering.
Democrats' Iowa Caucus Voting App Stirs Security Concerns - WSJ
Mon, 03 Feb 2020 23:33
Democrats will record the votes from the Iowa presidential caucuses in just over a week using a smartphone app, a procedure that has stirred questions about security.
Party leaders said that the mobile app would make it easier and faster to report results from some 1,700 caucus sites. But critics expressed concern about the reliability of the app amid warnings that cyber adversaries could seek to disrupt the 2020 elections.
Douglas Jones, an associate professor of computer science at the University of Iowa, who has studied election security, called the idea a ''security nightmare,'' and said that cellphones were difficult to protect against the range of possible threats.
The caucus workers will use the app on their personal smartphones, which Mr. Jones said could be vulnerable, depending on how well the workers take care of their devices.
Iowa Democratic Party Chairman Troy Price defended the plan. ''We are confident in the security systems we have in place,'' he said.
If there were any errors due to the app, the party would be able to correct them because the caucus workers also would keep paper records of the votes, a state party official said. In addition, caucus chairs would have the option of calling in the results through a secure hotline.
The Iowa Democratic Party has declined to disclose some details about the app, such as the vendor that made it, saying that doing so could inadvertently help potential cyber attackers.
Some security experts took issue with that approach. ''The argument the party is using is effective at preventing public oversight, but it's not effective at protecting against'' cyber threats, said Mr. Jones, the election-security expert.
In Iowa, multiple caucus organizers said in interviews that they liked the app because it was convenient.
Catherine Crist, who expects that she will have to count roughly 400 voters at her caucus site next week as a precinct chair in Iowa's Linn County, said the app would be a big help.
Ms. Crist, a longtime Democratic organizer, said that she was confident about the system and that fears about hacking were overblown. ''People are making much ado about nothing,'' she said.
Glenn Hurst, a Democratic caucus organizer in Minden, Iowa'--whose population is around 600'--said he expected the app would make it easier to transmit the results from his rural site.
But he doesn't think he needs it. ''I'm pretty confident in my ability to do the math,'' said Mr. Hurst, a family-medicine doctor.
It isn't the first time for a caucus app. Both Democrats and Republicans in Iowa used an app from Microsoft Corp. in 2016. The company said it helped the parties report 95% of their precinct results in about four hours.
A spokesman for Microsoft said that the company had a good experience with the Iowa caucuses but was focusing this election cycle on helping secure campaigns and other election security efforts.
This isn't the only tech-related controversy for the Democratic Iowa caucuses this election cycle. The state party initially sought to allow some phone voting through so-called virtual caucuses, but the Democratic National Committee blocked the plan over security concerns.
The DNC says the state party has worked with it on security measures, along with the Department of Homeland Security and experts from Harvard University's Belfer Center for Science and International Affairs.
DHS senior adviser on election security Matt Masterson said that the department has collaborated with both the Democratic and Republican parties to protect the 2020 elections.
Issues with smartphone app could delay Iowa caucus results
Mon, 03 Feb 2020 23:31
February 3, 2020 | 4:59pm
Enlarge Image Voters sign in before the Iowa caucus in 2016. Getty Images
Issues with the new smartphone app for reporting the results of the crucial Iowa Democratic caucus could delay the count of the votes tonight in the bellwether contest.
Precinct chairs across the Hawkeye State experienced problems downloading or logging into the app, one of the ways they're able to send the results from their smaller, individual caucuses to the Iowa Democratic Party, according to Bloomberg News.
''We are experiencing some issues in terms of people being able to load and connect with the app for their precinct reporting,'' Bret Nilles, the chairman of the Linn County Democratic Party, told the outlet.
The chairs can still relay their results to the state party via a call-in phone number, but the app was intended to expedite the tallying.
A potential logjam created by party chairs calling the hotline could delay the results by a few hours, according to Bloomberg, but a spokeswoman for the IDP said that they aren't concerned by the snafu.
''The IDP is working with any precinct chairs who want to use the optional tabulation application to make sure they are comfortable with it,'' said Mandy McClure in a statement. ''We've always been aware that many precinct chairs prefer to call in results via a secure hotline, and have systems in place so they can do so.''
Vermont Sen. Bernie Sanders heads into the nominating contest with a slim lead in the state poll over former Vice President Joe Biden.
Robby Mook - Wikipedia
Mon, 03 Feb 2020 23:11
Robert E. Mook (; born December 3, 1979) is an American former political campaign strategist and campaign manager. He was the campaign manager for Hillary Clinton's unsuccessful 2016 presidential campaign. He is currently a CNN political commentator.
Mook worked on state campaigns, leading up to Howard Dean's 2004 presidential campaign. Mook then joined the Democratic National Committee, and worked for Clinton's 2008 presidential campaign as a state director in three states.
Mook managed Senator Jeanne Shaheen's campaign as she ran in New Hampshire for election to the U.S. Senate in fall 2008, served as the executive director of the Democratic Congressional Campaign Committee in 2012, and was the campaign manager for Terry McAuliffe's successful 2013 gubernatorial campaign.
In the wake of the 2016 U.S. presidential election, Mook drew criticism for his campaign strategy and tactics, specifically his reliance on data analytics despite advice from campaign teams in battleground states.[1]
Early life Edit Mook was born in Sharon, Vermont, the son of Kathryn and Delo Mook, and was raised in nearby Norwich, across the river from Hanover, New Hampshire.[2] His father was a physics professor at Dartmouth College in Hanover, and his mother was a hospital administrator at Dartmouth''Hitchcock Medical Center, in nearby Lebanon, New Hampshire.[3][4] Both are now retired.[citation needed ]
Mook attended Hanover High School, where Matt Dunne, a member of the Vermont House of Representatives, served as the theater director. Dunne met Mook when he auditioned for a school play, and Mook volunteered for Dunne's re-election campaign.[3][4] Mook graduated from Columbia University in 2002 with a Bachelor of Arts in Classics.[4][5][6] Mook also served in the United States Senate Page program.[3]
Career Edit Political campaigns Edit During the summer after Mook's freshman year at Columbia, Dunne hired Mook as the first paid staffer for the Vermont Democratic House Campaign, working to elect Democrats to the Vermont House.[3][6] Mook worked as a field director during the 2002 Vermont gubernatorial election, which the Democrats lost. He served as deputy field director during Dean's 2004 presidential campaign in Wisconsin and New Hampshire. He joined the Democratic National Committee after Dean lost the nomination to John Kerry, serving as director of the get out the vote effort in Wisconsin during the general election. He worked for David W. Marsden, managing a campaign that lost a Republican-held seat in the Virginia House of Delegates in 2005. In 2006, he coordinated the campaigns of Martin O'Malley, who defeated incumbent Bob Ehrlich in the Maryland gubernatorial election, and Ben Cardin, who defeated Michael Steele to win the United States Senate election.[4]
Hillary Clinton presidential campaign, 2008 Edit Mook joined Hillary Clinton's 2008 presidential campaign in 2007. He served as the campaign's state director for Nevada, Indiana, and Ohio. Clinton won the popular vote in all three states. Mook then managed Jeanne Shaheen's successful campaign for the United States Senate that fall.[4][7] Mook joined the Democratic Congressional Campaign Committee (DCCC) in 2009 as their political director, and was named independent expenditure director of the DCCC in May 2010.[8] After the 2010 House of Representatives elections, where the Democrats lost the majority, Mook was named executive director.[9] In the 2012 House of Representatives elections, he aided the Democrats in gaining eight seats,[7] though Democrats had aimed for the 25 seats needed to retake the majority.[6]
Terry McAuliffe Edit In 2013, Mook left the DCCC and was named the campaign manager of Terry McAuliffe's gubernatorial campaign.[5][7] That year, Politico named Mook one of their "50 Politicos to Watch."[10] Mook led McAuliffe's campaign to victory.[11] He worked for McAuliffe's political action committee as well as the Virginia Progress PAC, helping in the reelection campaign of Senator Mark Warner in 2014.[12]
Hillary Clinton presidential campaign, 2016 Edit In January 2015, Clinton hired Mook and Joel Benenson as strategists.[13] Upon the April 2015 announcement of Clinton's 2016 campaign for president, Mook was introduced as Clinton's campaign manager.[14][15] In 2015, Mook was paid by the campaign at an annual rate of $121,000, which is somewhat lower than other presidential campaign managers and similar to that of other top Clinton staffers (such as communication director Jennifer Palmieri, finance director Dennis Cheng, and national political director Amanda Renteria).[16] According to the Washington Post, as Clinton's campaign manager Mook won praise "both inside the campaign and among Clinton's vast circle of second-guessers, for the airtight and drama-free campaign he has built."[17] A group of about 150 young political operatives close to Mook became known as the "Mook Mafia."[17][18]
Mook was the one who negotiated with Bernie Sanders' campaign and won support for Clinton.[19]
During the campaign, Donna Brazile commented on Mook's micro-tagging of voters based on purchasing preferences and how it "missed the big picture".[20]
In the aftermath of the campaign, former staffers and political pundits criticized Mook for actions taken during the campaign. In particular, they faulted what they considered his excessive focus on data analytics, while neglecting feedback from campaign teams in battleground states.[21][1]
Aftermath Edit In 2017, in response to Russia's interference in the 2016 presidential election Mook, together with Matt Rhoades, started the "Defending Digital Democracy" initiative at the Belfer Center for Science and International Affairs at the Harvard Kennedy School.[22]
In January 2017, Leading Authorities, a Washington, D.C.''based speaker's bureau, falsely announced that Mook had teamed with Trump campaign manager Corey Lewandowski to offer insights into the 2016 race. After Mook and Lewandowski questioned the announcement, Leading Authorities released a statement[23] saying that the partnership was a marketing strategy that had not been approved by Mook or Lewandowski. Mook fired the firm as a result.[24]
Personal life Edit Mook was the first openly gay manager of a major presidential campaign.[25][26] In September 2017, Mook was announced as Harvard Institute of Politics' 2017''2018 Visiting Fellow.[27][28]
References Edit ^ a b Kakutani, Michiko (April 17, 2017). " ' Shattered' Charts Hillary Clinton's Course Into the Iceberg". New York Times. New York City: New York Times Company . Retrieved February 20, 2019 . As described in Shattered, Clinton's campaign manager, Robby Mook '-- who centered the Clinton operation on data analytics (information about voters, given to him by number crunchers) as opposed to more old-fashioned methods of polling, knocking on doors and trying to persuade undecideds '-- made one strategic mistake after another, but was kept on by Clinton, despite her own misgivings. ^ Hongoltz, Matt (January 31, 2016). "Hanover '-- Sitting in front of the Christmas tree in the living room Friday evening, among the plates of baguettes". Vnews.com . Retrieved May 17, 2017 . ^ a b c d Heintz, Paul (September 18, 2013). "Take Back Virginia? Old Dominion Dems Are Counting on Vermont-Born Robby Mook". Seven Days . Retrieved October 4, 2013 . ^ a b c d e Gonzales, Nathan L. (August 2, 2010). "DCCC Turns to Mook's Ground Game for Fall". The Rothenberg Political Report . Retrieved October 3, 2013 . ^ a b "Robby Mook". The Washington Post. September 26, 2013 . Retrieved October 3, 2013 . ^ a b c "Political Strategist". Columbia College Today . Retrieved April 13, 2015 . ^ a b c Hunt, Albert R. (July 14, 2013). "Virginia Campaign Could Lift Strategist to Stardom". The New York Times . Retrieved October 4, 2013 . ^ Cillizza, Chris (May 10, 2010). "The Fix '' House Democrats expand 2010 campaign team". Washington Post . Retrieved October 4, 2013 . ^ Bentz, Leslie (December 6, 2010). "DCCC names Robby Mook as executive director". CNN.com . Retrieved October 3, 2013 . ^ Burns, Alexander (July 19, 2013). "50 Politicos to Watch: Robby Mook". Politico. Arlington County, Virginia: Capitol News Company . Retrieved January 7, 2015 . ^ Allen, Jonathan (December 22, 2014). "The Man Poised to Guide Hillary Clinton's Presidential Campaign". Bloomberg. New York City . Retrieved January 7, 2015 . ^ Evans, Garrett (January 8, 2015). "Favorite emerges for Clinton campaign". TheHill. Washington, DC: Capitol Hill Publishing Corp . Retrieved February 12, 2018 . ^ Haberman, Maggie (January 7, 2015). "Hillary Clinton brings in Robby Mook, Joel Benenson for likely teame". Politico. Arlington County, Virginia: Capitol News Company . Retrieved January 7, 2015 . ^ Karni, Annie (April 12, 2015). "Hillary Clinton formally announces 2016 run". Politico. Arlington County, Virginia: Capitol News Company . Retrieved April 13, 2015 . ^ Helmore, Edward (April 11, 2015). "Can the geek who hates the spotlight guide Hillary to the White House?". The Guardian. London, England: Guardian Media Group . Retrieved April 12, 2015 . ^ Meyer, Theodoric (July 16, 2015). "Rubio's campaign manager tops early salary list". Politico. Arlington County, Virginia: Capitol News Company . Retrieved April 30, 2018 . ^ a b Tumulty, Karen (February 19, 2016). "In Nevada, Clinton's campaign manager faces his biggest test". Washington Post. Washington DC: Nash Holdings LLC . Retrieved April 30, 2018 . ^ Blake, Aaron (November 14, 2014). "The Hillary 2016 campaign infighting begins even before the Hillary 2016 campaign begins". Washington Post. Washington DC: Nash Holdings LLC . Retrieved April 30, 2018 . ^ Graphics, WSJ.com News. "Robby Mook, campaign manager | Election 2016: Hillary Clinton's Inner Circle". The Wall Street Journal . Retrieved February 24, 2018 . ^ Brazile, Donna (2017). Hacks : the inside story of the break-ins and breakdowns that put Donald Trump in the White House. New York City: Hachette Books. pp. 54''55, 86. ISBN 9780316478519. OCLC 1007319949. ^ Dovere, Edward-Isaac (December 14, 2016). "How Clinton lost Michigan '-- and blew the election". Politico. Arlington County, Virginia: Capitol News Company . Retrieved February 20, 2019 . The anecdotes are different but the narrative is the same across battlegrounds, where Democratic operatives lament a one-size-fits-all approach drawn entirely from pre-selected data '-- operatives spit out ''the model, the model,'' as they complain about it '-- guiding Mook's decisions on field, television, everything else. ^ Nakashima, Ellen (July 18, 2017). "Former Clinton and Romney campaign chiefs join forces to fight election hacking". Washington Post. Washington DC: Nash Holdings LLC. ISSN 0190-8286 . Retrieved February 24, 2018 . ^ Nelson, Louis (January 25, 2017). "Agency that advertised joint Mook, Lewandowski speaking engagements pulls web page down". Politico. Arlington County, Virginia: Capitol News Company . Retrieved March 19, 2017 . ^ Sherman, Jake (January 27, 2017). "MOOK DITCHES LEADING AUTHORITIES". Politico. Arlington County, Virginia: Capitol News Company . Retrieved January 27, 2017 . ^ Kroll, Andy; Caldwell, Patrick (April 9, 2015). "Robby Mook just took the hardest job in politics: saving the Clintons from themselves". Mother Jones. San Francisco, California: Foundation for National Progress . Retrieved April 13, 2015 . ^ McDonald, James (April 20, 2015). "Five Things We Know About Robby Mook, Hillary Clinton's Openly Gay Campaign Manager". Out Magazine. San Francisco, California: Here Media . Retrieved July 3, 2015 . ^ ''What is a visiting fellow at Harvard's Institute of Politics?'' ''Boston Globe'', September 15, 2017 ^ Harvard IOP listing for Robby Mook External links Edit Appearances on C-SPAN
David Wohl on Twitter: "BREAKING: The guy who designed the failing #IowaCaucuses app? Robbie Mook, campaign manager for @BernieSanders arch-enemy, Crooked Hillary Clinton! Nothing here folks, move along. ðŸ‚ðŸ‚" / Twitter
Mon, 03 Feb 2020 23:10
BREAKING: The guy who designed the failing
#IowaCaucuses app?Robbie Mook, campaign manager for
@BernieSanders arch-enemy, Crooked Hillary Clinton!Nothing here folks, move along.ðŸ‚ðŸ‚
An app used to report the results of the Iowa caucus has failed spectacularly '' TechCrunch
Mon, 03 Feb 2020 23:09
Image Credits: Brendan Hoffman / Getty Images
A smartphone app designed to send the results of the Iowa caucus has crashed, delaying the result of the first major count in nominating a Democratic candidate to run for the U.S. presidency.
The result of the Iowa caucus was due to be transmitted by smartphone apps from delegates across the state on Monday, but a ''quality control'' issue was detected shortly before the result was expected.
''We found inconsistencies in the reporting of three sets of results,'' said Mandy McClure, a spokesperson for the Iowa Democrats.
''In addition to the tech systems being used to tabulate results, we are also using photos of results and a paper trail to value that all results match and ensure that we have confidence and accuracy in the numbers we report,'' said McClure, saying this was ''not a hack or an intrusion.''
''The underlying data and paper trail is sound and will simply take time to further report the results,'' she said.
Some reports say that the result may not be called before Tuesday.
A report by NPR in January said the smartphone app was designed to save time, but bucked the trend in the use of smartphones in the voting process during a time where there are concerns that voting machines and other election infrastructure are feared vulnerable to hackers. Security concerns were raised about the app, whose developer has not yet been named nor its security practices, fearing that doing so would help hackers break into the system.
But the app was reportedly described as buggy and problematic by official hours before the final results were due to be called.
Screenshots in tweets seen by TechCrunch, but have since been deleted, showed problems with the app as early as 6pm local time.
One of the precinct chairs in Shelby County said they would call in her results instead.
Iowa is an important first round of votes to nominate a Democratic candidate for the presidency. The final candidate will be chosen later this year to run against presumed Republican candidate, President Donald Trump.
Voco - privacy friendly voice control
Mon, 03 Feb 2020 22:49
Why you should care about privacy friendly voice control . Controlling your home with your voice is a wonderful thing. Having companies listen in is not.
Your voice is being fingerprinted
'Œ Your voice is as unique as your fingerprint. Every time you speak near a cloud connected microphone, you could be sharing your presence.
Do the friends, family and other people who visit your home consent to having their voice recorded?
Your voice paints a picture
Cloud-based voice control systems can learn more from your voice than you may realise. Algorithms will try to infer your mood, health, how your relationship is doing, and much more.
W'Œith Candle you can speak freely Candle's voice control happens completely locally.
No trackingYour voice and your behavioural patterns never leave your home.
Turn off the microphoneDisable it any time, or unplug the microphone!
All the popular featuresSet timers and reminders, toggle devices and ask for their data.
Machine learningLocal machine learning makes voice recognition flexible and fast.
1. Connect the microphone and speaker But the Playstation Eye webcam online, and plug it into one of the Candle controller's USB ports. Tape over the camera, which we won't be using.Plug in any normal speaker into the Candle Controller's headphone jack.
2. Install the Voco add-on
Get an authorization token
'Œ Go to settings > developer > create local authorization
To allow the Voco addon to toggle your devices you will need to create a security code. Copy the token, which is a long line of random letters.
E'Œnter the authorization code in the Voco add-on's settting page
Go to settings > add-ons
Install the Voco addon, wait a minute to let it install, then open its configuration page. C'Œopy the authorization code into the Authorizaton token field. While you're here, change the time zone to the correct one. Then hit save.
Try it! Say "Hey Snips", followed by:
Remind me to go to the gym in 1 hour Passionate team members
Turn on the kitchen light for 5 minutes 'Œ
S'Œet the station of the radio to Fip 'Œ
Set a countdown for 30 seconds 'Œ
S'Œet the volume level of Snips to 95 'Œ
Is the front door locked? 'Œ
Hey Snips, say goodbye to Alexa!
Facebook's Platform Opportunity '' Stratechery by Ben Thompson
Mon, 03 Feb 2020 18:43
George Soros is famous for his timing.
In 1992 Soros built a massive short position in pound sterling, betting that the United Kingdom had entered European Exchange Rate Mechanism (ERM) at an unsustainably high rate, particularly given British inflation and interest rates relative to Germany; when the pound fell below the minimum level allowed by the ERM, Soros pounced, selling so much sterling that the government could not prop up the currency. The United Kingdom withdrew from the ERM, the pound plummeted, and Soros pocketed over £1 billion in profit.
That, though, was then; last week Soros penned an opinion column in the New York Times that basically stated that Facebook CEO Mark Zuckerberg was actively working to re-elect President Trump. Much of it reads like a conspiracy theory '-- and the part on Section 230 is so mistaken it is, ironically enough, bordering on disinformation '-- but what was particularly striking was how poor the timing was; Soros concluded:
I repeat and reaffirm my accusation against Facebook under the leadership of Mr. Zuckerberg and Ms. Sandberg. They follow only one guiding principle: maximize profits irrespective of the consequences. One way or another, they should not be left in control of Facebook.
In fact, Facebook reported its financial results two days before Soros' op-ed, and the stock lost 10% of its value. The general consensus was concern about the ongoing slowdown in profit growth, which decelerated even more last quarter '-- traditionally the quarter with the most growth:
The issue is costs, which have outgrown revenue for each of the last seven quarters:
To be perfectly honest, the slowdown in revenue growth was just as likely to be a factor in the stock's slide, especially because Facebook's costs have been growing so rapidly. Whatever the cause, if Zuckerberg's only guiding principle is maximizing profits, he is extremely bad at it.
Facebook's Security InvestmentsThe fact of the matter is that Facebook, more than any other tech company, has put its money where its mouth is as far as security is concerned. Zuckerberg said on the company's Q3 2017 earnings call:
I've directed our teams to invest so much in security on top of the other investments we're making that it will significantly impact our profitability going forward, and I wanted our investors to hear that directly from me. I believe this will make our society stronger, and in doing so will be good for all of us over the long term. But I want to be clear about what our priority is. Protecting our community is more important than maximizing our profits.
Nine months later was when the growth rate of Facebook's costs exceeded the growth rate of the company's revenues for the first time, leading to the largest one-day loss by any company in U.S. stock market history; CFO Dave Wehner said on that 2Q 2018 earnings call:
Turning now to expenses; we continue to expect that full-year 2018 total expenses will grow in the range of 50% to 60% compared to last year'...Looking beyond 2018, we anticipate that total expense growth will exceed revenue growth in 2019. Over the next several years, we would anticipate that our operating margins will trend towards the mid-30s on a percentage basis.
That is exactly what has happened.1 Facebook has spent on security (i.e. more people) more quickly than it has increased revenue '-- and it has increased revenue quite a bit! Vice President Andrew Bosworth expressed confidence in an internal memo2 that the money will prove to be well-spent; after noting that the role of foreign interference and misinformation on Facebook was extremely small relative to the content people saw over the last election cycle (a fair thing to note), Bosworth wrote:
Most of the information floating around that is widely believed isn't accurate. But who cares? It is certainly true that we should have been more mindful of the role both paid and organic content played in democracy and been more protective of it. On foreign interference, Facebook has made material progress and while we may never be able to fully eliminate it I don't expect it to be a major issue for 2020.
Misinformation was also real and related but not the same as Russian interference. The Russians may have used misinformation alongside real partisan messaging in their campaigns, but the primary source of misinformation was economically motivated. People with no political interest whatsoever realized they could drive traffic to ad-laden websites by creating fake headlines and did so to make money. These might be more adequately described as hoaxes that play on confirmation bias or conspiracy theory. In my opinion this is another area where the criticism is merited. This is also an area where we have made dramatic progress and don't expect it to be a major issue for 2020.
Bosworth went on to note that President Trump ran a far superior digital advertising operation last campaign,3 and that he is worried that he will win in 2020 by doing the same. It is an admittedly self-serving but still crucial point to make: the effectiveness of Facebook's expenditures should be based on the extent of illicit activity on Facebook, not the results of the next presidential election.
That, of course, is unlikely to happen, particularly if President Trump does indeed win re-election: Facebook will be almost certainly be held responsible because they are the easiest target, even if there is no meaningful foreign interference or disinformation campaigns. Critics will point to the company's refusal to fact-check politicians, even if it is right on principle, and all of those expenses won't make up for it.
Again, how is this profit-maximizing? If anything this is an argument for founder control: Facebook is spending billions of dollars and taking regular hits in the stock market for something they will almost certainly get no credit for, primarily because Zuckerberg believes it is the right thing to do.
That noted, Zuckerberg may not be entirely altruistic.
Facebook's Missing PlatformAt the beginning of the year I wrote The End of the Beginning, where I posited that the current tech giants would likely be dominant for some time to come:
There may not be a significant paradigm shift on the horizon, nor the associated generational change that goes with it. And, to the extent there are evolutions, it really does seem like the incumbents have insurmountable advantages: the hyperscalers in the cloud are best placed to handle the torrent of data from the Internet of Things, while new I/O devices like augmented reality, wearables, or voice are natural extensions of the phone.
In other words, today's cloud and mobile companies '-- Amazon, Microsoft, Apple, and Google '-- may very well be the GM, Ford, and Chrysler of the 21st century. The beginning era of technology, where new challengers were started every year, has come to an end; however, that does not mean the impact of technology is somehow diminished: it in fact means the impact is only getting started.
Careful readers would have noted that I left out one of the tech giants '-- Facebook. The reason is straightforward: Facebook isn't a platform, but rather an Aggregator. I explained the differences in A Framework for Regulating Competition on the Internet:
The name ''platform'' is a descriptive one: it is the foundation on which entire ecosystems are built. The most famous example of a platform '-- one with which regulators are intimately familiar '-- is Microsoft Windows. Windows provided an operating system for personal computers, a set of APIs for developers, and a user interface for end users, to the benefit of all three groups: developers could write applications that made personal computers useful to end users, thanks to the Windows platform tying everything together'...
''Aggregator'' is also descriptive: Aggregators collect a critical mass of users and leverage access to those users to extract value from suppliers. The best example of an Aggregator is Google. Google offered a genuine technological breakthrough with Google Search that made the abundance of the Internet accessible to users; as more and more users began their Internet sessions with Google, suppliers '-- in this case websites '-- competed to make their results more attractive to and better suited to Google, the better to acquire end users from Google, which made Google that much better and more attractive to end users.
This excerpt raises a fair question: why did I include Google as a foundational company and not Facebook if they are both Aggregators? Three reasons:
Google controls the largest mobile platform in the world (Android).While Google Search is not essential to connecting users and websites, both users and websites behave as if it is, suggesting the sort of multi-sided network effects that are strong moats.Google has an ad platform that supports not only Google properties, but also YouTube and websites across the Internet.This last point is a crucial one: the word ''platform'' tends to evoke developers, but Google plays the same role connecting consumers, advertisers, and websites (both its own and 3rd-party) that Windows played connecting users, developers, and OEMs.
Facebook, meanwhile, has always been much more of a closed garden. It's most important content comes not from 3rd-parties, but rather its own users. Similarly, its advertising uses Facebook data on Facebook properties. This self-containment helped protect Facebook from Google and made it into the giant that it is, but it is a fundamentally more fragile position than the other big tech companies.
This is also why investing in security is, in the long-run, not simply altruistic. Facebook depends on users using Facebook properties because they choose to use Facebook properties; Facebook connects advertisers to those users, the advertisers are not a reason to stay on the platform. Absent 3rd-parties that make Facebook essential, Facebook has to do whatever it takes to ensure users don't leave the platform.
This is also why Facebook has invested so heavily in virtual and augmented reality. Zuckerberg knows the importance of platforms '-- remember, the entire reason Facebook ended up in the Cambridge Analytica scandal was in an attempt to make Facebook into a platform '-- and is betting that being early to the next paradigm will secure the company's position.
In fact, though, Facebook has a much larger opportunity.
FAN's Failed PromiseFacebook Audience Network is Facebook's ad platform for 3rd-party mobile apps, mobile websites, and video. It quite obviously exists, but it definitely doesn't seem to be getting much attention internally: the last time it was mentioned on an earnings call was in Q1 2018, and then only in a passing comment about increased transparency; the last substantive discussion was way back in Q2 2016.
It's easy to figure out why: any company, even one the size of Facebook, has to choose what to spend resources on; doing one thing means not doing another. And, in a competition between Facebook's own ad products and Facebook Audience Network, it was inevitable that Facebook Audience Network would lose:
First and foremost, Facebook Audience Network ads have lower margins. That is because Facebook has to share revenue with the site or app that shows an ad.Secondly, Facebook Audience Network ads have lower revenues because the best ad units are on Facebook properties! Any advertiser, for the same price, would rather advertise in Facebook's feed than on a 3rd-party app or site, because it performs better; that means the ads are never the same price.Third, the nature of digital advertising is such that Facebook has effectively unlimited inventory on its own properties, particularly with the explosion of Stories. That means the first two factors are always true.You can see a similar dynamic at Google: DoubleClick, its 3rd-party advertising business, was an acquisition, not home-grown, and even still the percentage of revenue generated on Google's own properties continues to grow. It's hard to resist focusing efforts on the ad products that make more money with better margins!
Still, it is DoubleClick that, more than anything, makes Google into an ad platform. DoubleClick introduces a third stakeholder '-- 3rd party websites and apps '-- into the equation, making Google that much stickier and essential. This is exactly what Facebook should do with Audience Network.
Facebook's OpportunityThe relative worth of investing in Facebook Audience Network relative to Facebook's own ads will never change; there are, though, good reasons for Facebook to invest anyways.
First, privacy regulation like GDPR or California's CCPA is much more challenging for 3rd-party advertising networks that rely on collecting user information across non-owned-and-operated sites than Facebook or Google. Facebook and Google already have superior targeting capabilities, and that advantage is only going to increase.
Second, Facebook's data is much better for display advertising; Google is superior at identifying and capitalizing on purchase intent, particularly through search but also re-targeting, but Facebook excels at building brands and surfacing things you didn't know you wanted. These categories are likely to be much more effective in most website or apps which are not necessarily about immediate conversions.
Third, the biggest reason to be bullish on Facebook is its dominance in digital advertising. As long as it has access to most customers, it will always be the default choice for advertisers; spending more time and attention on extending its advertising to 3rd-parties also extends the responsibility of attracting customers. Yes, this costs margin, but the payback is an even better moat.
The reason to bring this up now is the pressure Facebook is under, from PR to politics to the stock market:
A meaningful investment in the Facebook Audience Network would mean lower margins in the long run, so best to make the investment when investors are already grumpy about margins.So much of the media only sees Facebook as a competitor; Facebook is uniquely placed to be their benefactor.The PR angle is not obvious, but I do think that Facebook in the long run is likely to be recognized as the company that has made the greatest investment in security. This will make regulators more comfortable with Facebook being one of the few companies constructed to leverage user data for advertising.This article is not, by the way, my opinion on what is best for the world; rather, despite all of the company's bad press, my point is that Facebook is better positioned for the future than it appears. More privacy regulation, more attention on security issues, more concerns about Google leveraging its own position: all of these are opportunities for Facebook. The question is if it will leverage investor discontent to make the sort of shift that gives up margin to build moats. Facebook can finally have its platform '-- the timing is right '-- if it is willing to take the risk.
Rebecca Carnes, Ryan Lanza, Adam Lanza and the 2007 NHS Freshman Yearbook Oddities - James Fetzer
Mon, 03 Feb 2020 18:43
Could Adam Lanza really be a compilation of his brother Ryan Lanza and an unidentified young man featured in the 2007 Newtown High School yearbook?While at Newtown's Cyrenius Booth Library recently, I located the Newtown High School yearbook from 2006 which features Ryan Lanza as a graduating senior (see below pics).
Ryan Lanza is supposed to be about 4 years older than his brother Adam Lanza and Ryan was reported as being 24 years old at time of SH incident. So, a Newtown High School (NHS) graduation of 2006 would make sense for Ryan Lanza.
A Daily Mail article published on Dec. 16, 2012 stated that Adam Lanza was a member of the Newtown High School Tech Club in 2007 when he was a freshman (as shown in the below famous pic of Adam standing with his fellow Tech Club members). This information about Adam Lanza was widely circulated in the press. The Daily Mail article states:
In 2007, when he was a freshman, he was pictured along with ten of his classmates for a group photo of the 'Tech Club,' which 'allowed students to explore technology and promote events' on student TV.
The famous freshman 'Tech Club'' photo of Adam Lanza as widely publicized by the news media following the Sandy Hook event.However, the 2007 Newtown High School yearbook (pic below) that I viewed from the Cyrenius Booth Library collection, did not feature the same 2007 Tech Club photo as published in major news publications like the Daily Mail.
Cover of the 2007 Newtown High School yearbook that is contained in Newtown's Cyrenius Booth Library NHS yearbook collection that contains editions going back to the 1970s.
Tech Club photo as featured in a 2007 Newtown High School (NHS) yearbook housed at the Cyrenius Booth Library in Newtown, Conn. The 2007 school year would have been Adam Lanza's freshman year at Newtown High School, the only year he reportedly attended Newtown High School before being switched to home schooling for the remainder of his high school education in Newtown.
The actual 2007 NHS yearbook does not feature the well-publicized, alleged picture of Adam Lanza as a 'freshman' Tech Club member.
Ryan Lanza is indeed listed and pictured as a junior in this 2005 NHS yearbook that I viewed at the Cyrenius Booth Library in Newtown. However, the Newtown Library did not have the NHS 2004 yearbook in its collection which would have shown or listed Ryan Lanza as a sophomore. The Newtown Library did have a 2003 NHS yearbook in its collection, but the 2003 yearbook did not have Ryan Lanza pictured or listed in the 'Camera Shy' section as a freshman at Newtown High School in 2003.
The 2005 NHS yearbook has Ryan Lanza pictured as a junior.
Ryan Lanza pictured as a junior in the 2005 NHS yearbook.
Interestingly, the Tech Club picture from this same 2005 NHS yearbook appears to show Ryan Lanza standing towards the back (see below photo with red arrow).
A close-up of this 2005 Tech Club photo (below) appears to feature Ryan Lanza '' as exemplified by his characteristic sideways smile that can also be seen in his close-up photo above.
A Tech Club photo from the 2005 NHS yearbook appears to show Ryan Lanza with his signature sideways smile.The 2005 yearbook Tech Club photo also states that Mr. Rich Novia heads the Tech Club at Newtown High School. And Richard Novia (also the former head of security for Newtown schools) is mentioned and quoted in that same Daily Mail article:
Richard Novia, the school district's head of security until 2008, who also served as adviser for the school technology club, said Lanza clearly 'had some disabilities.
'If that boy would've burned himself, he would not have known it or felt it physically,'' Novia told The Associated Press in a phone interview. ''It was my job to pay close attention to that.'
Mr Novia described Lanza as 'a very scared young boy, who was very nervous around people he could trust or he refused to speak with,' Novia said.
'Somewhere along in the last four years, there were significant changes that led to what has happened,' Novia said. 'I could never have foreseen him doing that.'
The 2007 NHS yearbook also does not show Adam Lanza listed as a freshman and he is also not listed in the Class of 2010 'Camera Shy' students who missed photo day for the 2007 yearbook.Adam Lanza is not pictured or listed in the 2007 NHS yearbook as part of the freshman class of 2010. Adam Lanza was reported to have attended Newtown High School as a freshman in 2007 before switching to home school status for the remainder of his high school education in Newtown. He was also reported by the press to have been a 'freshman' participant in the Tech Club. If Adam Lanza graduated from Newtown High School in 2010 as widely reported in the media, he would have been a freshman in 2007.
Adam Lanza is also not listed in the 2007 NHS yearbook among the 'Camera Shy' freshman who missed picture day.
This is the freshman class of 2010 page as featured in the 2007 NHS yearbook in the Cyrenius Booth Library collection in Newtown, Conn.Another freshman class of 2010 page as featured in the 2007 NHS yearbook when Adam Lanza was reported to have been a freshman at the school before switching to home schooling the following school year. He reportedly never returned to NHS after his 2007 freshman year.
The Daily Mail article mentions two former classmates of Adam Lanza who said he ''hung out with the freaks'' and roamed the hallways carrying a briefcase (apparently during his freshman year since that is the only year he attended NHS):
Former classmate Olivia DeVivo said she remembered Lanza talking about 'blowing things up', but added: 'I put that down to the usual talk of boys. I think he went so unnoticed people didn't stop to think, ''There's something going on here '' maybe he needs some kind of help?''
'No one is surprised. He always seemed like he was someone who was capable of that because he didn't really connect with our high school, with our town.'
Another former school friend, Jamie Crespo, 19, said: 'He used to hang with the freaks, guys who dressed in trench coats.'
Other students remember him walking through school dressed in black, carrying a black briefcase.
That same article also strangely quotes 2010 NHS class president Ben Federman as saying he barely remembered Adam Lanza and neither did any of his classmates he spoke with while home in Newtown for Chirstmas break in 2012. But then he goes on to say that he remembered a specific detail about Adam Lanza '' that he always carried around a briefcase instead of a backback (even though he was just quoted as saying he barely remembered his classmate at all).
Newtown High School's 2010 class president Ben Federman is like the rest of his classmates '' he can barely remember Adam Lanza.
Mr Federman, who was home from attending college at Vanderbilt University, told MailOnline that he had heard from many graduates from the class of 2010 and none of them can think of a single friend Lanza had.
'The only time I ever saw him was in the hallway and he never seemed to engage anyone. He was just focused on walking from one class to another,' Mr Federman said.
His only memory of the 20''year-old Lanza was the bizarre way he dressed '' always in button-down shirts that were too big for him. He also usually had pens in his shirt pocket and usually carried a black leather briefcase.
'You noticed that because it was different. He carried a briefcase and not a backpack,' Mr Federman said.
Strangely, even though the Newtown Library has an extensive collection of Newtown High School yearbooks dating back to the 1970s, the years 2008, 2009 and 2010 (which would have been Adam Lanza's yearbook dates for his sophomore, junior and senior year, respectively) '' are all missing from the Cyrenius Booth Library collection in Newtown. I do not know if home schooled students are included in photos or ''Camera Shy'' lists for NHS yearbooks.
As a side note '' I did notice a picture of an odd-looking, unidentified young man featured in the ''Clubs'' section of the 2007 NHS yearbook with a similar hairdo and facial features as the pictures of Adam Lanza widely circulated in the media. Again, the 2007 NHS yearbook would have been Adam Lanza's freshman year at Newtown High School.
This unidentified young man is featured in the ''Clubs'' section of the 2007 NHS yearbook and has similar facial features and hair as the widely circulated photos of Adam Lanza in the media following the Sandy Hook event.
''Clubs'' page in the 2007 NHS yearbook, which was reportedly Adam Lanza's freshman year before he switched to being home schooled in 2008.
This photo collage (below) shows the similarity in facial features of the unidentified young man featured in the 2007 NHS yearbook ''Clubs'' page with the pictures of Adam Lanza circulated in the press.
Rebecca Carnes is a third-generation resident of Newtown whose two children were second graders within the Newtown Public School system during the 12/14 (Sandy Hook) event. She also is the creator and writer of a local blog covering issues relevant to Newtown, Connecticut: https://www.newtownroosterct.com/
Email Rebecca at dandelion1972@protonmail.com. To help Rebecca continue her research and writing, please consider making a donation to support her efforts. paypal.me/NewtownRooster
Correspondence may also be sent to Rebecca at the following address:
P.O. Box 3671
Newtown, CT 06470
Rush Limbaugh reveals advanced lung cancer diagnosis
Mon, 03 Feb 2020 14:05
| February 03, 2020 02:59 PM
Conservative radio host Rush Limbaugh revealed that he has been diagnosed with advanced lung cancer.
On his radio show Monday, Limbaugh, 69, also said that he would likely miss some time on the program while he undergoes treatment.
This is a developing story. Check back for updates.
Viral Immunity - Coronavirus, flu, and more | Genetic Lifehacks
Mon, 03 Feb 2020 10:33
Our genome is shaped by the pathogens that our ancestors survived. This is really pretty cool '' you carry specific genetic variants that were passed down to you from the ancestors who lived through diseases and epidemics. Throughout history, humanity's biggest threats for survival have been the microscopic pathogens that we now battle successfully with antibiotics, antifungals, vaccines, clean water, etc. All of the genetic variants that gave your ancestors a survival advantage in ages past are still written in your genome today.
Let me give you a few examples:
People who carry a sickle-cell anemia mutation are likely to have an ancestor who survived malaria.One copy of a cystic fibrosis mutation could have protected your ancestors from dying from cholera.The CCR5Î--32 variant is protective against HIV / AIDS. It is theorized that it may also have protected against the black death in the Middle Ages.About 20% of the population carries a variant that prevents them from secreting their blood type '' and this also protects them from getting the norovirus and the rotavirus (aka the stomach flu). [ref]Let's take a look at how the immune system works '-- using the coronavirus that is all over the news right now as an example. Then I'll bring in some of the other genetic variants that gave your ancestors superpowers to defeat tiny microbes.
How does the body protect against viruses? Viruses are not considered to be living organisms because they don't have a cellular structure. Instead, they have to get inside a cellular organism in order to reproduce. Biologists define viruses as small, infectious agents. They can infect your cells and then hijack your own cellular processes to replicate themselves. After replication they spread to other cells, causing more replication and cell death.
Your body has several lines of defense against pathogens '' multiple ways to go to battle, defending the body from out of control viral or bacterial invaders. Just like the military has multiple branches (Army, Navy, Air Force, Marines) and specialized groups within those branches, your immune system has several ways of detecting, isolating, killing, and defending against pathogens.
First, the virus must enter the cell. Some viruses need a cell entry receptor to bind to in order to get into the cell. This is the case with HIV, and a mutation in the cell entry receptor CCR5 can prevent HIV from entering a cell and replicating.
For this current coronavirus outbreak, initial publications indicate that the cell entry receptor for this coronavirus is the same as for the SARS virus '' the ACE2 (angiotensin-converting enzyme 2) receptor. [ref '' preprint] [ref]
For viral infections, interferons are the first wave of defenders. White blood cells produce several different types of interferons to act against a wide range of viruses. Interferons act in a couple of different ways:
Interferons are cytokines that signal to other cells to protect against the spread of the virus.Interferons bind to interferon receptors in adjacent cells, which triggers changes in those adjacent cells in order to resist the viral infection. This basically produces a firewall around the cell that contains the viruses.Interferons also stimulate the cells to produce antiviral enzymes.Pattern recognition receptors are also a part of the innate immune system, which is how the body recognizes foreign invaders. There are several subtypes of pattern recognition receptors including Toll-like receptors (TLRs), nucleotide-binding oligomerization domain (NOD), retinoic acid-inducible gene 1 (RIG-1) -like receptors, and the C-type lectin receptors (CLRs). [ref]
These pattern recognition receptors are found on immune cells, such as macrophages and neutrophils, and they detect specific parts of a microbe (bacteria, virus, etc) and alert the immune system to attack it.
Two specific pattern recognition receptors are TLR3 and TLR4 (toll-like receptor 3/4), and these are what the body uses to identify the SARS coronavirus. [ref][ref]
What exactly is the coronavirus? This latest coronavirus outbreak in January 2020 isn't the first coronavirus to scare everyone with headlines of 'pandemic' and 'outbreak'. Past coronavirus outbreaks include:
SARS '' severe acute respiratory syndrome: a coronavirus outbreak that started in 2002-2003, infecting 8,000 people with a 10% mortality rate.MERS '' Middle East respiratory syndrome: became prevalent in 2012 with a 35% mortality rate.Other strains of the coronavirus, though, just cause common, cold-like symptoms. Most coronavirus strains are found in animals, but there have been human coronaviruses known since the 1960s.
Viruses change, creating new strains. And these altered strains can be carried by animals, as well as infecting humans. This current coronavirus outbreak is thought to originate in animals (probably bats[ref]) and is now capable of spreading via human-to-human contact. [ref]
How do different genetic variants protect against pathogens? Genes are the blueprint for the proteins that make up the various components of the immune system. You have genes that code for the proteins that act as cellular receptors, the different pattern recognition receptors, several types of interferon, the various cytokines needed to destroy the pathogens, cell signals, and more. It's a complicated system that keeps us resilient and able to fight off various types of pathogens, including new viruses and bacteria.
Genetic variants can cause slight differences in how any single part of the immune system works. Each of us is unique '' able to easily fight off certain foreign invaders and slightly more susceptible to others. As a whole, this makes the human population resilient and powerful. Some people may be more susceptible to certain pathogens while others may have a mutation that protects them against that specific foreign invader.
There are, of course, trade-offs. Variants that give protection against a specific pathogen often have a downside such as increased cancer risk or increased risk of inflammatory conditions[ref][ref]. So if you are battling with an overactive immune response, just keep in mind that it may be the same genetic variant that helped an ancient ancestor to survive a leprosy outbreak and then reproduce, passing along the variant.
Which genetic variants protect against this new coronavirus? Ha! It is way too soon to know that information for the coronavirus responsible for the current outbreak in Wuhan, China (2019-nCoV).
In the genetics section below are a couple of variants that influenced the susceptibility to the SARS coronavirus, but it is too soon to know if those variants would influence susceptibility to this new strain of the virus.
Genetic variants that influence viral susceptibility: While it is too soon to know who is more susceptible to the new coronavirus strain, there are many well-studied genetic variants that interact with other viruses.
Below are several examples of differences in viral susceptibility that you may find interesting. Note that this is just a sampling of the well-studied variants and not everything currently known to researchers.
Genetic variants that protect against the flu: Influenza '' the flu '' can be caused by several different strains of the virus. It tends to change and trend with different strains going around periodically.
Interestingly, studies show that the majority of people exposed to a new flu strain don't get the flu '' they remain asymptomatic.[ref]
The H3N2 strain has been prevalent for the past few years. Genetic variants in the cytokine producing interleukin genes have been found to alter people's susceptibility to the flu. These variants don't completely protect you from getting the flu -just statistically make it less likely that you will come down with it. You still need to take the usual precautions against the flu'... complications from the flu kill a lot of people each year. [ref]
The IL-1β gene codes for interleukin-1 beta, an inflammatory cytokine important in the immune response.
Check your genetic data for rs16944 (23andMe v4, v5; AncestryDNA):
A/A: typical risk for H3N2 fluA/G: typical risk for H3N2 fluG/G: less than half the risk for H3N2 flu [ref]The IL-28 gene codes for interleukin-28.
Check your genetic data for rs8099917 (23andMe v4, v5; AncestryDNA):
T/T: typical risk for H3N2 fluG/T: ~ half the risk for H3N2 fluG/G: ~ half the risk for H3N2 fluThe TNF gene codes for the TNF-alpha cytokine, which is important in the immune response.
Check your genetic data for rs361525 (-238G/A) (23andMe v4 )
A/A: less TNF-alpha, increased risk of H1N1 flu and complications [ref]A/G: typical immune response to the fluG/G: typical flu responseGenetic variants that influence HIV susceptibility: The CCR5 gene (chemokine receptor type 5) codes for a protein on the cell membrane.
Check your 23andMe results for i3003626 (v4, v5) also known as rs333:
Insertion/Insertion (either II or GTCAGTATCAATTCTGGAAGAATTTCCAGACA/GTCAGTATCAATTCTGGAAGAATTTCCAGACA): typical and not resistant to HIVInsertion / Deletion (either DI or -/GTCAGTATCAATTCTGGAAGAATTTCCAGACA): One copy of CCR5-delta 32 mutation; a slower progression from HIV to AIDs, significantly reduced mortality risk from HIV[ref] [ref]Deletion / Deletion (either DD or -/-): Two copies of CCR5-delta 32 mutation; resistant to most strains of HIV [ref][ref][ref]Genetic variants associated with general susceptibility to several common viruses: The TLR3 gene codes for a part of the body's pattern recognition response.
Check your genetic data for rs3775291 (23andMe v4, v5; AncestryDNA):
C/C: most common genotypeC/T: decreased risk of hepatitis B virus, decreased risk of dengue fever, decreased risk of herpes simplex virus type 2T/T: decreased risk of hepatitis B [ref]; decreased risk of dengue fever[ref]; decreased risk of herpes simplex virus type 2[ref]The CCL2 gene codes for an inflammatory cytokine involved in the recruitment of monocytes and other immune system cells needed at the site of an inflammatory response.
Check your genetic data for rs1024611 (23andMe v4, v5; AncestryDNA):
A/A: typicalA/G: typical risk of SARSG/G: increased risk of SARS coronavirus.[ref]The MBL2 gene codes for mannose-binding lectin 2, which is part of the immune system that recognizes carbohydrate signatures from foreign pathogens.
Check your genetic data for rs1800450 codon 54 (23andMe v4, v5; AncestryDNA):
T/T: reduced mannose-binding lectin; increased risk of SARS coronavirus [ref]; increased susceptibility to tuberculosis[ref]C/T: somewhat reduced mannose-binding lectin; increased risk of SARS coronavirus [ref]C/C: typicalLifehacks for preventing viral illnesses Obviously, the first steps in preventing contagious diseases are to wash your hands frequently and avoid being around people who are contagious. I mentioned above that antibiotics, antifungals, etc have been important in fighting off pathogens, but really '' mankind took a huge step forward in resisting diseases with the implementation of basic hygiene, including simple hand washing (with soap) and having clean water.
Beyond the obvious '' what else actually works, according to research, for boosting your ability to fight off a virus?
Resveratrol has been shown in studies to inhibit viruses, including flu, Epstein-Barr, RSV, and other common viruses. It is thought to inhibit viral replication. Cell studies show that resveratrol inhibits the MERS coronavirus, but it isn't clear whether this holds true in people.[ref][ref]
Elderberry '' specifically the species Sambucus FormosanaNakai '' has been shown in cell studies to have antiviral activity against the coronavirus NL63 (not the Wuhan strain). The study found that the caffeic acid in the elderberry extract may block the virus from attaching and replicating. [ref]
Mushroom extracts from lions mane and reishi protect against the dengue virus '-- in cell studies. [ref] Reishi has long been used as an immune system booster. It has been shown in cell studies to inhibit the replication of enterovirus 71 (causes hand, foot, and mouth disease)[ref] Cordyceps helps out with the flu '' in mice. [ref]
Will drinking red wine (for the resveratrol, of course) and eating mushrooms prevent you from getting the coronavirus or anything else that is going around? Yeah'... well'... Personally, I'm going to stick to frequent hand washing and avoiding sick people as my best bet for virus prevention.
Related Genes and Topics Are you a non-secretor? Your genes control the species of bacteria that live in your gut microbiome. And your gut microbiome can help defend against '-- or make you vulnerable to '-- diseases. People who are non-secretors of their blood type due to a FUT2 variant are protected from getting the norovirus and rotavirus.
Familial Mediterranean Fever Familial Mediterranean fever (FMF) is a genetic condition of inflammatory episodes that cause painful joints, pain in the abdomen, or pain in the chest, and is most often accompanied by a fever. FMF is often misdiagnosed as various pain-related conditions such as fibromyalgia, myofascial pain syndrome, or gouty arthritis.
Author Information: Debbie Moon Debbie Moon is the founder of Genetic Lifehacks. She holds a Master of Science in Biological Sciences from Clemson University. Debbie is a science communicator who is passionate about explaining evidence-based health information. Her goal with Genetic Lifehacks is to bridge the gap between scientific research and the lay person's ability to utilize that information. To contact Debbie,
visit the contact page.
Speaker Nancy Pelosi Refuses to Abide by Supreme Court Ruling on Trump Travel Ban '' News With Views
Mon, 03 Feb 2020 10:32
By NWV Senior Political News Writer, Jim Kouri
The Democratic Party, especially its leaders in both Houses of the U.S. Congress, has demonstrated time and time again that they place little, if any, interest in protecting American citizens. They've also demonstrated that their interest in the U.S. Constitution is how it can be used to actually hurt American people, according to former Chief of Detectives Scott Myers of the Saratoga P.D., and current security director and consulting detective.
A perfect example of their propensity to be an anti-Constitution political movement is being ignored by the news media who prefer to intensify their assistance to the Deep State and the Democratic Party in overthrowing the Donald Trump presidency.
For example, Speaker of the House Nancy Pelosi, D-California, is angrily refusing to accept a U.S. Supreme Court ruling that confirmed President Trump's legal right to enforce a travel ban.
Pelosi, in the midst of the Trump Impeachment Trial, revealed that the Democratic-controlled House will vote on a bill to repeal President Donald Trump's travel ban, which he ordered to counter the arrival in America of individuals from the world's terrorist havens, especially in the Middle East, Latin America and parts of North Africa.
Following weeks of Democrats accusing the Trump administration of racism and unfairness, the Supreme Court ruled that the president had the legal authority to operate the travel ban, which bars citizens of certain countries with high rates of extremist violence from entering the U.S. on national security grounds.
Despite the Supreme Court decision, Pelosi said the House Judiciary Committee will propose and fight for her party's bill dubbed ''The National Origin-Based Anti discrimination for Non immigrants'' or ''NO BAN Act,'' which was penned by Representative Judy Chu, Pelosi's fellow Democrat from California.
''House Democrats continue to stand opposed to President Trump's cruel, un-American travel ban in all of its iterations,'' Pelosi said in a statement, adding that the bill will ''prohibit religious discrimination in our immigration system and limit the President's ability to impose such biased and bigoted restrictions.''
''Her recent statements show us that Pelosi is willing to allow criminals, terrorists and sexual predators entry into the United States even if these immigrants are a threat to citizens. And she doesn't care if they kill or injure Americans,'' said former police lieutenant Mark Franin now a police academy instructor.
''It is essential that we take away the president's power to put prejudice into policy,'' Chusaid at a press conference.
House Judiciary Committee Chairman Jerry Nadler confirmed on Monday that his committee will take up the travel ban repeal legislation in about two weeks. Pelosi's announcement comes days after the Trump administration revealed it's considering adding 7 additional counties to the travel ban. The Trump White House is considering adding Belarus, Myanmar, Eritrea, Kyrgyzstan, Nigeria, Sudan, and Tanzania.
Administration officials have argued that its travel restrictions are essential to national security, due to countries named on the list not adequately vetting travelers to the U.S. At one congressional hearing during the Obama administration, FBI Director James Comey admitted there is no realistic way for the feds to vet aliens, especially criminal aliens who possess aliases galore.
The first travel ban currently in effect and upheld by the U.S. Supreme Court restricts U.S. entry to Iranians, Libyans, Somalis, Syrians and Yemenis, Venezuelans, and North Koreans.
Several left-wing and Marxist groups such as the American Civil Liberties Union, the Southern Poverty Law Center (SPLC) and others have filed legal challenges to the travel ban, but each case met with failure.
The Supreme Court has clearly ruled that whoever is the president of the United States ''Democrat or Republican '-- can legally restrict immigration for national security purposes. Trump vowed to keep the nation safe, and many Americans would agree he has done that since taking office.
''Even though Nancy Pelosi hastily rammed impeachment through Congress and got her way, she isn't done doing damage. President Trump was always her #1 target, but now she's got a new target in her crosshairs: Congressional Conservatives,'' said Rep. Liz Cheney, R-Wyoming, in an email to the National Association of Chiefs of Police (NACOP) on Wednesday.
''[It] comes as no shock that Nancy Pelosi would like to see our voices removed from Congress, and I know right now she's rallying her supporters to see us defeated,'' stated Cheney, the daughter of former Vice President Dick Cheney (2001-2009), in her statement to NACOP.
(C) 2020 NWV '' All Rights Reserved
Contact Jim Kouri '' E-Mail: COPmagazine@aol.com
News With Views Senior Political News Writer, Jim Kouri.Jim Kouri, CPP is currently fifth vice-president of the National Association of Chiefs of Police. He's former chief at a New York City housing project in Washington Heights nicknamed "Crack City" by reporters covering the drug war in the 1980s. He's also served on the National Drug Task Force and trained police and security officers throughout the country. He writes for many police and crime magazines including Chief of Police, Police Times, The Narc Officer, Campus Law Enforcement Journal, and others. He's appeared as on-air commentator for over 100 TV and radio news and talk shows including Oprah, McLaughlin Report, CNN Headline News, MTV, Fox News, etc. His book Assume The Position is available at Amazon.Com, Booksamillion.com, and can be ordered at local bookstores. Email: COPmagazine@aol.com
Moira Gilchrist answers questions about It's Time | PMI - Philip Morris International
Mon, 03 Feb 2020 07:53
Philip Morris International's VP of Strategic and Scientific Communications, Dr Moira Gilchrist explains the It's Time campaign and the company's vision for a smoke-free future.Philip Morris International (PMI) is marking World No Tobacco Day with a call for a new dialogue about tackling the global issue of smoking. We think It's Time to talk about smoke-free alternatives and the current tobacco regulations.
Our message is clear. If you don't smoke, don't start. If you smoke, quit. If you don't quit, change. However, many smokers are being denied the opportunities to have information about and access to better alternatives than continued smoking.
We believe It's Time to have a new conversation with regulators and health bodies about the future of the world's 1 billion smokers. We want to evolve World No Tobacco Day on May 31 into World No Smoking Day.
PMI launched the It's Time campaign at the Wall Street Journal Future Of Everything Festival in New York City on May 20, 2019. Attending the festival, Dr Moira Gilchrist, PMI's VP of Strategic and Scientific Communications answered some questions about the It's Time campaign and why now is the time to have a conversation.
Why do you call this campaign It's Time?We call this campaign It's Time because we know now from science that there are better alternatives for men and women who smoke. We think it's now time to have a different conversation. One that really brings men and women who smoke to the very center, and talk about how good tobacco policy can enable new opportunities for those smokers, those men and women who would otherwise continue to use cigarettes. To really learn about these products, to be given information about them and most importantly, to have access to them so that they can make a change. We're really excited about the conversations we've had here at the Future of Everything Festival because there's a lot of interest. People didn't know these products existed. Everybody knows a smoker, everybody loves the people that they know who smoke and they've been very interested in the opportunity that these new products can bring for them.
So PMI has already launched the campaign Unsmoke. How does it relate to It's Time?We're here talking about It's Time to Unsmoke. That's really about a simple set of messages we have. For adults around the world, our message is clear: If you don't smoke, don't start; If you do smoke, quit; but if you don't quit, then change. There are better alternatives around than continuing to use cigarettes and we want adult smokers to know about them. So the It's Time component is about asking society to enter into a new conversation about tobacco products, a new conversation about their regulation and a new conversation about how we can communicate to men and women who smoke about these alternatives so they can make informed choices.
What would you say the biggest challenge is for PMI in communicating to smokers about these new products?The biggest challenge we face at PMI in communicating to men and women who smoke is regulation. Innovation moves with a much faster pace than regulations. Most of the current tobacco regulations worldwide never envisaged that there could be alternatives to combustible cigarettes. So there is either no regulation, which creates ambiguity, or they try to apply the same rules as for combustible cigarettes which does not make sense.So our challenge is to have a dialogue with regulators, to talk with people in public health and to really have a conversation that puts science and technology and facts at the center as well as the men and women who smoke. That's really what our presence here at this festival is about: getting that message across. There is a need, an urgent need I believe, for a new conversation.
Could you tell us about PMI's smoke-free portfolio and, in particular, heated tobacco?At Philip Morris International, many years ago, we decided to create a range of different products that had the potential to be better alternatives to continuing to smoke. We did this because we knew there wouldn't be one single product that would meet the needs of every single adult smoker around the world. So we have electronic cigarettes, or e-vapor products in our portfolio but we also have a group of products called heated tobacco products. They work by heating tobacco at temperatures lower than combustion. It's the combustion of tobacco that creates the vast majority of the harmful chemicals that cause smoking related diseases. Heated tobacco is a really promising technology that delivers the taste and flavor that adult smokers are used to, but science shows they're a much better alternative than continuing to smoke.
What does innovation for you mean in the context of PMI?Innovation in the context of PMI today means opportunity. It means an opportunity for the 9 out of 10 adult smokers who continue smoking each year. I think innovation in technology and innovation in science means we've been able to develop and assess better alternatives than continuing to smoke. I'm really excited that we have the opportunity to talk about those products and talk about the science here at the Future of Everything Festival.
We all know cigarette smoking is harmful and addictive. What is the main problem?It is the burning of tobacco. When a cigarette is lit, the tobacco burns and creates smoke. In cigarette smoke more than 6,000 chemicals have been identified and public-health authorities have classified approximately 100 of them as causes or potential causes of smoking-related diseases. So our approach has been to develop and scientifically assess a range of different products that don't burn tobacco. One of the promising types of products we have in our portfolio is heated tobacco products. They still contain tobacco, they still deliver taste and flavor, but with far lower levels of those harmful chemicals. These products are still addictive as they contain nicotine and they're not risk-free, but all of the science shows that they're a much better choice than continuing to smoke cigarettes.
What is the one thing you would tell anyone who comes to speak to you about PMI?The one thing I like to tell people we've been having discussions with this week is: put your thoughts and feelings about the industry I come from, the company I come from, to the side for a minute and let's just have a conversation about today's facts, that's based on today's science and based on the opportunity that science and technology can bring a billion people around the world who are smoking today. I think if people can spend just a moment, put their thoughts aside and do some critical thinking about the opportunity that these products present, then I think we can go a long way to changing the conversation all across the globe.
Related Articles
Coronavirus wreaks havoc on tech supply chain
Mon, 03 Feb 2020 07:37
The Wuhan coronavirus is wreaking havoc within the global technology supply chain, as many Chinese provinces extend the new year holiday in an effort to contain the spread of the deadly disease.
Underlining the concerns for the tech industry, Taiwan's Hon Hai Precision Industry, which is also known as Foxconn and makes the majority of the world's iPhones, suffered its biggest share price fall in almost 20 years on Thursday.
Elsewhere, shares of Japanese electronics parts makers and other tech groups with exposure to China were hit hard, with Murata Manufacturing, Tokyo Electron and Sharp all suffering dips of more than 3 per cent as a result of anxieties about disruption to supply chains.
The wobbles came after the governments of six Chinese provinces, including manufacturing hubs crucial for the global technology industry such as Shanghai, Jiangsu, Guangdong and Chongqing, mandated that the return to work after the Lunar New Year be delayed by a week to February 10 for all but essential industries.
''The coronavirus creates a more uncertain environment than the trade war'‰.'‰.'‰.'‰and the scale of the impact is bigger than Sars,'' said Gary Cheung, a director at Haitong Securities in Hong Kong specialising in industrial technology.
The growing disruption to the world's second-largest economy comes as China's health authority said on Thursday that 170 people had died from the coronavirus and nearly 7,800 cases had been confirmed worldwide.
By contrast, 8,098 people were infected by severe acute respiratory syndrome, or Sars, during the outbreak in 2003, which killed 774 people, according to the World Health Organization.
RecommendedHow dangerous is new coronavirus and how does it spread?Mr Cheung said that the companies hit hardest by the outbreak would likely be those that relied on significant manpower in China '-- which, in addition to Foxconn, included Pegatron, the Taiwanese contract electronics manufacturer.
''Semiconductor manufacturing is heavily automated, whereas companies such as Foxconn and Pegatron rely heavily on labour-intensive assembly, which [is] more exposed,'' said Mr Cheung.
Analysts said the most immediate impact would be felt by those with operations in Wuhan, the Chinese city at the centre of the outbreak. These include flat panel display television fabrication plants owned by China Star, Tianma and BOE, which are estimated to account for up to 9 per cent of global capacity.
The Chinese government has barred people from leaving Wuhan and Hubei, the province surrounding it, and severely restricted them from moving around in public '-- measures that have forced most industrial production in the province to grind to a halt.
DSCC, a consultancy focused on the display industry supply chain, said China Star was not expected to reopen until mid-March. ''Thus, their Q1 '20 shipments are most definitely at risk,'' the consultancy said in a research note.
Because of the extended holiday in the six provinces, the technology supply chain could suffer beyond Hubei. Some 290 of about 800 plants named in Apple's global supplier list are located in regions that have delayed returning to work.
However, it remains unclear how strictly the Chinese government is enforcing the work restrictions. Semiconductor and LCD panel fabrication plants cannot easily stop production without huge losses and therefore usually continue running through the holidays.
LG Display and memory chipmaker SK Hynix, both of which have plants in the provinces where the government ordered a delayed return to work, said their factories there had been operating normally through the lunar new year holiday and continued to do so.
Additional reporting by Song Jung-a in Seoul, Sue-Lin Wong in Shenzhen and Hudson Lockett in Hong Kong
CopyrightThe Financial Times Limited . All rights reserved. Please don't copy articles from FT.com and redistribute by email or post to the web.
Coronavirus: China's stock market plummets as country's death toll climbs past 360 '' live updates | World news | The Guardian
Sun, 02 Feb 2020 23:49
12.43am EST 00:43
Trading has resumed on China's stock markets after the lunch break. The losses have been staunched slightly from the falls of almost 9% earlier in the day but it's still very ugly. Oil has lost 51c to $56.11 a barrel, reflecting concerns about slowing demand in the global economy.
The Shanghai Composite is off 7.91%Shenzhen Component down 7.59%The Australian ASX200 has closed down 1.34%The Nikkei is off 0.85%Kospi in Seoul is down 0.12Hang Seng up 0.26%Brent crude loses 51c to $56.11 a barrel The yuan has fallen to 7.01 to the US dollar, its worst since AugustFutures point to 0.55 lift on FTSE100Dow Jones expected to rise 0.75%https://twitter.com/S_Rabinovitch/status/1224199130555117568
Interesting that the Hong Kong market is up today. It's the only major bourse in the black and perhaps says more about the medium term outlook on the markets, where many expect the Chinese econonmy to bounce back once the virus is under control.
Simon Rabinovitch (@S_Rabinovitch)The 8% plunge in Chinese stocks today is, understandably, making headlines. But good reporters all note that this is catch-up after a long holiday. More surprising is the stability in HK market. Do investors really think they've priced in the effects of the epidemic? pic.twitter.com/ry24SzXxNF
February 3, 2020 12.41am EST 00:41
There seems a fairly concerted effort just now to put a positive spin on how China is handling the virus, with a series of tweets from state media. They include:
The government promising to purchase the surplus production from enterprises when coronavirus epidemic ends The overall production of face masks in China exceeding 20m per day '' ''the highest in the world''The virus stimulating online shopping and online entertainment, despite its impact on other industries. ''China has better capabilities to contain the economic impact of the epidemic compared to the time of SARS outbreak: official'', reports the Global TimesMy personal favourite is this video below from CGTN, which says people have chosen to stay in Wuhan because of ''love, people and responsibilities''. ''Everyone is united and we will work together to battle the coronavirus,'' it says, adding: ''I believe everything will be back to normal. Cherry blossoms will bloom, streets will be busy and people will have hot dry noodles for breakfast at restaurants.''
CGTN (@CGTNOfficial)''My city is hit by the coronavirus, but we will get through it''This video is for everyone who is fighting against the #coronavirus https://t.co/k7je5yy5LE pic.twitter.com/2Co0ABzOzU
February 3, 2020A close second is the People's Daily most recent post of a field of ''thriving'' rape flowers. ''That's the brightness we need,'' the post says.
People's Daily, China (@PDChina)That's the brightness we need! A vast field of thriving rape flowers light up the Meijiang County in E China's #Jiangxi. pic.twitter.com/VY5Oe65o4P
February 3, 2020Updatedat 12.47am EST
12.26am EST 00:26
The city of Guyuan, 1,200km north-east of Wuhan, has brought in new measures to stop the virus spread according to state-run media. It means no more than 25 people are allowed in every 100 sq metres in public venues.
Global Times (@globaltimesnews)Strictest measure to curb the spread of #nCoV2019! No more than 25 people allowed in every 100 square meters in public venues, announced the govt of Guyuan, a city in Ningxia Hui Autonomous Region. pic.twitter.com/Rh1i2yalWM
February 3, 2020 12.14am EST 00:14
Hong Kong medical workers go on strike, demanding closure of China borderHundreds of Hong Kong medical workers walked off their jobs on Monday, demanding the city close its border with China to reduce the coronavirus spreading - with frontline staff threatening to follow in the coming days. Hong Kong has 15 confirmed cases of the virus. The action by non-essential medical staff comes as authorities refuse to completely seal the border, instead closing down some crossings.
Medical workers hold a strike near Queen Elizabeth Hospital, demanding Hong Kong close its border with China to reduce the coronavirus spreading. Photograph: Tyrone Siu/Reuters 12.08am EST 00:08
The extended lunar new year ended in China today, raising concerns that travel across the country could impact the spread of the virus. Agence France-Presse reports that in Beijing, some neighbourhoods have sealed themselves off '' including with homemade barriers '' to force visitors or anyone returning home from the holiday to register their travel history.
One district in northern Shijiazhuang city is offering cash incentives of 2,000 yuan ($288) AFP says, for reporting anyone who has travelled to Wuhan in the past two weeks.
For some communities, anyone who has visited central Hubei province - of which Wuhan is the capital - is no longer welcome at all.
''Even if you live here, you can't enter,'' said a security guard at the entrance of a Beijing neighbourhood when asked about returning Hubei residents.
''Those from Hubei could bring the infection here,'' he told AFP, wearing a blue mask. ''If you're from Hubei, you have to notify the neighbourhood committee.''
Chinese residents line up to get a free protective mask at a local pharmacy in Beijing. Photograph: Kevin Frayer/Getty Images 11.57pm EST 23:57
France's evacuation flights from Wuhan carry 36 people showing virus symptomsFrances's health minister has confirmed that 36 people on an evacuation flight from Wuhan were showing symptoms of the coronavirus.
In all, 254 people arrived in France from the Chinese city of Wuhan, where the deadly virus was first detected, on the second such flight.
''About 20 people who presented symptoms have stayed on the tarmac,'' at Istres airport in the south of France to undergo further testing, Agnes Buzyn said. They included French and non-European nationals, Agence France-Presse reported.
Tests were carried out to establish whether they had the coronavirus and the results will be known on Monday.
Passengers are checked as they disembark from a plane carrying French citizens flown out of Wuhan. Photograph: HANDOUT/ECPAD/AFP via Getty ImagesA further 16 foreign nationals displaying symptoms were flown back to their respective countries.
The second evacuation flight was carrying people of 30 different nationalities, most of them European. Sixty five of the returnees were French.
A total of 124 non-French evacuees swiftly travelled on to their home countries, according to military sources in Istres, AFP says.
Nine Belgians and three of their partners as well as 15 Dutch citizens and their two Chinese partners were isolated after travelling on from Istres to a military airport near Brussels, according to Belga news agency.
However, 60 others from Mexico, Rwanda, Brazil and Georgia remained on French soil, Buzyn told reporters.
So far in France, only six cases of coronavirus have been detected.
A bus carrying French citizens flown out of Wuhan is escorted by the French Gendarmerie from the Istres-Le Tube Air Base near Istres, on its way to The Vacanciel Holiday Resort in Carry-le-Rouet, where other people are in quarantine following their repatriation, on February 2, 2020. - G7 countries will dis. Photograph: Clement Mahoudeau/AFP via Getty ImagesUpdatedat 12.10am EST
11.32pm EST 23:32
China's state-run People's Daily is publishing pictures of the air force bringing in medical staff and supplies to Wuhan.
People's Daily, China (@PDChina)Eight large transport aircraft dispatched by the Chinese People's Liberation Army (PLA) air force Sunday landed at Wuhan Tianhe International Airport, delivering 795 military medical staff and 58 tonnes of supplies to help the city fight against the novel #coronavirus epidemic. pic.twitter.com/AjKL34xVwp
February 3, 2020 11.24pm EST 23:24
Vietnam confirms three new casesVietnam has confirmed three new cases of coronavirus, bringing the total cases in the country to eight.
Women wear protective masks while they take part in morning exercises by the Hoan Kiem lake in Hanoi, Vietnam. Photograph: KHAM/Reuters 11.13pm EST 23:13
11th case confirmed in the USHealth officials in California said there were now 11 confirmed case of the virus in the country, adding three to the previous tally.
A woman in Santa Clara county and the family she is staying with are being quarantined and she is now in isolation at their home. However, the woman, who recently travelled to Wuhan, was not sick enough to require hospitalisation.
The other two cases involve a married couple in San Benito county, the San Benito county public health services announced in a release late Sunday.
10.39pm EST 22:39
SummaryHere's a summary of what we know so far today on the coronavirus outbreak:
361 people have died in China, one in the PhilippinesConfirmed infections in China are 17,238 (official Chinese figures include Taiwan, Hong Kong Macao)Outside of China, infections stand at more than 150 (for simplicity of comparison between the numbers, I have removed Taiwan [10], Hong Kong [15] and Macao [8] from this global figure)China's markets plunged on opening, on the first day of trading since the extended lunar new year. Shanghai fell 8.7%A Qantas charter flight carrying Australian citizens has departed WuhanNew Zealand has banned foreign travellers from China from enteringThe new hospital in Wuhan, built to accommodate coronavirus patients, is due to open on MondayUpdatedat 11.05pm EST
10.20pm EST 22:20
The eastern Chinese city of Wenzhou in Zhejiang province on Sunday closed roads and confined people to their homes to try and stop the spread of the virus. Wenzhou, an industrial port city, is 800km (500 miles) from Wuhan, where the health emergency began. It has a population of around three million.
Passengers wearing protective faceasks sit as they arrive at the Beijing Capital International Airport. Photograph: Noel Celis/AFP via Getty Images 9.52pm EST 21:52
Three officials in China's Zhejiang province are reported to have been ''penalised for their negligence of duty after failing to report seven infected cases'' of coronavirus, Chinese state media is reporting.
9.41pm EST 21:41
One source of figures on the deaths and infections from the coronavirus that we have been referring to is from Johns Hopkins University in the US. Its tracker shows Chinese and global cases of infections and deaths, including visual representations of the virus. Below is a snapshot of what it's showing now. The headline figures are:
17,318 confirmed cases globally362 deaths globally (all in China except one in Philippines)It's worth noting that they separate out cases in Hong Kong, Macao and Taiwan, whereas the Chinese Health Commission groups them in their figure all under China.
Graph showing global infections from the coronavirus as collated by Johns Hopkins university. Photograph: Johns Hopkins University CSSEUpdatedat 9.42pm EST
9.40pm EST 21:40
China's currency, the yuan, is also having a torrid time today. It has fallen back through the seven-to-the-dollar mark to trade at its lowest point since December.
The higher the number the weaker it is because, unlike with most other currencies, its movements tend to be expressed in yuan rather than the US dollar. For example, the Aussie dollar is usually quoted in US cents '' today its standing at US66.9c.
YUAN TALKS (@YuanTalks)Onshore #yuan and offshore yuan both break through 7/USD mark pic.twitter.com/0TcWVWeZTj
February 3, 2020 Tom Orlik (@TomOrlik)Yuan crashes through 7 to the dollar pic.twitter.com/qRUvDqSerW
February 3, 2020
The IRS is done letting TurboTax easily steer you away from filing taxes for free - The Verge
Sun, 02 Feb 2020 23:42
Earlier this year, ProPublica published a report showing how Intuit, the company behind TurboTax, was misleading users into paying to file their taxes '-- something that's supposed to be free in the first place for many. They, along with H&R Block, went so far as to keep the free versions from showing up in search engine results. This made it harder for users to find the free versions online, and many people ended up paying to file their taxes when they really didn't have to. Now, ProPublica reports that the IRS is taking steps against this.
On Monday, the IRS released an addendum to its Free File program '-- the agreement with tax preparation companies intended to keep tax filing free '-- that now prohibits these companies from hiding the pages that allow you to file for free from Google and other search engines. They've also eliminated a restriction against the IRS making its own filing software.
In several other countries, filing your taxes is a lot easier. The government uses data it already has on your income to fill out your taxes. But in the United States, Intuit has spent millions each year lobbying against these simpler systems which would eliminate the need for their services. Tax industry lobbying was how the IRS's Free File was initially created, with the IRS agreeing to leave it up to those companies.
The Free File program initially said that filing software had to allow lower- and middle-income taxpayers to be able to file for free. In return, the IRS agreed to not make its own free filing software, something that the tax preparation companies thought could be a big competitor to their business. The new addendum also requires all these tax preparation companies to give their truly free options a specific badge: ''IRS Free File program delivered by [Member company name or product name],'' so you can tell them apart from other versions which might sneakily require you to pay.
When ProPublica published their groundbreaking report in April, they found that TurboTax's main page didn't even link to the page that lets you file for free. You couldn't access the free version from TurboTax.com at all. Some of the links in the free version of TurboTax would link to the paid version, tricking you into paying more than you should. And TurboTax had also deliberately targeted students and low-income users with the paid version of their service, moving necessary forms like student loan interest deduction into the ''Deluxe'' tier. But the IRS isn't addressing those sorts of tricks with its new restrictions, so it's quite possible Intuit and other tax prep companies will have plenty of other ways to make their money.
In the meanwhile, Intuit is currently facing investigations over its practices leading people to pay for what is legally a free service.
DNC Members Discuss Changing Rules To Stop Sanders From Getting Nomination At Convention, Report Says | The Daily Wire
Sun, 02 Feb 2020 23:27
Members of the Democratic National Committee (DNC) have reportedly started discussing the implementation of a plan aimed at harming Democrat presidential candidate Sen. Bernie Sanders (I-VT), a socialist, in hopes of derailing his campaign.
''In conversations on the sidelines of a DNC executive committee meeting and in telephone calls and texts in recent days, about a half-dozen members have discussed the possibility of a policy reversal to ensure that so-called superdelegates can vote on the first ballot at the party's national convention,'' Politico reported. ''Such a move would increase the influence of DNC members, members of Congress and other top party officials, who now must wait until the second ballot to have their say if the convention is contested.''
Politico noted that it's an uphill battle for those who want the rule change, but that ''the talks reveal the extent of angst that many establishment Democrats are feeling on the eve of the Iowa caucuses.''
''The decision to relegate superdelegates '' now called 'automatic delegates' '' to the second ballot in a contested convention consumed the DNC for nearly two years after the 2016 election. Superdelegates overwhelmingly sided with Hillary Clinton, infuriating Sanders' supporters,'' Politico added. ''The rule change was widely viewed as a major victory for the Democratic Party's left flank. At the time, Perez called the delegate overhaul 'historic,' while progressive Democrats and many moderates lauded its appeal to young voters skeptical of centralized party power.''
The Democrat Party has already started to put its thumb on the scales with new rules that it announced that favored Democrat billionaire Michael Bloomberg.
The New York Times reported:
The D.N.C. announced Friday that in order to participate in the debate, set for Feb. 19 in Las Vegas, a candidate must win at least a single delegate in either the Iowa caucuses or the New Hampshire primary or meet polling requirements.
It has eliminated the requirement that candidates must have received donations from hundreds of thousands of individuals. Mr. Bloomberg, a multibillionaire, is running a self-funded campaign and is not soliciting donations.
The changes, which represent the most significant tightening of debate requirements this cycle, set off a fresh and pointed round of criticism at a critical moment in the race, as several campaigns braced for the reality check that the Iowa caucuses will provide. And the edict from party officials, which some saw as a concession to Mr. Bloomberg, quickly reignited concerns among those who believe the D.N.C.'s shifting rules for the debates privilege some candidates and campaigns over others.
The Sanders campaign responded by telling The New York Times: ''To now change the rules in the middle of the game to accommodate Mike Bloomberg, who is trying to buy his way into the Democratic nomination, is wrong. That's the definition of a rigged system.''
Just before jumping into the race, @MikeBloomberg gave $325,000 to the DNC, on top of the gobs he spent on ads this month. Totally normal system. pic.twitter.com/u4JDelWb7H
'-- Ryan Grim (@ryangrim) January 31, 2020
Failed far-left Green Party presidential candidate Jill Stein responded to Politico's report by writing on Twitter: ''Desperate DNC members consider rule change to let superdelegates vote on 1st ballot to stop Sanders. If the DNC rigs another election against its voters, it'll be asking for biggest #DemExit yet by those who want an actually democratic party. #DNCRigging''
Dave Wasserman, U.S. House editor of the non-partisan Cook Political Report, wrote: ''Yeah, this is going to end well.''
Left-wing journalist Ben Norton wrote: ''After rigging the primary in 2016 and stealing numerous states from Bernie Sanders, a small group of unelected corporate-funded DNC elites are plotting to steal the election from him again, reversing the policy to give unelected superdelegates more power.''
New York Times columnist Elizabeth Bruenig wrote: ''they're going to throw it to trump, but that's alright with them, because he's not going to raise their taxes''
This is a developing news story, refresh the page for updates.
Iran's Quds Force to work with Hamas, Islamic Jihad against Trump deal | The Jerusalem post
Sun, 02 Feb 2020 23:25
Hamas said that Iran's support will strengthen its morale and resolve ''to liberate Palestine.'' Hamas Chief Ismail Haniyeh attends a meeting with members of international media at his office in Gaza City, June 20, 2019
(photo credit: MOHAMMED SALEM/ REUTERS)
The new leader of Iran's
Islamic Revolutionary Guard Corps (IRGC) Quds Forces phoned Ismail Haniyeh of Hamas and Islamic Jihad's Ziad Nakhaleh to stress Iran's support for opposition to the US ''deal of the century'' plan. The plan was announced on January 28 and Iran's Quds Force commander Esmail Ghaani is now moving to bolster Palestinian resistance against it.
The report at Iran's Tasnim and Mehr News media appears to be the first major act of Ghaani after he took over from Qasem Soleimani in early January. The US killed Soleimani in a January 3 airstrike in Iraq. Iran has appointed Mohammed Hejazi as Ghaani's deputy. Hejazi is an expert on trafficking precision guided munitions to Hezbollah in Lebanon. Israel has expressed concern about Hezbollah's development of precision guidance.
Ghaani had separate calls with Islamic Jihad and Hamas. In November last year Israel killed a leading Islamic Jihad commander in Gaza. Iran is a major supporter of Palestinian Islamic Jihad and Iranian Foreign Minister
Mohammad Javad Zarif spoke to Nakhaleh twice after the November fighting. In the phone calls Iran emphasized ''firm support'' for the Palestinians in their struggle against the Trump administration's deal. It is ''doomed to failure,'' the IRGC says. The US views the IRGC as a terrorist group.
Ghaani stressed how Iran's view of supporting Palestinians has not changed in the wake of Soleimani's death. In fact, it may become stronger. ''American statesmen are seeking to please Zionists,'' the Iranians said. The Palestinian factions in turn said hat they would not abandon their historic rights and Trump's deal will fail. Islamic Jihad said that the Palestinians had no choice but to confront the deal and he said Iran's role is principled and part of the ''path of resistance.'' Iran calls its allies in Lebanon, Iraq, Syria and Yemen part of the ''arc of resistance'' that Iran supports.
Hamas said that Iran's support will strengthen its morale and resolve ''to liberate Palestine.'' Hamas also spoke to Turkey's President yesterday to coordinate opposition to Trump's plan and Israel. Hamas also commemorated the legacy of Soleimani and wished Ghaani success in carrying out the mission of the Quds Force.
Islamic Jihad criticized the Palestinian Authority for continued security cooperation with Israel. Mohammed Al-Hindi, one of the group's leaders in Gaza, slammed Mahmoud Abbas and claimed that Abbas had held a secret meeting with the CIA in Ramallah. He based his comments on media reports in Iranian media that said the head of the CIA had visited Ramallah. Hindi said that if the PA did not immediately stop security coordination with ''the occupiers'' it would lose credibility. In recent days Abbas has said Palestinians should unite against the deal of the century and said he would cut ties with the US and Israel. Rocket and mortar fire has increased from Gaza in the last week.
var cont = ` Sign up for The Jerusalem Post Premium Plus for just $5 Upgrade your reading experience with an ad-free environment and exclusive content Join Now >
`;document.getElementById("linkPremium").innerHTML = cont;var divWithLink = document.getElementById("premium-link");if(divWithLink !== null && divWithLink !== 'undefined'){divWithLink.style.border = "solid 1px #cb0f3e";divWithLink.style.textAlign = "center";divWithLink.style.marginBottom = "40px";divWithLink.style.marginTop = "40px";divWithLink.style.width = "728px";}(function (v, i){});
Kevin Shipp on Twitter: "Hilarious. Trump: ''Uh, very little. I just think of little. You know, now he wants a box for the debates to stand on ....Why should he get a box to stand on, okay? He wants a box for the debates. Why should he be entitled to tha
Sun, 02 Feb 2020 23:23
Hilarious. Trump: ''Uh, very little. I just think of little. You know, now he wants a box for the debates to stand on ....Why should he get a box to stand on, okay? He wants a box for the debates. Why should he be entitled to that? Really. Does that mean everyone else gets a box?''
pic.twitter.com/pZF1ssyTyN

Clips & Documents

Art
Image
Image
All Clips
Ask Adam Guess the goofball Iowa moment.mp3
Astounding ISO.mp3
Backup to the backup - ISO.mp3
Biden to Voter in Iowa - 'I'm beginning to see why your wife left you'.mp3
Bloomberg in Spanish.mp3
CNN - Symone Sanders of Biden campaign damage control message.mp3
CNN Panel Dump On Biden - He Doesn't Have a Great History Running for President.mp3
Democrat SOTU response Grentchen Whitmer ASMR.mp3
Donald Trump - ‘Little’ Michael Bloomberg Wants a Box to Stand on at Next Debate.mp3
Emily Tisch Sussman MSNBC pundit says if you support Bernie Sanders over Elizabeth Warren it’s “showing your sexism.”.mp3
fake emergency message in MN.mp3
Head of FBI Dr.Wray, Sent a Letter APOLOGIZING for the ILLEGAL WIRETAPPING of PRESIDENT TRUMP.mp3
How Many Lies Has Trump Told - Jimmy Kimmel Explains In A Way Even POTUS Can Understand.mp3
Hung up on me full Bro;f Iowa.mp3
I Will Never Vote Democrat Again Say Angry Dems on C-SPAN After Pelosi's Tantrum.mp3
immdiately after the impeachment back to work cspan.mp3
IMPEACH Lisa DJ FOUR MIXED PBS.mp3
IMPEACH Lisa DJ ONE PBS.mp3
IMPEACH Lisa DJ THREE REPS PBS.mp3
IMPEACH Lisa DJ TWO DEMS PBS.mp3
Interesting old clip from around 2010 re blackwater.mp3
Jake Tapper tells Bernie spokesperson that Des Moines polling problem was a GLITCH.mp3
John Kelly turns on Trump CSPAN.mp3
John Kerry in Iowa shilling for Joe - Protest much.mp3
judy questions unbalanced PBS.mp3
MN collecting person infor for parties.mp3
MSNBC - John Kerry overheard discussing possible 2020 bid amid concern of 'Sanders taking down the Democratic Party'.mp3
NA Jingles - Simply Unimpeachable - Close Jingle.mp3
NA Jingles - Simply Unimpeachable - Open Jingle.mp3
NPR Pre-Iowa App -1- Intro 'Big Test' for Democracy.mp3
NPR Pre-Iowa App -2- Closed box secrecy raises questions.mp3
NPR Pre-Iowa App -3- Security and BACKUPS.mp3
NPR Pre-Iowa App -4- What could possibly go wrong.mp3
PBS IOWA Guy analyzes caucus.mp3
Rick Wilson - Lincoln Project on Bill Mahr - Dirty stuff with our skills.mp3
Schiff - If Trump Isn’t Removed He Could Offer Alaska to the Russians In Exchange For Support In The Next Election.mp3
Schiff closing speech used for Eleven Films Ad - Remember America - We do.mp3
Schumer do you then her - ISO.mp3
schumer is astounded.mp3
Scott adams on Trump gaffe.mp3
Speaker Nancy Pelosi on why she ripped up President Trump’s speech - Because it was the courteous thing to do considering the alternatives.mp3
Trump introduces Juan Guaido at SOTU.mp3
Trump SOTU Stanktuary.mp3
TYT's Emma Vigeland -2- Popular vote and the app.mp3
TYT's Emma Vigeland BOTG slams media for dismissing Bernie's popular vote lead.mp3
Unavailable for comment KTLA.mp3
Van Jones Warns Democrats - Trump Is Helping African-Americans In Real Life.mp3
vandana Shiva Attacks Gates.mp3
Watchman Home by Rekor - License Plate Recognition for Home Security.mp3
Weisstein horrors part two Lauren Young.mp3
wind tax cred PTC bkgrounder.mp3
wind tax credit phasing out.mp3
yargh ISO.mp3
Youtuber Status Quo on next day retraction of results data.mp3
0:00 0:00